Articles on this page are available in 1 other language: Spanish (1) (learn more)

Overview

Brief Summary

Pinaceae -- Pine family

    T. D. Rudolph and P. R. Laidly

    Jack pine (Pinus banksiana), also called scrub pine, Banksian  pine, or Hudson Bay pine, is a small-to medium-sized coniferous tree of  the northern forests of the United States and Canada, where it is an  important source of pulpwood, lumber, and round timber (1,10,15,16). It  grows farther north than any other American pine and is the most widely  distributed pine species in Canada. It is a pioneer species in succession  and invades areas where mineral soil has been exposed by major  disturbances such as fires. It usually grows in even-aged pure or mixed  stands on less fertile and drier soils than those required by other native  species in its range (38).

  • Burns, Russell M., and Barbara H. Honkala, technical coordinators. 1990. Silvics of North America: 1. Conifers; 2. Hardwoods.   Agriculture Handbook 654 (Supersedes Agriculture Handbook 271,Silvics of Forest Trees of the United States, 1965).   U.S. Department of Agriculture, Forest Service, Washington, DC. vol.2, 877 pp.   http://www.na.fs.fed.us/spfo/pubs/silvics_manual/table_of_contents.htm External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

T. D. Rudolph

Source: Silvics of North America

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Comments

This small tree is distinguished by its short needle-like leaves (only ¾–1½' long) that are arranged in clusters of 2, and its persistent pine cones, which have incurving tips and lack significant prickles. Other Pinus spp. (Pines) in Illinois have longer leaves (exceeding 1½'); some species in this genus also have their leaves arranged in clusters of 3-5, while other species have cones with significant prickles. Jack Pine's irregular pattern of growth often provides it with a 'bonsai' appearance.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© John Hilty

Source: Illinois Wildflowers

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

This native coniferous tree is 30-70' tall at maturity. The growth and development of individual trees will depend on their situation. Trees growing in the open usually have a globoid-ovoid crown with a branching and crooked trunk, while trees growing in dense pine forests usually have a small oblongoid crown on top of a tall straight trunk. Branches within the crown are ascending-spreading to drooping; they are often crooked. Trunk bark is gray with reddish brown patches, somewhat scaly and flaky, and becoming slightly ridged with age. Bark of the branches is predominately gray or gray-brown and smooth to very flaky. Young branchlets are greenish yellow and smooth. The needle-like evergreen leaves are arranged on the branchlets in clusters of 2; they are pale green and ¾–1½' long. Each pair of leaves are divergent; individual leaves are slightly curved and twisted.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© John Hilty

Source: Illinois Wildflowers

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

General: Jack pine is a small to medium-sized, native, evergreen tree averaging 17 - 20 m (55 - 65 ft) high. Crown small, irregularly rounded or spreading and flattened irregular. Branches descending to spreading-ascending, poorly self-pruning; twigs slender, orange-red to red-brown, aging gray-brown, rough. Cones are retained for several years, resulting in a coarse appearance. Trunk straight to crooked; bark at first dark and scaly, later develops scaly ridges. Branchlets are yellow to greenish-brown when young, then turning gray-brown with age; very resinous buds. The leaves are evergreen, 2 - 3.75 cm (.75 - 1.5 in) long, and two twisted, divergent needles per fascicle, yellow-green in color all surfaces with fine stomatal lines, margins finely serrulate, apex acute to short-subulate. Fascicle sheath is short 0.3-0.6 cm, semipersistent. Seeds are compressed-obovoid, oblique; body 4-5 mm, brown to near black; wing 10-12 mm. 2n=24

The minimum seed-bearing age of open-grown jack pine is 3 to 5 years old. Some seed is produced every year and serotinous cones accumulate in the crown. A mature stand of jack pine may have as many as 2 million seeds per acre (5 million/ha) stored in unopened cones. Because of abundant seed production, few mature trees are necessary to regenerate a stand. The serotinous cones are sealed close with a resinous bond that requires high temperatures to open and liberate the seeds. This heat is usually provided by fire, but hot, dry weather (temperatures of at 49 to 60 degrees C) also opens some cones. Because temperatures required to open cones typically occur in the warmest part of the summer, survival of new germinant may be poor because of drought conditions or lack of time to become established before winter.

The winged seeds are the smallest of the native North American pines and are dispersed by gravity and wind. The effective dispersal range is about 110 to 130 feet (34-40 m) or two tree heights.

Seeds usually germinate rapidly after release when the 10-day mean maximum air temperature is 65 degrees Fahrenheit (18 deg C) or higher. Jack pine seeds occasionally exhibit partial dormancy, which is probably broken naturally by heat from fire. Seeds remain viable in closed cones for years, but viability decreases over time

Distribution: Jack pine occurs in Canada from British Columbia to Nova Scotia; and in the United States from Illinois eastward to New Hampshire, and Maine. For current distribution, please consult the Plant Profile page for this species on the PLANTS Web site.

Habitat: Widespread throughout Northwestern Ontario, jack pine is usually found on sandy soils of the Spodosol and Entisol soil orders. It also grows on loamy soils, on thin soils over the granites and metamorphosed rocks of the Canadian Shield, over limestone, on peat, and on soil over permafrost. Grows in mono-specific stands or in association with black spruce; less common in mixed woods with trembling aspen and other species.

Public Domain

USDA NRCS National Plant Data Center

Source: USDA NRCS PLANTS Database

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Occurrence in North America

     IL  IN  ME  MI  MN  NH  NY  VT  WI  AB
     BC  MB  NB  NT  NS  ON  PE  PQ  SK

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Jack pine occurs in Canada and in the north-central and northeastern
United States.  The northern boundary of its range extends east from the
Mackenzie River in the Northwest Territories to Cape Breton Island, Nova
Scotia.  Its range extends southwest from Nova Scotia to Maine, New
Hampshire, Vermont, northern New York, Michigan, extreme northwestern
Indiana, and northeastern Illinois, and northwest through Wisconsin and
Minnesota to Manitoba, Saskatchewan, central Alberta, and extreme
northeastern British Colombia [48].  Jack pine has been planted outside
its native range in the Central States and in Alaska.
  • 48. Little, Elbert L., Jr. 1979. Checklist of United States trees (native and naturalized). Agric. Handb. 541. Washington, DC: U.S. Department of Agriculture, Forest Service. 375 p. [2952]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range and Habitat in Illinois

Jack Pine is found only in northern Illinois, where it is rare (see Distribution Map). It is state-listed as 'endangered.' Illinois lies along the southern boundary of its distribution. Further to the north into Canada, this tree is common in some areas. In Illinois, habitats include sandy woodlands, sandy savannas, sand prairies, rocky sandstone cliffs, and stabilized sand dunes along Lake Michigan. This tree thrives in barren dry areas where there is a history of fire. While individual trees are only moderately resistant to fire, their seeds germinate in response to the heat and greater amounts of sunlight. Jack Pine is rarely used as a landscape tree.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© John Hilty

Source: Illinois Wildflowers

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The major portion of the jack pine range is in Canada where its northern  boundary extends eastward from the Mackenzie River in the Northwest  Territories across the country to Cape Breton Island, NS. The range then  extends southwest through Maine, New Hampshire, northern New York, central  Quebec and northern Ontario, Michigan, extreme northwest Indiana,  northeast Illinois, then northwest through Wisconsin, Minnesota, Manitoba,  Saskatchewan, central Alberta, to extreme northeast British Columbia (72).

    Within its range, jack pine is widely but not continuously distributed.  In Canada it is most abundant in Ontario, and in the United States, the  largest acreages are in Minnesota, Wisconsin, and Michigan (74). The only  significant artificial extensions of the jack pine range have been on  strip-mined areas in the central and northeastern States (61) and on the  sand hills of Nebraska (11).

     
- The native range of jack pine.

  • Burns, Russell M., and Barbara H. Honkala, technical coordinators. 1990. Silvics of North America: 1. Conifers; 2. Hardwoods.   Agriculture Handbook 654 (Supersedes Agriculture Handbook 271,Silvics of Forest Trees of the United States, 1965).   U.S. Department of Agriculture, Forest Service, Washington, DC. vol.2, 877 pp.   http://www.na.fs.fed.us/spfo/pubs/silvics_manual/table_of_contents.htm External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

T. D. Rudolph

Source: Silvics of North America

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Localities documented in Tropicos sources

Pinus banksiana Lamb.:
Canada (North America)
United States (North America)
China (Asia)

Note: This information is based on publications available through Tropicos and may not represent the entire distribution. Tropicos does not categorize distributions as native or non-native.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Missouri Botanical Garden, 4344 Shaw Boulevard, St. Louis, MO 63110 USA

Source: Missouri Botanical Garden

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Adaptation

Jack pine is the best adapted of all boreal conifers to fire. With medium thick bark, mature individuals have only moderate fire tolerance, but populations survive because of delayed seed release from serotinous cones, early reproductive maturity, fast growth in full sun, and preference for mineral soil seedbeds. Jack pine invades areas where mineral soil has been exposed by major disturbance such as fire. Jack pine is fire adapted and becomes a dominate species in areas that are exposed to frequently burned.

