Articles on this page are available in 2 other languages: Chinese (Simplified) (5), Spanish (26) (learn more)

Overview

Brief Summary

Biology

This social marine mammal forms groups consisting of up to 100 individuals (2); those inhabiting coastal areas generally form the smallest schools, of 5 to 15 dolphins (4). These schools, which may be segregated by age and sex, have a fluid structure, with dolphins joining and splitting into smaller groups, although long-term bonds are also formed within this gregarious social system (2) (5). In the Bahamas, Atlantic spotted dolphins are often known to associate with bottlenose dolphins as they travel and search for fish, squid and bottom-dwelling invertebrates on which to feed (2). The Atlantic spotted dolphin is an acrobatic species, frequently riding the bow waves of boats (4), leaping out of the water, and playing at every opportunity (5). It is also capable of diving to up to 60 metres, remaining underwater for up to 6 minutes (2). It is known to be preyed on by sharks, but killer whales and other small-toothed whales may also be predators of this dolphin (2). Mature female Atlantic spotted dolphins give birth every one to five years, with the average interval between births being three years. The young is nursed for up to five years, and females become sexually mature at an estimated eight to fifteen years of age (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Often observed in the clear, shallow waters surrounding the Bahamas, the Atlantic spotted dolphin is said to be an intermediate in appearance between the bottlenose dolphin and pantropical spotted dolphin (4). Its sturdy body is light grey, with a dark grey 'cape' on the back, and a white belly (4). A light streak extends up the shoulder, ending just below the dorsal fin, one feature which differentiates this species from the similar pantropical spotted dolphin (2). As the name suggests, many individuals are patterned with spots, although not all. All calves are unspotted (4), but some will develop spots as they age, with a number of dolphins becoming so heavily spotted they appear white from a distance (2). The beak of the Atlantic spotted dolphin is fairly long and sharply demarcated from the melon, and the dorsal fin is tall and sickle-shaped. Atlantic spotted dolphins inhabiting the far-offshore waters of the Gulf Stream can be smaller and completely unspotted, even as adults (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

The Atlantic spotted dolphin is seen in coastal waters from the Carolinas south to Brazil, usually staying within about 350 km of the coast. Another population in known from the Gulf Stream near New England. Calves have no spots at birth, and begin to be spotted about the time that they are weaned. Adults have a white belly with dark spots, and a darker back with pale spots. They feed on a great variety of fish, squids, and invertebrates that live at the bottom of the sea. Newborns measure 0.88 - 1.2 m in length, and the length of adults is 1.7 - 2.3 m.

Links:
Mammal Species of the World
  • Original description: "Cuvier, G. [Baron], 1829.  ""Le règne animal distribue d'après son organisation, pour servir de base a l'histoire naturelle des animaux et d'introduction a l'anatomie comparée"". Les mammifères. Nouvelle édition, revue et augmentée. Deterville, Paris. 1, p. 288."
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

This species is found only in the Atlantic Ocean, from southern Brazil to the United States (New England) in the west, and to the coast of Africa in the east (the exact limits off West Africa are not well known – Perrin 2002a,b). A discontinuity in the range of the species exists in the western South Atlantic Ocean (Moreno et al., 2005).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Stenella frontalis, the Atlantic spotted dolphin, is found in the tropical and temperate waters of the Atlantic Ocean (Wilson and Reeder, 1993).

Biogeographic Regions: atlantic ocean (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cape Cod to South America
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Atlantic, Azores Exclusive Economic Zone, European waters (ERMS scope), Gulf of Mexico, North West Atlantic
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: Tropical, subtropical, and warm temperate Atlantic, including Gulf of Mexico and Caribbean Sea (Perrin 2002); locality records mapped in Perrin et al. (1987).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Found only in the Atlantic, this spotted dolphin occurs from southern Brazil to New England in the west, to the coast of Africa in the east (4), generally between 50°N and 25°S (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

As the common name spotted dolphin suggests, S. frontalis has a spotted color pattern on its body. These spots are not present at birth, and generally do not appear until the onset of weaning. The first spots to appear on the calves are dark spots on the animal's ventral surface. As the dolphin approaches puberty, the ventral spots increase in number and size and pale dorsal spots appear as well. The number of spots continues to increase with age, similar to the development of spotting in Stenella attenuata. There is a large amount of variation in the adult color pattern, between populations and between individuals. At times some individuals become so heavily spotted that they appear white from a distance. Spotting seems to decrease with the distance from the continental shores of North America. In the Azores some specimens have had few or no ventral spots, but well developed dorsal spotting.

