Overview

Distribution

Range Description

This species is found in fourteen states within the United States of America.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

endemic to a single nation

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (20,000-2,500,000 square km (about 8000-1,000,000 square miles)) Northeastern North America: A substantial total known range from northeastern Maine, southwest to Ohio, south to South Carolina (Needham and Westfall 1955). Area approximately 650 x 2,000 kilometers = 1,300,000 square kilometers (approximately 400 x 1,200 miles = 480,000 square miles).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species is found in clean sandy or rocky streams and also rivers with muck (a type of soil mostly made up from humus from drained swampland) deposits.

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Lotic. Overall habitat is clear rivers and streams. There appears to be little known regarding habitat and microhabitat requirements of this species but a mature female was taken perched in the short grasses beside the St. George River in Maine in 1997. The river at this point is moderately wide and shallow, with clear water running over a cobble bottom and few macrophytes.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 to >300

Comments: Based on inventory data from Maine, New York, Massachusetts, Rhode Island, Pennsylvania, New Jersey, Virginia and North Carolina, there could be as many as 249 occurrences in these states. This number is likely an underestimate when you consider the areas that have not been inventoried.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Abundance

10,000 - 1,000,000 individuals

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Gomphus abbreviatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACCTTATATCTACTATTTGGTGCCTGAGCAGGAATAGTGGGAACTGCCTTAAGTATACTAATTCGAATTGAATTAGGTCAACCAGGATCATTAATTGGAGATGATCAAATTTATAATGTAATTGTAACTGCCCACGCATTTGTAATAATTTTCTTCATAGTTATACCCATTATAATTGGTGGTTTCGGAAATTGACTAGTACCTCTCATATTAGGAGCACCTGATATAGCCTTCCCTCGTCTCAATAACATAAGTTTCTGATTATTACCCCCATCATTAACACTACTATTAGCTAGAAGTATAGTAGAAAGAGGGGCAGGAACAGGATGAACAGTATACCCCCCTCTTGCAGGGGCAATTGCCCATGCAGGAGCATCAGTTGACTTAACCATCTTCTCTTTACACCTTGCAGGAGTTTCATCAATTCTAGGTGCTGTTAATTTCATTACTACAACTATTAATATGAAATCCCCAGGAATAAAGTTAGATCAAATACCTCTTTTCGTGTGGTCAGTAGTAATTACCGCAGTTTTACTTTTATTATCTTTACCAGTATTAGCTGGAGCTATTACTATGTTATTAACAGATCGTAATATCAATACGTCTTTCTTTGATCCTGCTGGTGGAGGAGATCCTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Gomphus abbreviatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
Paulson, D. R.

Reviewer/s
Clausnitzer, V. & Kalkman, V. (Odonata Red List Authority)

Contributor/s

Justification
G. abbreviatus is reasonably widespread and locally common throughout its range, including protected areas and no indication of any global population decline. However, within state listings of Threatened species, it is listed as Endangered in Massachusetts.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N3 - Vulnerable

United States

Rounded National Status Rank: N3 - Vulnerable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G3 - Vulnerable

Reasons: Uncommon but not rare, with a moderately large range but partly in areas of heavy development.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
G. abbreviatus is locally common in many populations.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Short Term Trend: Relatively stable (=10% change)

Comments: No abundance changes not attributable to flight season have been noted.

Global Long Term Trend: Decline of 30-50%

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
There are no threats presently affecting this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Degree of Threat: B : Moderately threatened throughout its range, communities provide natural resources that when exploited alter the composition and structure of the community over the long-term, but are apparently recoverable

Comments: Current threats appear minor over much of the species' northern range, but habitat threat is probably significant to the south.Potential threats of habitat degradation are the impoundment of running waters by human activities such as poorly drained roads, damming, and also natural activities such as beaver damming (often a transient effect), channelization leading to scour of microhabitats, toxic or organic pollution, introduction of exotic species.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
G. abbreviatus is present in many federal, state, local, and private reserves; it appears not to require further conservation measures at this time. It is listed as Endangered in Massachusetts (Massachusetts Division of Fisheries and Wildlife: www.mass.gov/dfwele/dfw/nhesp/species_info/mesa_list/mesa_index.htm).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biological Research Needs: Determine distinquishable exuvial characters between this species and Gomphus adelphus.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Protection: Few to several (1-12) occurrences appropriately protected and managed

Comments: No EOs are known from protected areas.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: The classification of the genus Gomphus has long been discussed, a number of subgenera have been proposed, and Carle (1986) made further classification proposals. The distinct status of the species Gomphus abbreviatus is currently accepted. It is currently placed in the genus or subgenus HYLOGOMPHUS by some workers.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!