Public Domain

USDA NRCS National Plant Data Center

Source: USDA NRCS PLANTS Database

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Description

Trees to 27m; trunk to 0.6m diam., straight to crooked; crown becoming irregularly rounded or spreading and flattened. Bark orange- to red-brown, scaly. Branches descending to spreading-ascending, poorly self-pruning; twigs slender, orange-red to red-brown, aging gray-brown, rough. Buds ovoid, red-brown, 0.5--1cm, resinous; scale margins nearly entire. Leaves 2 per fascicle, spreading or ascending, persisting 2--3 years, 2--5cm ´ 1--1.5(--2)mm, twisted, yellow-green, all surfaces with fine stomatal lines, margins finely serrulate, apex acute to short-subulate; sheath 0.3--0.6cm, semipersistent. Pollen cones cylindric, 10--15mm, yellow to orange-brown. Seed cones maturing in 2 years, shedding seeds soon thereafter or often long-serotinous and shedding seeds only through age or fire, upcurved, asymmetric, lanceoloid before opening, ovoid when open, 3--5.5cm, tan to light brown or greenish yellow, slick, nearly sessile or short-stalked, most apophyses depressed but increasingly mammillate toward outer cone base; umbo central, depressed, small, sunken centrally, unarmed or with a small, reflexed apiculus. Seeds compressed-obovoid, oblique; body 4--5mm, brown to near black; wing 10--12mm. 2 n =24.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Missouri Botanical Garden, 4344 Shaw Boulevard, St. Louis, MO, 63110 USA

Source: Missouri Botanical Garden

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Description

More info for the term: serotinous

Jack pine is a small to medium-sized, native, coniferous, evergreen tree
with 0.75- to 2.0-inch-long (2-5 cm) needles.  Mature jack pine are
usually 55 to 65 feet (17-20 m) tall and 8 to 10 inches (20-25 cm) in
d.b.h. but can attain a maximum height of 100 feet (30 m) and a diameter
of 25 inches (64 cm) [67].  On extremely harsh, sandy sites, jack pine
is small and bushy [31].  Although the canopy begins showing signs of
decay by age 75, jack pine can live more than 200 years [17].  A
243-year-old jack pine was found in the Boundary Waters Canoe Area in
Minnesota [40].

Jack pine develops a taproot as a seedling and maintains it to maturity.
On deep, well-drained soils, roots of mature trees may penetrate 9 feet
(2.7 m).  The abundant lateral roots are mostly confined to the upper 18
inches (46 cm) of soil [67].

Although the species is predominantly closed-coned, individual trees can
have nonserotinous cones or a combination of serotinous and
nonserotinous cones.  Mature stands with mostly open-coned trees are
common in the southern Great Lakes region and sporadic in the East [29].
  • 31. Curtis, John T. 1959. The vegetation of Wisconsin. Madison, WI: The University of Wisconsin Press. 657 p. [7116]
  • 17. Cayford, J. H.; McRae, D. J. 1983. The ecological role of fire in jack pine forests. In: Wein, Ross W.; MacLean, David A., eds. The role of fire in northern circumpolar ecosystems. Scope 18. New York: John Wiley & Sons: 183-199. [18509]
  • 29. Critchfield, William B. 1985. The late Quaternary history of lodgepole and jack pines. Canadian Journal of Forest Research. 15: 749-772. [17710]
  • 40. Heinselman, Miron L. 1973. Fire in the virgin forests of the Boundary Waters Canoe Area, Minnesota. Quaternary Research. 3: 329-382. [282]
  • 67. Rudolph, T. D.; Laidly, P. R. 1990. Pinus banksiana Lamb. jack pine. In: Burns, Russell M.; Honkala, Barbara H., technical coordinators. Silvics of North America. Volume 1. Conifers. Agric. Handb. 654. Washington, DC: U.S. Department of Agriculture, Forest Service: 280-293. [13391]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Tree, Evergreen, Monoecious, Habit erect, Trees without or rarely having knees, Tree with bark rough or scaly, Young shoots 3-dimensional, Buds resinous, Leaves needle-like, Leaves alternate, Needle-like leaf margins finely serrulate (use magnification or slide your finger along the leaf), Leaf apex acute, Leaves < 5 cm long, Leaves > 5 cm long, Leaves < 10 cm long, Leaves yellow-green above, Leaves yellow-green below, Leaves not blue-green, Needle-like leaves somewhat rounded, Needle-like leaves twisted, Needle-like leaf habit erect, Needle-like leaves per fascicle mostly 2, Needle-like leaf sheath early deciduous, Needle-like leaf sheath persistent, Twigs glabrous, Twigs viscid, Twigs not viscid, Twigs without peg-like projections or large fascicles after needles fall, Berry-like cones orange, Woody seed cones < 5 cm long, Woody seed cones > 5 cm long, Seed cones bearing a scarlike umbo, Umbo with missing or very weak prickle, Bracts of seed cone included, Seeds brown, Seeds black, Seeds winged, Seeds unequally winged, Seed wings prominent, Seed wings equal to or broader than body.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

Stephen C. Meyers

Source: USDA NRCS PLANTS Database

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Trees to 25 m tall; trunk straight or crooked, to 0.6 m d.b.h. in native range; bark orange- or red-brown, scaly; crown irregularly rounded or flat topped; branchlets orange-red or red-brown, aging gray-brown, slender, rough; winter buds red-brown, ovoid, resinous. Needles 2 per bundle, yellow-green, twisted, 2-5 cm × 1-1.5(-2) mm, stomatal lines present on all surfaces, fine, base with semipersistent sheath 3-6 mm, margin finely serrulate. Seed cones upcurved, nearly sessile or shortly pedunculate, tan to pale brown or greenish yellow, ovoid when open, asymmetric, 3-5.5 cm, maturing in 2 years, then soon shedding seeds or often long serotinous and shedding seeds only with age or after fire. Apophyses mostly depressed but increasingly mamillate toward outer part, basal of cone; umbo depressed, sunken centrally, small, unarmed or with a small, reflexed apicula. Seeds brown or nearly black, compressed obovoid, oblique, 4-5 mm; wing 1-1.2 cm.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Missouri Botanical Garden, 4344 Shaw Boulevard, St. Louis, MO, 63110 USA

Source: Missouri Botanical Garden

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Synonym

Pinus divaricata (Aiton) Sudworth; P. sylvestris Linnaeus [var.] d divaricata Aiton
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Missouri Botanical Garden, 4344 Shaw Boulevard, St. Louis, MO, 63110 USA

Source: Missouri Botanical Garden

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat characteristics

More info for the terms: lichen, shrub, tree

Jack pine occurs on level to gently rolling sand plains of glacial
outwash, fluvial, or lacustrine origin.  It also occurs on eskers,
sand dunes, rock outcrops, bald rock ridges, and lake shores.  In the
Lake States, it commonly occurs between 1,000 and 1,500 feet (300-460 m)
in elevation with a maximum elevation of about 2,000 feet (610 m).  In
the East, jack pine grows near sea level to about 2,000 feet (610
m), with a population in New Hampshire occurring at around 2,500 feet
(760 m) [34,67].

Jack pine usually grows in dry, acidic sandy soils of the Spodosol or
Entisol Order, but it also grows in loamy soil, thin soil over bedrock,
peat, and soil over permafrost.  Although jack pine does not usually
grow in moderately alkaline soil, it can grow in calcareous soils up to
pH 8.2 if normal mycorrhizal fungi associates are present [67].

Common tree associates of jack pine not mentioned in Distribution and
Occurrence are bur oak (Quercus macrocarpa), northern red oak (Q.
rubra), red maple (Acer rubrum), balsam fir, white spruce (Picea
glauca), tamarack (Larix laricina), balsam poplar (Populus balsamifera),
bigtooth aspen (P. grandidentata), and quaking aspen (P. tremuloides)
[34].

Common shrub associates include prickly rose (Rosa acicularis),
bunchberry (Cornus canadensis), velvetleaf blueberry (Vaccinium
myrtilloides), mountain cranberry (V. vitis-idaea), bearberry (Arctostaphylos
uva-ursi), American green alder (Alnus crispa), Labrador tea (Ledum
groenlandicum), wintergreen (Pyrola spp.), and beaked hazel (Corylus
cornuta) [28,34,46,47,57].

Groundcover commonly consists of reindeer lichen (Cladonia spp.) on
drier sites and feather mosses, especially mountain fern-moss
(Hylocomium splendens) and Schreber's moss (Pleurozium schreberi), on
moister sites [16,34,57].
  • 34. Eyre, F. H., ed. 1980. Forest cover types of the United States and Canada. Washington, DC: Society of American Foresters. 148 p. [905]
  • 16. Carroll, S. B.; Bliss, L. C. 1982. Jack pine - lichen woodland on sandy soils in northern Saskatchewan and northeastern Alberta. Canadian Journal of Botany. 60: 2270-2282. [7283]
  • 28. Corns, I. G. W.; Annas, R. M. 1986. Field guide to forest ecosystems of west-central Alberta. Edmonton, AB: Canadian Forestry Service, Northern Forestry Centre. 251 p. [8998]
  • 46. Kurmis, Vilis; Webb, Sara L.; Merriam, Lawrence C., Jr. 1986. Plant communities of Voyageurs National Park, Minnesota, U.S.A. Canadian Journal of Botany. 64: 531-540. [16088]
  • 47. La Roi, George H. 1992. Classification and ordination of southern boreal forests from the Hondo - Slave Lake area of central Alberta. Canadian Journal of Botany. 70: 614-628. [18702]
  • 57. Moss, E. H. 1955. The vegetation of Alberta. Botanical Review. 21(9): 493-567. [6878]
  • 67. Rudolph, T. D.; Laidly, P. R. 1990. Pinus banksiana Lamb. jack pine. In: Burns, Russell M.; Honkala, Barbara H., technical coordinators. Silvics of North America. Volume 1. Conifers. Agric. Handb. 654. Washington, DC: U.S. Department of Agriculture, Forest Service: 280-293. [13391]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Key Plant Community Associations

More info for the terms: codominant, tree

Jack pine is a dominant tree in the southern boreal forest region.
Associates are almost always subdominant except for aspen (Populus
spp.), paper birch (Betula papyrifera), and red pine (Pinus resinosa)
which may be codominant [34].