The beak of S. frontalis is long and narrow, a typical feature of all Stenella dolphins. S. frontalis has a robust head and body, that make it larger in size, but not length, than S. attenuata. Proportionately larger flippers, flukes and dorsal fins are also characteristic of S. frontalis. The average adult body length of the Atlantic spotted dolphin is 166-229cm. The adult S. frontalis females tend to be slightly larger than the males, and an average adult weight is approximately 200 pounds (90k).

The skull of the Atlantic spotted dolphin varies in size with individuals and with geographical region. Skull size is generally correlated with body size. S. frontalis has small conical teeth, 3-5mm in diameter. In each rostral row there are 32-42 teeth, and 30-40 teeth in each mandibular row. S. frontalis have on average a distally broader rostrum and fewer but larger teeth than S. attenuata. At times differentiating between these two spotted dolphins is difficult, especially in areas where they converge geographically. (Ridgway, 1994;   http://wwwa.com/dolphin/index.html, 1999;   http://whales.ot.com, 1999).

Average mass: 90 kg.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 229 cm

Weight: 143000 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size in North America

Length:
Range: 1.7-2.3 m

Weight:
Range: up to 143 kg
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Type for Stenella frontalis (Cuvier, 1829)
Catalog Number: USNM A3884
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Unknown;
Preparation: Skull
Collector(s): J. Varden
Locality: Locality Unknown, North Atlantic, Locality Unknown, Locality Unknown, Locality Unknown
  • Type: Cope, E. D. 1866. Proc. Acad. Nat. Sci. Philadelphia. 18: 296.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Distribution is mostly over the offshore continental shelf, but these dolphins also inhabit deep oceanic waters. The species is known from far-offshore Gulf-stream waters and the mid-tropical Atlantic (Perrin et al. 1987). The large, heavily spotted form of the Atlantic spotted dolphin along the south-eastern and Gulf coasts of the United States inhabits the continental shelf, usually being found inside or near the 200 m isobath (within 250-350 km of the coast), but sometimes coming into very shallow water adjacent to the beach seasonally, perhaps in pursuit of migratory fish (Perrin et al. 1987). In the Bahamas, Atlantic spotted dolphins spend much time in shallow water (6-12 m) over sand flats. The smaller and less-spotted forms that inhabit more pelagic offshore waters and waters around oceanic islands are less well known in their habitat requirements (Perrin et al. 1994; Jefferson and Schiro 1997. In the north-central and western Gulf of Mexico. Atlantic spotted dolphins were consistently found in the shallowest waters on the continental shelf and along the shelf break within the 250-m isobath (Davis et al. 1998). In addition, the bottom depth gradient (sea floor slope) was less for Atlantic spotted dolphins than for any other species.

A wide variety of epi- and mesopelagic fishes and squids, as well as benthic invertebrates, are taken by this species (Perrin et al. 1994). There are known to be some regional differences in diet.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Along the southeastern and Gulf coasts of the U.S., Stenella frontalis inhabits the continental shelf, usually within 250-350 km of the coast. In the Bahamas, the Atlantic spotted dolphin spends most of its time in the shallow water over sand flats. (Ridgway, 1994;   http://whales.ot.com, 1999).

Aquatic Biomes: coastal

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

tropical to warm temperate, mostly offshore over continental shelf
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 839 specimens in 1 taxon.
Water temperature and chemistry ranges based on 693 samples.

Environmental ranges
  Depth range (m): 0 - 2450
  Temperature range (°C): 3.137 - 27.711
  Nitrate (umol/L): 0.157 - 19.752
  Salinity (PPS): 32.419 - 36.503
  Oxygen (ml/l): 4.363 - 6.303
  Phosphate (umol/l): 0.049 - 1.306
  Silicate (umol/l): 0.769 - 23.647

Graphical representation

Depth range (m): 0 - 2450

Temperature range (°C): 3.137 - 27.711

Nitrate (umol/L): 0.157 - 19.752

Salinity (PPS): 32.419 - 36.503

Oxygen (ml/l): 4.363 - 6.303

Phosphate (umol/l): 0.049 - 1.306

Silicate (umol/l): 0.769 - 23.647
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Marine

Comments: Along southeastern U.S.: continental shelf, usually inside or near 185 m contour (within 250-350 km of coast); sometimes moves into very shallow water near shore (usually replaced in shallow water by Tursiops). Offshore distribution poorly known.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The Atlantic spotted dolphin inhabits tropical and warm temperate waters. It is found most often in waters over the continental shelf, but may also inhabit deep oceanic waters in some areas (4). In the Bahamas, this species can be observed in clear, shallow waters, between 6 and 12 metres deep, over sandflats (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

The diet of Stenella frontalis varies with location. They eat a variety of invertebrates, as well as small eels and herring. They have even been known to follow trawlers to eat discarded fish. Other feeding habits include feeding at or near the surface and "tracking" schools of small fish. (Ridgway, 1994;   http://whales.ot.com, 1999).