The following published classifications list jack pine as dominant or
codominant:

The vegetation of Alberta [57]
Field guide to forest ecosystems of west-central Alberta [28]
Virgin plant communities of the Boundary Waters Canoe Area [59]
Plant communities of Voyageurs National Park, Minnesota, U.S.A. [46]
The principal plant associations of the Saint Lawrence Valley [32]
The vegetation of Wisconsin [31]
Classification and ordination of southern boreal forests from the
   Hondo-Slave Lake area of central Alberta [47]
Jack pine-lichen woodland on sandy soils in northern Saskatchewan and
   northeastern Alberta [16]
  • 34. Eyre, F. H., ed. 1980. Forest cover types of the United States and Canada. Washington, DC: Society of American Foresters. 148 p. [905]
  • 31. Curtis, John T. 1959. The vegetation of Wisconsin. Madison, WI: The University of Wisconsin Press. 657 p. [7116]
  • 16. Carroll, S. B.; Bliss, L. C. 1982. Jack pine - lichen woodland on sandy soils in northern Saskatchewan and northeastern Alberta. Canadian Journal of Botany. 60: 2270-2282. [7283]
  • 28. Corns, I. G. W.; Annas, R. M. 1986. Field guide to forest ecosystems of west-central Alberta. Edmonton, AB: Canadian Forestry Service, Northern Forestry Centre. 251 p. [8998]
  • 32. Dansereau, Pierre. 1959. The principal plant associations of the Saint Lawrence Valley. No. 75. Montreal, Canada: Contrib. Inst. Bot. Univ. Montreal. 147 p. [8925]
  • 46. Kurmis, Vilis; Webb, Sara L.; Merriam, Lawrence C., Jr. 1986. Plant communities of Voyageurs National Park, Minnesota, U.S.A. Canadian Journal of Botany. 64: 531-540. [16088]
  • 47. La Roi, George H. 1992. Classification and ordination of southern boreal forests from the Hondo - Slave Lake area of central Alberta. Canadian Journal of Botany. 70: 614-628. [18702]
  • 57. Moss, E. H. 1955. The vegetation of Alberta. Botanical Review. 21(9): 493-567. [6878]
  • 59. Ohmann, Lewis F.; Ream, Robert R. 1971. Wilderness ecology: virgin plant communities of the Boundary Waters Canoe Area. Res. Pap. NC-63. St. Paul, MN: U.S. Department of Agriculture, Forest Service, North Central Forest Experiment Station. 55 p. [9271]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat: Cover Types

More info on this topic.

This species is known to occur in association with the following cover types (as classified by the Society of American Foresters):

     1  Jack pine
    12  Black spruce
    14  Northern pin oak
    15  Red pine
    16  Aspen
    18  Paper birch

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat: Plant Associations

More info on this topic.

This species is known to occur in association with the following plant community types (as classified by Küchler 1964):

   K093  Great Lakes spruce - fir forest
   K095  Great Lakes pine forest
   K100  Oak - hickory forest
   K108  Northern hardwoods - spruce forest

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat: Ecosystem

More info on this topic.

This species is known to occur in the following ecosystem types (as named by the U.S. Forest Service in their Forest and Range Ecosystem [FRES] Type classification):

   FRES10  White - red - jack pine
   FRES11  Spruce - fir
   FRES15  Oak - hickory
   FRES19  Aspen - birch

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range and Habitat in Illinois

Jack Pine is found only in northern Illinois, where it is rare (see Distribution Map). It is state-listed as 'endangered.' Illinois lies along the southern boundary of its distribution. Further to the north into Canada, this tree is common in some areas. In Illinois, habitats include sandy woodlands, sandy savannas, sand prairies, rocky sandstone cliffs, and stabilized sand dunes along Lake Michigan. This tree thrives in barren dry areas where there is a history of fire. While individual trees are only moderately resistant to fire, their seeds germinate in response to the heat and greater amounts of sunlight. Jack Pine is rarely used as a landscape tree.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© John Hilty

Source: Illinois Wildflowers

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Soils and Topography

Jack pine is usually found on sandy soils of the Spodosol and Entisol  soil orders (81). It also grows on loamy soils, on thin soils over the  granites and metamorphosed rocks of the Canadian Shield, over limestones,  on peats, and on soil over permafrost (16,61,74).

    Jack pine can grow on very dry sandy or gravelly soils where other  species can scarcely survive, but it grows best on well drained loamy  sands where the midsummer water table is from 1.2 to 1.8 m (4 to 6 ft)  below the surface. Jack pine does not grow naturally where the surface  soil is alkaline, but it does grow on soils overlying limestone. It can  grow on calcareous soils (pH 8.2) if a normal mycorrhizal association is  present. In southeastern New Brunswick, owing to a long fire history, jack  pine occupies vast areas of clayey soils and it is more common than red  pine on xeric sites that have high nutrient levels (61).

    In well stocked stands in Minnesota and central Wisconsin, available  moisture-holding capacity in the upper 30 cm (12 in) ranges from 3 to 17  percent by weight. Site index improves with an increase in fine sand and  silt and clay in the upper soil layer, an increase in water-holding  capacity (up to a point after which it levels off), and an increase in  cation exchange capacity in the A and B horizons (61). Similar relations  between these soil factors and site index were found for plantations in  Wisconsin (82).

    In a jack pine forest in northeastern Minnesota about 2580 to 3140 kg/ha  (2,300 to 2,800 lb/acre) ovendry weight of organic matter was returned to  the soil annually. The quantity of nutrient elements, expressed in  percentage of dry weight, in freshly fallen jack pine litter averages as  follows: calcium, 0.61; potassium, 0.16; phosphorus, 0.04; nitrogen, 0.58;  and ash, 4.15. The litter is acid with a pH of 3.8 to 4.3 (61).  Accumulated biomass of vegetation in jack pine stands more than 50 years  old in northeastern Minnesota was 89 000 kg/ha (79,400 lb/acre) on shallow  soils over bedrock, and 152 800 kg/ha (136,300 lb/acre) on deep till  soils. Biomass of the forest floor was 35 200 kg/ha (31,400 lb/acre) on  shallow soils and 50 300 kg/ha (44,870 lb/acre) on deep till soils.  Nutrients in the vegetation, forest floor, and soil were similarly higher  on the deep till soils (33). The above values largely agree with those  found on other sites for jack pine forest floor biomass, litter fall, and  nutrient transfer from jack pine forest to soil (28,49,78).

    In the Lake States and Canada, jack pine grows most commonly on level to  gently rolling sand plains, usually of glacial outwash, fluvial, or  lacustrine origin. It occurs less commonly on eskers, sand dunes, rock  outcrops, and bald rock ridges. In the Lake States jack pine is found  chiefly at elevations between 300 and 460 m (1,000 and 1,500 ft), with a  maximum of about 610 m (2,000 ft) above sea level. In the East, jack pine  grows on a variety of sandy sites from near sea level up to about 610 m  (2,000 ft), with an outlier in New Hampshire at 760 m (2,500 ft) (61).

  • Burns, Russell M., and Barbara H. Honkala, technical coordinators. 1990. Silvics of North America: 1. Conifers; 2. Hardwoods.   Agriculture Handbook 654 (Supersedes Agriculture Handbook 271,Silvics of Forest Trees of the United States, 1965).   U.S. Department of Agriculture, Forest Service, Washington, DC. vol.2, 877 pp.   http://www.na.fs.fed.us/spfo/pubs/silvics_manual/table_of_contents.htm External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

T. D. Rudolph

Source: Silvics of North America

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Climate

In the eastern part of its range, jack pine grows in a maritime climate  but elsewhere it is found in diverse continental climates characterized by  short, warm to cool summers, very cold winters, and low rainfall. The  average January and July temperatures range from -29° to -4° C  (-20° to 25° F) and from 13° to 22° C (55° to 72°  F), respectively. Average annual maximum temperatures range from 29°  to 38° C (85° to 100° F), and average annual minimum  temperatures are from -21° to -46° C (-5° to -50° F)  (61). Mean annual temperatures range between -5° and 4° C (23°  and 40° F) (74). The northern limits of the range closely parallel  the 29° C (85° F) mean annual maximum isotherm. Frost may occur  in some areas during any month and in the Northwest the range extends into  the permafrost zone. (61).

    Average annual precipitation ranges from 250 to 1400 mm (10 to 55 in)  but 380 to 890 mm (15 to 35 in) are more usual. The average warm season  precipitation ranges from 150 to 640 mm (6 to 25 in). Annual snowfall is  from 76 to 508 cm (30 to 200 in), but over much of the range it is between  102 and 254 cm (40 to 100 in). Summer droughts are common in the  south-central and western portions of the range (61).

    The average date of the last killing spring frost ranges from April 30  to about July 1; and the average date of the first killing fall frost  ranges from about August 10 to October 20. The frost-free period averages  from 50 to 173 days but is usually from 80 to 120 days. Generally,  temperature, rainfall, and frost-free period increase from the  northwestern toward the southeastern part of the range (61).

  • Burns, Russell M., and Barbara H. Honkala, technical coordinators. 1990. Silvics of North America: 1. Conifers; 2. Hardwoods.   Agriculture Handbook 654 (Supersedes Agriculture Handbook 271,Silvics of Forest Trees of the United States, 1965).   U.S. Department of Agriculture, Forest Service, Washington, DC. vol.2, 877 pp.   http://www.na.fs.fed.us/spfo/pubs/silvics_manual/table_of_contents.htm External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

T. D. Rudolph

Source: Silvics of North America

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat & Distribution

Fire successional in boreal forests, tundra transition, dry flats, and hills, sandy soils; 0--800m; Alta., B.C., Man., N.B., N.W.T., N.S., Ont., P.E.I., Que., Sask.; Ill., Ind., Maine, Mich., Minn., N.H., N.Y., Pa., Vt., Wis.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Missouri Botanical Garden, 4344 Shaw Boulevard, St. Louis, MO, 63110 USA

Source: Missouri Botanical Garden

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat & Distribution

Cultivated. Beijing Shi, Heilongjiang (Harbin Shi), Henan (Jigong Shan), Jiangsu (Nanjing Shi), Jiangxi (Lu Shan), Liaoning, Shandong [native to N North America]
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Missouri Botanical Garden, 4344 Shaw Boulevard, St. Louis, MO, 63110 USA

Source: Missouri Botanical Garden

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Dispersal

Establishment

Jack pine is regenerated by planting, direct seeding, scattering cone-bearing slash on mechanically scarified ground, or using the seed tree silviculture method combined with prescribed fire. Usually grows in dry, acidic sandy soils with a lower pH limit of 4.0, but also loamy soil, thin soil over bedrock, peat, and soil over permafrost. Does not usually grow in moderately alkaline soil, but can grow in calcareous soils up to pH 8.2 if normal mycorrhizal fungi are present.

Jack pine occurs on level to gently rolling sand plains of glacial outwash, fluvial, or lacustrine origin, on eskers, sand dunes, rock outcrops, bald rock ridges, and lakeshores. At elevations between 300 to 700 m (1,000 to 2300 feet).

Jack pine seeds germinate best on mineral soil or soil with less than 0.2 inch or organic matter. The organic material level can be reduced by fire or mechanical raking and disking. The slash on seedbed left by harvesting must be reduced because it will provide too much shade. Some shade might be good for germination but young Jack pine seedlings require full sunlight to become established.

Public Domain

USDA NRCS National Plant Data Center

Source: USDA NRCS PLANTS Database

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Faunal Associations

Many insects feed on Jack Pine and other pines, particularly moth caterpillars (see Moth Table) and the larvae of long-horned beetles (see Long-Horned Beetle Table). Other insect feeders include the shield bug Tetyra bipunctatus, the Jack Pine Resin Midge (Cecidomyia resinicola), the Pine Spittlebug (Aphrophora cribatus), Pine Needle Scale (Chionaspis pinifoliae), the plant bugs Deraeocoris albigulus and Phytocoris angustifrons, the larvae of several sawflies (Diprion similis, Neodiprion lecontei, Neodiprion sertifera), the bark beetles Dendroctonus valens and Ips pini, the weevils Cimberis elongatus and Dryophthorus americana, the Pinetree Spur-Throated Grasshopper (Melanoplus punctulatus), and the caterpillars of a butterfly, the Pine Elfin (Callophrys niphon). Pine seeds are eaten by both upland gamebirds and some songbirds (see Bird Table); they are also eaten by the Red Squirrel and White-Footed Mouse. White-Tailed Deer browse on the foliage and twigs of pines, particularly during the winter, while the Cottontail Rabbit browses on young seedlings and gnaws on the bark of these trees. Because of its dense evergreen leaves, Jack Pine provides good nesting and roosting habitat for many species of birds. An endangered bird species that is found in Michigan, Kirtland's Warbler (Dendroica kirtlandi), nests at the base of Jack Pine, where it is the dominant tree in sandy savannas.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© John Hilty

Source: Illinois Wildflowers

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associated Forest Cover

The Jack Pine forest cover type (Society of American Foresters Type 1)  (26) typically originates after forest fires. It is found in pure,  even-aged stands or as a majority of the stocking over vast areas of  Canada and to a much lesser extent in the Lake States and the northeastern  United States (61). In the boreal forest jack pine is also a component of  three other forest cover types-Black Spruce (Type 12), Paper Birch (Type  18), and Aspen (Type 16). In the northern forest region it is a component  of two forest cover types-Red Pine (Type 15) and Northern Pin Oak (Type  14). Outliers near southern fringes of the species' range are found in  various types of hardwood forest (12).

    Associated tree species, listed in order of presence on dry to mesic  sites, include northern pin oak (Quercus ellipsoidalis), bur oak  (Q. macrocarpa), red pine (Pinus resinosa), bigtooth aspen  (Populus grandidentata), quaking aspen (P. tremuloides), paper  birch (Betula papyrifera), northern red oak Quercus rubra),  eastern white pine (Pinus strobus), red maple (Acer  rubrum), balsam fir (Abies balsamea), white spruce (Picea  glauca), black spruce (P. mariana), tamarack (Larix  laricina), and balsam poplar (Populus balsamifera). In the  boreal forest the most common associates are quaking aspen, paper birch,  balsam fir, and black spruce. In the northern forest they are northern pin  oak, red pine, quaking aspen, paper birch, and balsam fir. Associates are  nearly always subordinate to jack pine except for aspen, paper birch, and  red pine which may be coordinate (26,61). Infrequent associates in the  northeastern United States and adjacent Canada include white oak (Quercus  alba), pin cherry (Prunus pensylvanica), gray birch (Betula  populifolia), red spruce (Picea rubens), and pitch pine (Pinus  rigida) (61).

    In Canada, six subtypes of jack pine may be recognized based upon the  edaphic and climatic conditions where they are found and on associated  species as follows: jack pine-balsam fir-black spruce (subtype a); jack  pine-feather moss (subtype b); jack pine-sheep laurel (subtype c); jack  pine-sphagnum. (subtype d); jack pine-labrador-tea (subtype e); jack  pine-lichen (subtype f) (26).

    The preceding subtype descriptions apply primarily to eastern Canada.  However, jack pine forests in Saskatchewan bear close resemblance to some  of the subtypes described above (43).

    Subtypes, as such, are not recognized in the Lake States. There are,  however, certain variants of the type, including jack pine-black spruce,  jack pine-red pine, and northern pin oak-jack pine (26).

  • Burns, Russell M., and Barbara H. Honkala, technical coordinators. 1990. Silvics of North America: 1. Conifers; 2. Hardwoods.   Agriculture Handbook 654 (Supersedes Agriculture Handbook 271,Silvics of Forest Trees of the United States, 1965).   U.S. Department of Agriculture, Forest Service, Washington, DC. vol.2, 877 pp.   http://www.na.fs.fed.us/spfo/pubs/silvics_manual/table_of_contents.htm External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

T. D. Rudolph

Source: Silvics of North America

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diseases and Parasites

Damaging Agents

Jack pine is subject to many agents that cause  damage or mortality. Young jack pines are especially susceptible to early  spring fires. Severe drought may kill many seedlings, particularly on  coarse soils. All young jack pines less than 1.5 m (5 ft) tall and 55  percent of those from 1.5 to 3.7 m (5 to 12 ft) tall were killed by 123  days of flooding in northern Minnesota. Heavy populations of white-tailed  deer can kill young jack pines up to 2.1 m (7 ft) tall, retard total  height growth to half its potential, and deform most trees so they have  little future value for timber products. Snowshoe hares can severely  damage jack pine reproduction, particularly in dense stands in trees less  than 4 cm (1.5 in) in d.b.h. (16,61). Jack pine seedlings are greatly  damaged by elk in western Manitoba when animal populations are high, and  meadow voles cause occasional damage and mortality by gnawing the bark off  main stems and lower branches (16). Porcupines can cause extensive damage  in older stands (74).

    Numerous insects affect the survival and growth of jack pine seedlings  (83). The more important groups of these are as follows: (1) root borers  such as the pales weevil (Hylobius pales), pine root collar weevil  (H. radicis), pine root tip weevil (H. rhizophagus), and  Warren's collar weevil (H. warreni); (2) shoot and stem borers  such as the northern pine weevil (Pissodes approximatus), the  white pine weevil (P. strobi), and the Allegheny mound ant (Formica  exsectoides); (3) leaf feeders such as numerous sawflies (Neodiprion  sertifer, N. pratti banksianae, N. swainei, N. nigroscutum, N. compar, N.  lecontei, N. dubiosus, N. nanulus nanulus), Diprion similus, jack pine  budworm, pine chafer (Anomala oblivia), and pine webworm (Tetralopha  robustella); (4) needle miners such as Argyrotaenia tabulanaExoteleia pinifoliella, and Zelleria haimbachi; (5) root  feeders including primarily white grubs (Phyllaophaga spp.);  and (6) sucking insects such as two midges (Cecidomyia reeksi,  and C. piniinopis), scale insects (Nuculaspis california,  Chionaspis pinifoliae, and Toumeyella parvicornis), spittlebugs  (Aphrophora parallela and A. saratogensis), and a wooly  aphid (Pineus coloradensis).