Animal Foods: fish

Primary Diet: carnivore (Piscivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Eats fishes (e.g., clupeoids, carangids, sciaenids, congrids, gadids, trichiurids, triglids) and squid; may eat fishes discarded from trawlers (Perrin et al. 1987).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Pods usually consist of fewer than 50 individuals, typically 5-15 in coastal waters (Perrin et al. 1987). In the western Atlantic, average first-year mortality rate was 24% (Herzing 1997).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Reproduction

Females are generally sexually mature at 9 years. Males do not reach sexual maturity until their 12th year. There is evidence of year round mating, and gestation is between 11 and 12 months long. Calves are normally born in May and September. There have been some observations of pods segregated by reproductive status as well as sex and age. (  http://whales.ot.com, 1999).

Breeding season: There is evidence of year round mating

Range gestation period: 11 to 12 months.

Average age at sexual or reproductive maturity (female): 9 years.

Average age at sexual or reproductive maturity (male): 12 years.

Key Reproductive Features: year-round breeding ; gonochoric/gonochoristic/dioecious (sexes separate); viviparous

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

In the western Atlantic, lactation lasted up to 5 years; calving interval 1-5 years (mean 3, 3-4 in females whose calf survived the first year); age of first parturition estimated at about 10-12 years; pregnancy rate varied annually, 7-57%; birth rate 6-14% (Herzing 1997).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Stenella frontalis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AATCACAAAGACATTGGTACCCTATATTTACTATTTGGCGCTTGAGCAGGAATAGTAGGTACCGGTCTAAGTTTGTTGATTCGTGCTGAATTAGGTCAACCTGGCACACTTATCGGAGAC---GACCAGCTTTATAATGTTCTAGTGACAGCTCATGCCTTCGTAATAATTTTCTTTATAGTTATACCTATCATAATTGGAGGTTTTGGGAACTGATTAGTCCCCTTAATAATCGGAGCCCCTGACATAGCATTCCCTCGTCTAAACAACATAAGCTTCTGACTACTCCCCCCTTCCTTTCTACTACTAATAGCATCTTCAATAATTGAGGCCGGCGCAGGTACAGGCTGAACTGTTTACCCTCCTCTAGCCGGAAATCTAGCACATGCAGGAGCCTCAGTAGACCTTACTATTTTCTCTCTACATTTAGCCGGTGTATCTTCAATCCTTGGAGCTATTAACTTCATCACAACTATCATTAATATAAAACCACCCGCTATAACTCAATACCAAACACCCCTCTTCGTCTGATCAGTCCTAGTCACAGCAGTCTTACTTTTACTATCATTACCTGTTCTAGCAGCCGGAATTACTATACTACTAACCGATCGAAATCTAAACACAACCTTTTTCGACCCGGCAGGAGGAGGTGACCCAATCTTATATCAACACTTATTCTGATTTTTTGGCCATCCTGAAGTATATATTTTAATTCTACCCGGCTTTGGAATAATTTCACACATCGTTACTTATTATTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Stenella frontalis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
DD
Data Deficient

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Hammond, P.S., Bearzi, G., Bjørge, A., Forney, K., Karczmarski, L., Kasuya, T., Perrin, W.F., Scott, M.D., Wang, J.Y., Wells, R.S. & Wilson, B.

Reviewer/s
Rojas-Bracho, L. & Smith, B.D. (Cetacean Red List Authority)

Justification
Although the species is widespread, abundance has not been estimated for the mid- and eastern Atlantic. Bycatches in West Africa are of unknown scale and potentially large.

History
  • 1996
    Data Deficient
  • 1994
    Insufficiently Known
    (Groombridge 1994)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Stenella frontalis is listed in Appendix II of the Convention of International Trade in Endangered Species of Wild Fauna and Flora (CITES). Those listed in Appendix II, as stated on the CITES web site,are "species which although not necessarily threatened with extinction may become so unless trade is subject to strict regulation." As well as non-threatened species that must be subject to regulation in order to control threatened species. (  http://www.wcmc.org.uk/CITES/english/index.html).