    The jack pine tip beetle (Conophthorus banksianae) causes  extensive shoot tip mortality, preferring sapling-size trees. The  lodgepole terminal weevil (Pissodes terminalis) attacks and  destroys the new terminal bud of jack pine in Saskatchewan (61,83).

    Several sawflies attack jack pine. Trees are often killed because the  sawflies feed on both old and new needles. The pine tussock moth (Parorgyia  plagiata) commonly defoliates large areas of sapling- and pole-size  jack pine. The jack pine budworm is the most important defoliator of jack  pine in the northeastern United States (61,84).

    Several diseases commonly attack young jack pines and reduce survival  and growth. A needle rust fungus (Coleosporium asterum) causes  some defoliation of seedlings. Diplodia blight (Diplodia pinea) frequently  results in a shoot blight of jack pine seedlings under nursery conditions.  Sirococcus shoot blight (Sirococcus strobilinus) has also caused  seedling losses in Lake States nurseries. Scleroderris canker (Gremmeniella  abietina) causes serious losses in both nursery stock and young  plantations. Before nursery control programs for this disease were  instituted in the Lake States, this fungus killed an average of 40 percent  of seedlings in plantations established with infected stock (77).

    Jack pine is susceptible to a number of rust fungi that cause both  growth loss and tree mortality. Many of these rusts are disseminated by  infected nursery stock. The sweetfern blister rust (Cronartium  comptoniae) sometimes kills many young seedlings and reduces the  growth of survivors. More prevalent is the pine-oak (eastern) gall rust  (Cronartium quercuum), which may infect up to 50 percent of young  seedlings, killing many of the seedlings with galls on the main stem.  Young jack pine in Minnesota have been severely cankered by stalactiform  rust (Cronartium coleosporioides). In recent years the  pine-to-pine (western) gall rust (Endocronartium harknessii) has  been found throughout the Lake States in young jack pine stands. The  importance of this rust is its potentially rapid rate of spread. This rust  can infect directly from pine to pine without spending parts of its life  cycle on an alternate host as do all the previously mentioned rusts (77).

    Sapling- and pole-size jack pine frequently show severe needlecast (Davisomycella  ampla). This fungus often causes loss of all but the current year's  needles. Although affected trees suffer growth loss, the disease seldom  causes mortality. Diplodia blight frequently kills branches and often the  entire tree. This disease appears to be stress related and may reach  epidemic status following drought. The European strain of scleroderris  canker is currently killing many jack pine in northern New York and will  cause serious losses if it reaches the major range of jack pine (77).

    The rust fungi mentioned under seedling disease also cause extensive  mortality in pole-size stands. The pine-oak (eastern) gall rust has caused  severe losses in jack pine stands in northern Wisconsin. In some pole-size  stands the disease is so prevalent that the stands have become worthless  and have been destroyed (77).

    The major root-rot fungi include the shoestring fungus (Armillaria  mellea) and annosum root rot (Heterobasidion annosum) (77).

    The principal wood decay organisms are Phellinus pini, Phaeolus  schweinitzii, and Fomitopsis pinicola (77).

    Windthrow is not a serious problem in jack pine stands except on shallow  soils or when more than one-third of the stand basal area is removed in  thinnings. Stem breakage from wind, ice, and snow is more common (10).

    Cone and seed production can be decreased by numerous factors. Red  squirrels and other rodents destroy cones and consume seeds (18,61,69,72).  Low-vigor trees may produce much pollen but little seed. Pine-oak  (eastern) gall rust damages trees resulting in smaller and aborted ovulate  cones. Birds may be important consumers of jack pine seeds that fall to  the ground or are directly sown (61). Cone and seed insects may cause  serious losses. In one study in northeastern Wisconsin, numerous insect  species were found attacking conelets and cones (57). The jack pine  budworm (Choristoneura pinus pinus) destroyed 12 percent of the  conelets. A mirid (Platylygus luridus) was observed piercing  conelets as well as shoots and needles and was apparently responsible for  a severe but unknown conelet abortion rate. The most prevalent insect  attacking cones was the cone borer (Eucosma monitorana) which  killed 10 percent of the cones. Other insects responsible for a total of  about 4 percent cone mortality were the webbing coneworm (Dioryctria  disclusa), red pine cone beetle (Conophthorus resinosae), jack  pine budworm, and cone midges (Lestodiplosis graddator, Resseliella  silvana, and Asynapta hopkinsi) (57).

    Other insects that directly damage jack pine conelets, cones, or seeds,  or that decrease their numbers by damaging potential cone-bearing shoots  include the jack pine tip beetle (Conophthorus banksianae), shield-backed  pine seed bug (Tetyra bipunctata), Virginia pine sawfly (Neodiprion  pratti pratti), a moth (Holcocera immaculella), eastern pine  seedworm (Laspeyresia toreuta), Nantucket pine tip moth (Rhyacionia  frustrana), European pine shoot moth (R. buoliana), fir  coneworm (Dioryctria abietivorella), and spruce coneworm (D.  reniculelloides) (36).

  • Burns, Russell M., and Barbara H. Honkala, technical coordinators. 1990. Silvics of North America: 1. Conifers; 2. Hardwoods.   Agriculture Handbook 654 (Supersedes Agriculture Handbook 271,Silvics of Forest Trees of the United States, 1965).   U.S. Department of Agriculture, Forest Service, Washington, DC. vol.2, 877 pp.   http://www.na.fs.fed.us/spfo/pubs/silvics_manual/table_of_contents.htm External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

T. D. Rudolph

Source: Silvics of North America

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Fire Management Implications

More info for the term: fuel

The study demonstrates that prescribed burning in conjunction with a
seed-tree system can successfully regenerate jack pine.  Enough heat was
generated from burning logging slash and the other fuel present to open
serotinous cones in the seed trees.  Jack pine regenerated successfully
on partially burned humus because of adequate precipitation during the
postfire growing seasons.  Had the fire been followed by a drought,
seedlings may have only survived on mineral seedbeds.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Site Description

More info for the term: fresh

The terrain was nearly flat with a slight south-southwest aspect.  The
glacial till soil varied downward from sandy loam to sandy clay loam.
The soil moisture regime was fresh to moderately moist, and the humus
(including surface moss and litter) averaged 2.8 inches (7.1 cm) in
depth.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Season/Severity Classification

Summer backfire/moderate-severity

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Fire Management Considerations

More info for the terms: duff, fuel, fuel moisture, natural, prescribed fire, seed tree, series, serotinous, tree, wildfire

Dense, young stands are extremely susceptible to crowning wildfire which
is hard to control.  A prescribed fire for the purpose of creating
Kirtland's Warbler habitat escaped control in 1980 at Mack Lake,
Michigan.  The fire crowned in a sapling stand, at times spread as fast
as 175 feet per minute (53 m/min), and did not slow down until it ran
out of jack pines and into hardwoods [70].

Prescribed fire is used in the jack pine type to prepare seedbeds,
reduce fire hazard, remove slash for easier planting, and/or open
serotinous cones in jack pine seed trees [55].  Slash has also been
burned in order to release seeds from cones in the slash.  This method
is ineffective, however, because if the fire is hot enough to prepare an
adequate seedbed, it destroys the cones [10,19].  Reproduction after
slash fires is often no better than on unburned clearcuts [23].

The seed tree silviculture method in conjunction with prescribed fire is
the most promising method for regenerating jack pine.  A prescribed
early summer fire serves to burn the slash, prepare a seedbed, and open
the serotinous cones in the seed trees [55].

While headfires may be more likely to open serotinous cones high in the
crowns of trees, backfires are generally recommended for use in
seed-tree systems because they move slower, may burn more humus, and are
safer [5,11].  However, in a series of prescribed fires in central
Ontario, backfires removed no more duff than headfires.  Drought
conditions were the the most important criteria in whether or not the
fire resulted in an adequate removal of humus [20].

Because of drier conditions, summer fires prepare better seedbeds than
spring fires [19,20,21].  If managers are relying on a natural seed
source, the prescribed fire should be timed early enough in the season
so that seedlings become well-established before winter [11], or late
enough so that seeds overwinter before germinating [5].  See Fire Case
Study for more information on prescribed fires in seed-tree systems.

Full-tree harvesting, in which a tree is delimbed at a landing, is
becoming a common practice.  This method leaves little slash to use as
fuel for seedbed-preparation prescribed fire.  However, if feather
mosses such as Schreber's moss are present, they will carry fire.  Spread
rates up to 164 feet per minute (50 m/min) over short distances were
observed in this fuel type, and prescribed fires have resulted in
statistically significant reductions in duff depth [56].

Dwarf-mistletoe (Arceuthobium americanum), which parasitizes jack pine
in the western part of its range, persists on dry ridges with sparse
undergrowth where fires are less severe and do not kill every tree.
Dwarf-mistletoe is eliminated if fire kills all of the trees.
Prescribed burning of logging slash and residual trees sanitizes an area
[6].  Seeds of dwarf-mistletoe are explosively discharged up to 60 feet
(18 m) from the canopy margin, so a minimum buffer of 66 feet (20 m) is
recommended between infected trees and new pine regeneration [61].

Equations were developed to predict the forest-floor moisture content
under jack pine canopies and in stand openings from the Duff Moisture
Code (DMC) and the Fine Fuel Moisture Code (FFMC) [26].  DMC and FFMC
are weather-based codes of the Canadian Forest Fire Weather Index System
[42].  The DMC and FFMC have also been calibrated to predict the
forest-floor moisture content of clearcut jack pine sites in relation to
slash distribution and by forest floor strata [25].

In one test, the Canadian Forest Fire Weather Index overestimated jack
pine wood slash moisture by a factor of 3.5 and variability by 50
percent, but was only 25 percent low on foliage moisture and 6 percent
low for its variability.  The U.S. National Fire-Danger Rating System
underestimated the wood and foliage moisture by 50 percent and
underestimated their variability by 30 percent [71].

Based on 12 experimental fires, Stocks [75] developed regression
equations for predicting the fire behavior in the mature jack pine fuel
type from the Canadian Forest Fire Weather Index System.  Frontal fire
intensity was strongly correlated with the Fire Weather Index (FWI).
  • 5. Ahlgren, Clifford E. 1970. Some effects of prescribed burning on jack pine reproduction in northeastern Minnesota. Misc. Rep. 94, Forestry Series 5-1970. Minneapolis, MN: University of Minnesota, Agricultural Experiment Station. 14 p. [7285]
  • 6. Alexander, Martin E.; Hawksworth, Frank G. 1975. Wildland fires and dwarf mistletoes: a literature review of ecology and prescribed buring. Gen. Tech. Rep. RM-14. Fort Collins, CO: U.S. Department of Agriculture, ForestService, Rocky Mountain Forest and Range Experiment Station. 12 p. [15583]
  • 10. Beaufait, William R. 1960. Influences of shade level and site treatment, including fire, on germination and early survival of Pinus banksiana. Lansing, MI: Michigan Department of Conservation, Forestry Division. 79 p. [11751]
  • 11. Beaufait, William R. 1962. Procedures in prescribed burning for jack pine regeneration. Tech. Bull. No. 9. L'Anse, MI: Michigan College of Mining and Technology, Ford Forestry Center. 39 p. [11752]
  • 19. Chrosciewicz, Z. 1959. Controlled burning experiments on jack pine sites. Tech. Note No. 72. Ottawa, Canada: Department of Northern Affairs and National Resources, Forestry Branch, Forest Research Division. 19 p. [16915]
  • 20. Chrosciewicz, Z. 1967. Experimental burning for humus disposal on clear-cut jack pine sites in central Ontario. Departmental Publ. No. 1181. Ottawa, Canada: Department of Forestry and Rural Development, Forestry Branch. 23 p. [13602]
  • 21. Chrosciewicz, Z. 1970. Regeneration of jack pine by burning and seeding treatments on clear-cut sites in central Ontario. Inf. Rep. 0-X-138. Forest Research laboratory, Ontario Region, Canadian Forestry Service, Department of Fisheries and Forestry. 13 p. [7241]
  • 23. Chrosciewicz, Z. 1988. Forest regeneration on burned, planted, and seeded clear-cuts in central Saskatchewan. Information Report NOR-X-293. Edmonton, AB: Canadian Forestry Service, Northern Forestry Centre. 16 p. [16697]
  • 25. Chrosciewicz, Z. 1989. Prediction of forest-floor moisture content on jack pine cutovers. Canadian Journal of Forest Research. 19: 239-243. [15609]
  • 26. Chrosciewicz, Z. 1989. Prediction of forest-floor moisture content under diverse jack pine canopy conditions. Canadian Journal of Forestry. 19: 1483-1487. [9734]
  • 42. Johnson, Edward A. 1992. Fire and vegetation dynamics: studies from the North American boreal forest. Cambridge Studies in Ecology. Cambridge: Cambridge University Press. 129 p. [19950]
  • 55. McRae, D. J. 1979. Prescribed burning in jack pine logging slash: a review. Report 0-X-289. Sault Ste. Marie, ON: Canadian Forestry Service, Great Lakes Forest Research Centre. 57 p. [7290]
  • 56. McRae, Douglas J. 1986. Potential use of prescribed fire on full-tree harvested jack pine sites. In: Koonce, Andrea L., ed. Prescribed burning in the Midwest: state-of-the-art: Proceedings of a symposium; 1986 March 3-6; Stevens Point, WI. Stevens Point, WI: University of Wisconsin, College of Natural Resources, Fire Science Center: 34-37. [16266]
  • 61. Punter, David; Gilbert, Jeannie. 1991. Explosive discharge of jack pine dwarf mistletoe (Arceuthobium americanum) seed in Manitoba. Canadian Journal of Forest Research. 21(4): 434-438. [13988]
  • 70. Simard, Albert J. 1981. The Mack Lake fire. Fire Management Notes. Spring: 5-6. [19238]
  • 71. Simard, A. J.; Eenigenburg, James E.; Blank, Richard W. 1984. Predicting fuel moisture in jack pine slash: a test of two systems. Canadian Journal of Forest Research. 14: 68-76. [13640]
  • 75. Stocks, B. J. 1989. Fire behavior in mature jack pine. Canadian Journal of Forest Research. 19: 783-790. [8672]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Plant Response to Fire

More info for the terms: density, duff, fire severity, hardwood, severity, softwood

Serotinous cones opened by the heat of fire release jack pine seeds onto
seedbeds exposed by fire.  Jack pine establishment is limited primarily
by the depth of organic matter and, therefore, progressively increases
with greater fire severity [22,77].  The dead boles of the former stand
provide partial shade during the first few years of establishment
[18].

Regeneration is typically better after summer fires than spring fires.
In the Boundary Waters Canoe Area in Minnesota, a spring fire (The
Little Sioux Fire) occurred while the forest floor was still cool and
moist from snowmelt, and only the top few centimeters of duff were
removed.  In the first postfire growing season, jack pine seedling
density on three sites ranged from 0.86 to 1.58 seedlings per square
foot (9.3-17.0/sq m).  A summer fire (The Prayer Lake Fire) exposed
mineral soil almost everywhere and also destroyed many competing plant
seeds and reproductive structures.  Seedling densities on two sites
after the summer fire was 3.04 and 6.29 seedlings per square foot (32.7
and 67.6/sq m), considerably higher than the spring fire regeneration
[58].  On a Little Sioux Fire site, seedling density decreased from 0.91
seedlings/sq ft (9.8/sq m) in the first postfire year to 0.61
seedlings/sq ft (6.6/sq m) in postfire year 2 because of competition
[14].

In a 3-year study of postfire emergence of jack pine seed sown on two
recently burned seedbed sites, jack pine seeds germinated in the first 2
years after being sown, but not the third year.  On the wetter site,
37 percent of viable seed sown emerged the first year and 18 percent
the second year.  On the drier site, 14 percent emerged the first year
and 8 percent emerged the second year.  The seedbed may be more
favorable in postfire year 2 because of shade provided by regenerating
understory species.  The authors conclude that a 1-year delayed
emergence from soil-stored seed is an important strategy for postfire
jack pine regeneration [78].

Conflicting reports in the literature of the effect ash has on jack pine
germination may result from differences in type of ash and degree of
leaching.  Ash from burned surface organic matter is chemically neither
detrimental nor advantageous to the establishment of jack pine.  Wood
ash is detrimental because of its extreme alkalinity, and hardwood ash
is a poorer substrate than softwood ash.  Leaching of the ash improves
germination rates [79].
  • 14. Books, David J. 1972. Little Sioux Burn: year two. Naturalist. 23(3&4): 2-7. [11550]
  • 18. Chapman, H. H. 1952. The place of fire in the ecology of pines. Bartonia. 26: 39-44. [14549]
  • 22. Chrosiewicz, Z. 1974. Evaluation of fire-produced seedbeds for jack pine regeneration. Canadian Journal of Forest Research. 4(4): 455-457. [12405]
  • 58. Ohmann, Lewis F.; Grigal, David F. 1981. Contrasting vegetation responses following two forest fires in northeastern Minnesota. The American Midland Naturalist. 106(1): 54-64. [8285]
  • 77. Thomas, P. A.; Wein, Ross W. 1985. The influence of shelter and the hypothetical effect of fire severity on the postfire establishment of conifers from seed. Canadian Journal of Forest Research. 15: 148-155. [7291]
  • 78. Thomas, P. A.; Wein, Ross W. 1985. Delayed emergence of four conifer species on postfire seedbeds in eastern Canada. Canadian Journal of Forest Research. 15: 727-729. [7882]
  • 79. Thomas, P. A.; Wein, R. W. 1990. Jack pine establishment on ash from wood and organic soil. Canadian Journal of Forest Research. 20: 1926-1932. [13594]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Immediate Effect of Fire

More info for the term: tree

Mature individuals survive low-severity fires [65].  Jack pine is
typically killed by crown fires or by moderate-severity surface fires
[37].  Alexander [7] found that double fire scars were fairly common in
jack pine, but triple fire scars were rare, suggesting that an
individual tree may survive only one or two surface fires in a lifetime.
  • 7. Alexander, Martin E. 1980. Forest fire history research in Ontario: a problem analysis. In: Stokes, Marvin A.; Dieterich, John H., technical coordinators. Proceedings of the fire history workshop; 1980 October 20-24; Tucson, AZ. Gen. Tech. Rep. RM-81. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station: 96-109. [16049]
  • 37. Frissell, Sidney S., Jr. 1973. The importance of fire as a natural ecological factor in Itasca State Park, Minnesota. Quatenary Research. 3: 397-407. [12988]
  • 65. Rowe, J. S. 1983. Concepts of fire effects on plant individuals and species. In: Wein, Ross W.; MacLean, David A., eds. SCOPE 18: The role of fire in northern circumpolar ecosystems. Chichester; New York: John Wiley & Sons: 135-154. [2038]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Post-fire Regeneration

More info for the terms: crown residual colonizer, tree

   Tree without adventitious-bud root crown
   Crown residual colonizer (on-site, initial community)
   Initial-offsite colonizer (off-site, initial community)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Fire Ecology

More info for the terms: duff, fire intensity, fuel, fuel continuity, high-severity fire, lichen, litter, natural, serotinous

Of all boreal forest conifers, jack pine is best adapted to fire [66].
With medium thick bark [15], mature individuals have only a moderate
tolerance of fire, but populations survive because of delayed seed
release from serotinous cones, early reproductive maturity, fast growth
rates in full sun, and preference for mineral soil seedbeds [54,66].