CITES: appendix ii

IUCN Red List of Threatened Species: data deficient

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: NU - Unrankable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Data Deficient (DD) on the IUCN Red List (1) and listed on Appendix II of CITES (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Data from surveys in the 1990s were used to estimate abundance in the northern Gulf of Mexico at 30,947 (CV=27%), although NMFS considers this an underestimate due to survey limitations (Waring et al. 2006). There are no data available from West Africa, but the few records available suggest that it is either not abundant or that it has an offshore distribution there (Van Waerebeek et al. 2000). A geographically and possibly genetically isolated population may occur off southern Brazil from 21-33°S (Moreno et al. 2005).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
No direct killing is known, other than occasional catches in small Caribbean dolphin fisheries, possible off West Africa and possibly in the Azores (Jefferson et al. 1993; Perrin et al. 1994).

Incidental catches in fisheries are known for several areas of the range (Brazil, the Caribbean, off the east coast of the United States, and in Mauritania). Some are probably also taken incidentally in tuna purse seines off the West African coast (Van Waerebeek et al. 2000). There are no reliable estimates of the number of animals taken in any of these fisheries (Jefferson et al. 1993). Atlantic spotted dolphins are also captured incidentally in gillnets in Brazil and Venezuela (Zerbini and Kotas 1998). In Venezuela, the dolphin carcasses are used for shark bait and for human consumption (Perrin et al. 1994). Mignucci-Giannoni et al. (1999) found that the most common human-related causes observed in strandings were entanglement and accidental captures, followed by animals being shot or speared. Niero et al. (1999) reported that in 1995, a large number of Atlantic spotted dolphins washed ashore on the sandy beaches north of Nouakchott, the capital of Mauritania. Workers surveyed the coastline to assess the number of corpses and the cause of death, which was attributed to fishery interaction.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Incidental take in the eastern tropical Atlantic tuna purse-seine fishery off West Africa could be considerable; level of incidental take in this and other fisheries needs investigation (see IUCN 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

There are two potential threats facing this dolphin; it is hunted in the Caribbean Sea, and possibly elsewhere along the coast of South America and West Africa, for food or bait (6), and it is killed incidentally in fisheries in many parts of its range when it becomes entangled in fishing gear (2). However, it is not known how many Atlantic spotted dolphins are killed in this manner, and therefore it is not known to what extent this species is threatened with extinction; consequently, the IUCN have classified this species as Data Deficient (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The species is listed in Appendix II of CITES.

Abundance and bycatch in fisheries off West Africa should be investigated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

While the Atlantic spotted dolphin has been extensively studied in the Bahamas (2), information on the global status of this species is lacking (1). Further research may be required to determine this dolphin's conservation status and what, if any, conservation measures need to be implemented. While hunting of the Atlantic spotted dolphin continues in some areas (6), elsewhere, dolphin-watching tours give the opportunity for people to see these charismatic animals at sea (5), and provide an incentive for local people to conserve them.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

The cost and complexity of the tuna fishery has been increased because of regulations that have been designed to lessen the number of dolphins killed by tuna fisherman.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

In the past dolphin flesh was considered a delicacy. Besides being used for food, certain parts of its body were used for medicinal purposes. For example, the oil from the liver was used to treat ulcers. Today zoologists are interested in dolphins because they have a high intelligence level. Due to their high intelligence level, dolphins have been trained to help in underwater salvage operations and have even taken part in military exercises. (Stephen, 1973).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Uses

Comments: Taken in subsistence harpoon fishery at St. Vincent, Lesser Antilles; possibly also at St. Lucia and Dominica (Perrin et al. 1987).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Risks

IUCN Red List Category

Data Deficient (DD)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Atlantic spotted dolphin

The Atlantic spotted dolphin (Stenella frontalis) is a dolphin found in the Gulf Stream of the North Atlantic Ocean. Older members of the species have a very distinctive spotted coloration all over their bodies.

Contents

Taxonomy [edit]

The Atlantic spotted dolphin was first described by Cuvier in 1828. Considerable variation in the physical form of individuals occurs in the species, and specialists have long been uncertain as to the correct taxonomic classification. Currently, just one species is recognised, but a large, particularly spotty variant commonly found near Florida quite possibly may be classified as a formal subspecies or indeed a species in its own right.

Atlantic spotted dolphins in the Bahamas have been observed mating with bottlenose dolphins.[3] Rich LeDuc has published data that suggest the Atlantic spotted dolphin may be more closely related to bottlenose dolphin (genus Tursiops) than to other members of the genus Stenella.[3]

Description [edit]

Stenella frontalis, La Gomera
Near South Caicos, Turks and Caicos Islands

The coloring of the Atlantic spotted dolphin varies enormously as they grow. Calves are a fairly uniform grey colour. When the calves are weaned, they then begin to get their spots. Juveniles have some dark spots on their bellies, and white spots on their flanks. Their back and dorsal fins are a darker grey than the rest of the body. As the animal matures, the spots become denser and spread until the body appears black with white spots at full maturation.

The Atlantic spotted dolphin has a three-part coloration: dark gray back, lighter sides, and a white belly.

Measurements at birth:

Length: about 35–43 in (89–110 cm)
Weight: unavailable

Maximum measurements:

Length:
Male 2.26 m (7 ft 5 in)
Female 2.29 m (7 ft 6 in)
Weight:
Male 140 kg (310 lb)
Female 130 kg (290 lb)

This is a medium-sized dolphin in both length and weight. At full size, South American spotted dolphins are about 2.2-2.5 m in length. Compared to the much smaller pantropical spotted dolphin, the Atlantic spotted dolphin is more robust. It lives in common waters with the pantropical spotted dolphin and the bottlenose dolphin.

In common with other species in its genus, the Atlantic spotted dolphin is a gregarious creature. It is a fast swimmer and keen bow-rider, and prone to acrobatic aerial displays.

Population and distribution [edit]

The species is endemic to the temperate and tropical areas of the Atlantic Ocean. It has been widely observed in the western end of the Gulf Stream, between Florida and Bermuda. It is also present in the Gulf of Mexico. More infrequent sightings have been made further east, off the Azores and Canary Islands. Northerly sightings have been made as far north as Cape Cod across to the southwestern tip of Spain. They are certainly present further south, too, as far as Rio Grande do Sul in Brazil and across to west Africa, but their distribution is poorly understood in these areas.

About 20 years ago, only about 80 dolphins were in the Bahamas. Now, almost 200 dolphins are found there. On account of their similar appearance to other dolphins in their range, it is difficult to be sure of the Atlantic spotted dolphin's population. A conservative estimate is around 100,000 individuals.

Human interaction [edit]

Some Atlantic spotted dolphins, particularly some of those are around the Bahamas, have become habituated to human contact. In these areas, cruises to watch and even swim with the dolphins are common.

Atlantic spotted dolphins are an occasional target of harpoon fishermen, and every year some creatures are trapped and killed in gill nets, but these activities are not currently believed to be threatening the survival of the species. This species lives in the mesopelagic layer of the ocean

Conservation [edit]

The Atlantic spotted dolphin is included in the Memorandum of Understanding Concerning the Conservation of the Manatee and Small Cetaceans of Western Africa and Macaronesia[4]

See also [edit]

References [edit]

  1. ^ Mead, J. G.; Brownell, R. L., Jr. (2005). "Order Cetacea". In Wilson, D. E.; Reeder, D. M. Mammal Species of the World (3rd ed.). Johns Hopkins University Press. pp. 723–743. ISBN 978-0-8018-8221-0. OCLC 62265494. 
  2. ^ HammondHammond, P.S., Bearzi, G., Bjørge, A., Forney, K., Karczmarski, L., Kasuya, T., Perrin, W.F., Scott, M.D., Wang, J.Y., Wells, R.S. & Wilson, B. (2008). Stenella frontalis. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 7 October 2008.
  3. ^ a b Herzing, D. (2011). Dolphin Diaries: My 25 Years with Spotted Dolphins in the Bahamas. Macmillan. pp. 132–147. ISBN 978-0-312-60896-5. 
  4. ^ Western African Aquatic Mammals MoU, Memorandum of Understanding Concerning the Conservation of the Manatee and Small Cetaceans of Western Africa and Macaronesia
  • Whales Dolphins and Porpoises, Mark Carwardine, Dorling Kindersley Handbooks, ISBN 0-7513-2781-6
  • National Audubon Society Guide to Marine Mammals of the World, Reeves, Stewart, Clapham and Powell,and there is no characteristics for survival. ISBN 0-375-41141-0
  • Perrin, William F. (2002). "Stenella frontalis". Mammalian Species (702):1–6.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Includes S. plagiodon (S. pernettensis plagiodon of Hall 1981) and several other nominal species (Perrin et al. 1987).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!