In a model that integrates plant population dynamics and disturbance,
jack pine is used to illustrate a species that maximizes the probability
of being reproductively mature at the time of the next recruitment
opportunity.  Fire provides the regeneration opportunity which usually
results in mortality of the mature forest [27].

Cone serotiny:  The resin of serotinous cones melts when heated, usually
at temperatures in excess of 140 degrees Fahrenheit (60 deg C).  In one
study, cones opened in 80 seconds at 200 degrees Fahrenheit (93 deg C)
and within 20 seconds at temperatures above 400 degrees Fahrenheit (204
deg C).  Seed viability is not markedly affected by heating, unless the
cone ignites, which results in complete loss of seed viability.  For
cones at 8 percent moisture content, the interval between cone opening
and cone ignition lies between about 200 and 1,300 degrees Fahrenheit
(93-705 deg C), depending on the time of exposure.  Cones exposed to
temperatures of 800 degrees (427 deg C) or less did not ignite during a
5-minute test.  Cones ignited in 60 seconds when exposed to temperatures
of 900 degrees (482 deg C) Fahrenheit and in 2 seconds when exposed to
temperatures of 1,300 degrees Fahrenheit (705 deg C).  Heating cones at
900 degrees Fahrenheit (482 deg C) for 30 seconds had no adverse effect
on germination.  Jack pine seeds unprotected by cones remain viable when
exposed to high temperatures until the wings ash and the seed coats
crack [9].  Crown torching does not ignite cones because the high
temperatures are unlikely to last more than 3 minutes [9].

Regeneration:  Seeds are dispersed from cones after fire and germinate
on burned duff or mineral soil exposed by fire.  Regeneration failures
are associated with low-severity surface fires that result in little
crown involvement [76] or in little duff removal [11].   

Fire regime:  Estimates of fire intervals in jack pine forests are
generally less than 50 years [40].  Based on jack pine fire scars, the
shortest and longest times between major fires in jack pine forests of
northern Ontario were 5 and 30 years, respectively [50].  The mean fire
return interval for jack pine forests in the Athabasca Plains in
northern Saskatchewan and northeastern Alberta is 38 years [16].  Large
upland ridges and ridge complexes, far from natural fire breaks, burn
most frequently.  Jack pine forests that burn more frequently than every
5 to 10 years become pine barrens [31].  Major stand-replacing fires in
the Boundary Waters Canoe Area occurred in years with summer droughts
[40].

The accumulation of litter and debris on the forest floor over time
increase the likelihood of moderate- or high-severity fire [40].  A
lichen mat, a highly flammable and continuous fuel source at ground
level, develops within 40 years and is important in supporting fires in
jack pine forests [16].

Mature and immature jack pine forests have very different stand and fuel
characteristics and, therefore, exhibit different fire behavior.  The
mature jack pine fuel type in Ontario is characterized by 635 jack pine
per acre (1,569/ha) averaging 58 feet (17.7 m) in height, and 5.8 inches
(14.7 cm) in d.b.h. with an understory of black spruce [76].  The base
of live crown in mature jack pine forests is typically 33 feet (10 m)
above the ground surface [42].

After observing 12 experimental fires under different weather
conditions, Stocks [75] grouped fire behavior in the mature jack pine
fuel type into three categories:  (1) surface fires with slow to
moderate rates of spread, low to medium flame heights (0.3 to 3.3 feet
[0.1-1.0 m]), and a fire intensity less than 140 btu/s/ft ( less than 500 kW/m);
(2) vigorous surface fires with various degrees of torching or
intermittent crowning, flame heights about 6.6 feet (2 m), and fire
intensities of 140 to 870 btu/s/ft (500-3,000 kW/m); and (3) extremely
vigorous surface behavior with high rates of spread (33 feet per minute
[10 m/min]) that result in active crown fires with intensities over 1160
btu/s/ft (4,000 kW/m).  Because of the gap between the crown base and
the surface fuels, sustained crown fires in this fuel type are rare,
even with windspeeds above 16 miles per hour (25 km/h) at 33 feet (10 m)
above the ground surface [76].

The immature jack pine fuel type is characterized by 3,489 live jack
pine stems per acre (8,614/ha) averaging 26.9 feet (8.2 m) in height and
2.1 inches (5.3 cm) in d.b.h. with an understory of 3,953 dead,
suppressed jack pine stems per acre (9,760/ha) ranging from 7 to 20 feet
(2-6 m) in height [76].  The extremely dense nature of the stand and the
vertical fuel continuity make it difficult for fires to spread at even
moderate rate without crown fuels becoming involved [74].  Active crown
fires occur at intensities of 1,450 btu/s/ft (5,000 kW/m) [76].  This
fuel type crowns at a lower rate of spread than any other boreal forest
fuel type [42].  Of 12 experimental fires in immature jack pine stands,
the only two fires that did not crown had very low spread rates of 2.3
and 6.9 feet per minute (0.7 and 2.1 m/min), representing minimum
conditions for continuous fire spread in this fuel type.  The rate of
spread for the other 10 fires that crowned ranged from 26 to 162 feet
per minute (7.9-49.4 m/min) [74].  Short-term spread rates and
intensities as high as 223 feet per minute (68 m/min) and 17,350
btu/s/ft (60,000 kW/m) have been documented [76].

Temperatures during 18 surface fires in an open jack pine barren in
northern Ontario were recorded.  The ground vegetation consisted of
sweet-fern (Comptonia peregrina), blueberries (Vaccinium spp.), and
abundant lichen and moss.  Temperatures recorded at 2 to 4 inches (5-10
cm) above the ground ranged from 248 to 1013 degrees Fahrenheit (120-545
deg C).  Fires with temperatures greater than 662 degrees Fahrenheit
(350 deg C) occurred in dense vegetation with more than 0.7 ounce per
square foot (235 g/sq m) fuel dry weight.  High wind speeds appeared to
have a cooling effect on the fire temperatures [73].
  • 31. Curtis, John T. 1959. The vegetation of Wisconsin. Madison, WI: The University of Wisconsin Press. 657 p. [7116]
  • 9. Beaufait, William R. 1960. Some effects of high temperatures on the cones and seeds of jack pine. Forest Science. 6(3): 194-199. [12407]
  • 11. Beaufait, William R. 1962. Procedures in prescribed burning for jack pine regeneration. Tech. Bull. No. 9. L'Anse, MI: Michigan College of Mining and Technology, Ford Forestry Center. 39 p. [11752]
  • 15. Brown, Arthur A.; Davis, Kenneth P. 1973. Forest fire control and use. 2nd ed. New York: McGraw-Hill. 686 p. [15993]
  • 16. Carroll, S. B.; Bliss, L. C. 1982. Jack pine - lichen woodland on sandy soils in northern Saskatchewan and northeastern Alberta. Canadian Journal of Botany. 60: 2270-2282. [7283]
  • 27. Clark, James S. 1991. Disturbance and tree life history on the shifting mosaic landscape. Ecology. 72(3): 1102-1118. [14584]
  • 40. Heinselman, Miron L. 1973. Fire in the virgin forests of the Boundary Waters Canoe Area, Minnesota. Quaternary Research. 3: 329-382. [282]
  • 42. Johnson, Edward A. 1992. Fire and vegetation dynamics: studies from the North American boreal forest. Cambridge Studies in Ecology. Cambridge: Cambridge University Press. 129 p. [19950]
  • 50. Lynham, Timothy J.; Stocks, B. J. 1991. The natural fire regime of an unprotected section of the boreal forest in Canada. In: Proceedings, 17th Tall Timbers fire ecology conference; 1989 May 18-21; Tallahassee, FL. Tallahassee, FL: Tall Timbers Research Station: 99-109. [17602]
  • 54. McCune, Bruce. 1988. Ecological diversity in North American pines. American Journal of Botany. 75(3): 353-368. [5651]
  • 66. McCune, Bruce. 1982. Site, history and forest dynamics in the Bitterroot canyons, Montana. Madison, WI: University of Wisconsin. 166 p. Thesis. [7232]
  • 74. Stocks, B. J. 1987. Fire behavior in immature jack pine. Canadian Journal of Forest Research. 17: 80-86. [20003]
  • 75. Stocks, B. J. 1989. Fire behavior in mature jack pine. Canadian Journal of Forest Research. 19: 783-790. [8672]
  • 73. Smith, David W.; Sparling, John H. 1966. The temperatures of surface fires in jack pine barrens. Canadian Journal of Botany. 44(10): 1285-1292. [9011]
  • 76. Stocks, Brian J.; Alexander, Martin E. 1980. Forest fire behaviour and effects research in northern Ontario: a field oriented program. In: Martin, Robert E.; Edmonds, Robert L.; Faulkner, Donald A.; [and others], eds. Proceedings, 6th conference on fire and forest meteorology; 1980 April 22-24; Seattle, WA. Washington, DC: Society of American Foresters: 18-24. [10291]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Successional Status

More info on this topic.

More info for the terms: climax, codominant

Obligate Initial Community Species

Jack pine invades areas where mineral soil has been exposed by major
disturbance such as fire [17].  It also rapidly invades newly formed
dunes after stabilization by grasses [60].  It is one of the most
shade-intolerant trees in its native range; only aspens, paper birch,
and tamarack are less tolerant [67].

Jack pine begins to show signs of decadence by age 75 [17], decreases in
frequency by 150 years, and may disappear completely after 200 years
[13], although some relic jack pine survive nearly 250 years [40].  In
the absence of fire, jack pine is succeeded by longer lived species such
as red pine (P. resinosa) or white pine, or by more shade-tolerant
species such as balsam fir and black spruce (Picea mariana).  Black
spruce, which often seeds in at the same time as jack pine, grows slower
but lives longer, becoming codominant after 90 years and eventually
succeeding jack pine [16,40,42].  On the driest, harshest sites, jack
pine may persist and form an edaphic climax [67].

Although generally occurring in even-aged stands that regenerated after
fire [34], some jack pine stands are uneven-aged.  Recruitment of jack
pine may occur fairly long after a fire if the stand is only partially
stocked.  In 65 percent of mature stands studied in northern lower
Michigan, the largest individuals differed in age by 10 to 23 years.
Two stands contained 40- to 45-year-old jack pines that had survived a
wildfire 10 years previously, a dominant intermediate class of 22- to
35-year-old pine regenerated after the fire, and numerous smaller
individuals from 4 to 20 years of age [1].  Zoladeski and Maycock [85]
suggest that recruitment of jack pine stops completely 50 years after
stand initiation, and that ultimate success is limited to the earliest
generation of jack pine.

Clearcutting alone or clearcutting followed by burning converts sites
previously dominated by mature jack pine to meadows dominated by Carex
spp. or early successional hardwoods, respectively [67]].
  • 34. Eyre, F. H., ed. 1980. Forest cover types of the United States and Canada. Washington, DC: Society of American Foresters. 148 p. [905]
  • 1. Abrams, Marc D. 1991. Post-fire revegetation of jack pine sites in Michigan: an example of successional complexities. In: Proceedings, 17th Tall Timbers fire ecology conference; 1989 May 18-21; Tallahassee, FL. Tallahassee, FL: Tall Timbers Research Station: 197-209. [17609]
  • 13. Bergeron, Yves; Dubuc, Michelle. 1989. Succession in the southern part of the Canadian boreal forest. Vegetatio. 79: 51-63. [5042]
  • 16. Carroll, S. B.; Bliss, L. C. 1982. Jack pine - lichen woodland on sandy soils in northern Saskatchewan and northeastern Alberta. Canadian Journal of Botany. 60: 2270-2282. [7283]
  • 17. Cayford, J. H.; McRae, D. J. 1983. The ecological role of fire in jack pine forests. In: Wein, Ross W.; MacLean, David A., eds. The role of fire in northern circumpolar ecosystems. Scope 18. New York: John Wiley & Sons: 183-199. [18509]
  • 40. Heinselman, Miron L. 1973. Fire in the virgin forests of the Boundary Waters Canoe Area, Minnesota. Quaternary Research. 3: 329-382. [282]
  • 42. Johnson, Edward A. 1992. Fire and vegetation dynamics: studies from the North American boreal forest. Cambridge Studies in Ecology. Cambridge: Cambridge University Press. 129 p. [19950]
  • 60. Olson, Jerry S. 1958. Rates of succession and soil changes on southern Lake Michigan sand dunes. Botanical Gazette. 119(3): 125-170. [10557]
  • 67. Rudolph, T. D.; Laidly, P. R. 1990. Pinus banksiana Lamb. jack pine. In: Burns, Russell M.; Honkala, Barbara H., technical coordinators. Silvics of North America. Volume 1. Conifers. Agric. Handb. 654. Washington, DC: U.S. Department of Agriculture, Forest Service: 280-293. [13391]
  • 85. Zoladeski, Christopher A.; Maycock, Paul F. 1990. Dynamics of the boreal forest in northwest Ontario. The American Midland Naturalist. 124(2): 289-300. [13496]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Regeneration Processes

More info for the terms: duff, presence, serotinous, tree

The minimum seed-bearing age of open-grown jack pine is 5 to 10 years.
Some seed is produced every year and serotinous cones accumulate in the
crown.  A mature stand of jack pine may have as many as 2 million seeds
per acre (5 million/ha) stored in unopened cones [35].  Because of
abundant seed production, few mature trees are necessary to regenerate a
stand.  Regeneration after fire in a balsam fir (Abies balsamea) forest
with only 5 relic jack pine per acre (12/ha) averaged 400 jack pine
seedlings per acre (1000/ha) in the first postfire year [74].

The serotinous cones, sealed shut by a resinous bond, require high
temperatures to open.  This heat is usually provided by fire, but hot,
dry weather (air temperatures of at least 80 degrees Fahrenheit [27 deg
C]) also opens some cones [67].  Because temperatures required to open
cones typically occur in the warmest part of the summer, survival of new
germinants may be poor because of drought conditions or lack of time to
become established before winter.

The winged seeds are the smallest of the native North American pines
[35] and are dispersed by gravity and wind.  The effective dispersal
range is about 110 to 130 feet (34-40 m) or two tree heights [53].

Seeds usually germinate rapidly after release when the 10-day mean
maximum air temperature is 65 degrees Fahrenheit (18 deg C) or higher
[35].  Jack pine seeds occasionally exhibit partial dormancy which is
probably broken naturally by heat from fire [4].  Seeds remain viable in
closed cones for years, but viability decreases over time.  Eyre and
LeBarron [35] found that 1- to 6-year-old cones had 78 to 89 percent
seed viability and cones over 5 years old had 62 percent seed viability.
Fifty percent of 20-year-old seeds may be viable [17].

Exposed mineral soil or thin residual humus of about 0.2 inch (0.5 cm)
or less provide the best seedbeds.  The presence of deeper humus has an
adverse effect on establishment; humus deeper than 1.5 inches (3.8 cm)
is a low-quality seedbed [22].  Successful germination and establishment
of jack pine usually occurs only after fire, but mechanical disturbance
may also expose adequate mineral seedbeds [33].  In northeastern
Minnesota, germination averaged 63 percent on mineral soil, 49 percent
on burned duff, 47 percent on scarified duff, and 17 percent on
undisturbed duff.  First-year survival of germinated seedlings was 84
percent on mineral soil, 70 percent on burned duff, 41 percent on
scarified duff, and 41 percent on undisturbed duff [35].

Germination and initial survival sometimes improve with partial shade,
but the positive effect of shade eventually becomes negative because
seedlings soon require higher light levels [10].  Mortality of
2-year-old jack pine seedlings was high under 11 and 20 percent of full
light, but minimal under 43 percent light and higher [69].  Seedling
survival may be low if drought conditions follow germination.  However,
in northeastern Minnesota, 3 consecutive days of 140 degree Fahrenheit
(60 deg C) surface temperatures for 2 hours did not result in
appreciable jack pine mortality [5].

During its first 20 years, jack pine is one of the fastest growing
conifers in its native range [67].  Maximum growth occurs under 43
percent light and higher [69].

Jack pine does not reproduce vegetatively.
  • 5. Ahlgren, Clifford E. 1970. Some effects of prescribed burning on jack pine reproduction in northeastern Minnesota. Misc. Rep. 94, Forestry Series 5-1970. Minneapolis, MN: University of Minnesota, Agricultural Experiment Station. 14 p. [7285]
  • 4. Ahlgren, Clifford E. 1959. Some effects of fire on forest reproduction in northeastern Minnesota. Journal of Forestry. 57: 194-200. [208]
  • 10. Beaufait, William R. 1960. Influences of shade level and site treatment, including fire, on germination and early survival of Pinus banksiana. Lansing, MI: Michigan Department of Conservation, Forestry Division. 79 p. [11751]
  • 17. Cayford, J. H.; McRae, D. J. 1983. The ecological role of fire in jack pine forests. In: Wein, Ross W.; MacLean, David A., eds. The role of fire in northern circumpolar ecosystems. Scope 18. New York: John Wiley & Sons: 183-199. [18509]
  • 22. Chrosiewicz, Z. 1974. Evaluation of fire-produced seedbeds for jack pine regeneration. Canadian Journal of Forest Research. 4(4): 455-457. [12405]
  • 33. Eyre, F. H. 1938. Can jack pine be regenerated without fire? Journal of Forestry. 36: 1067-1072. [18688]
  • 35. Eyre, F. H.; LeBarron, Russell K. 1944. Management of jack pine stands in the Lake States. Tech. Bull. No. 863. Washington, DC: U.S. Department of Agriculture, Forest Service. 66 p. [11643]
  • 53. McCaughey, Ward W.; Schmidt, Wyman C.; Shearer, Raymond C. 1986. Seed-dispersal characteristics of conifers. In: Shearer, Raymond C., compiler. Proceedings--conifer tree seed in the Inland Mountain West symposium; 1985 August 5-6; Missoula, MT. Gen. Tech. Rep. INT-203. Ogden, UT: U.S. Department of Agriculture, Forest Service, Intermountain Research Station: 50-62. [12593]
  • 67. Rudolph, T. D.; Laidly, P. R. 1990. Pinus banksiana Lamb. jack pine. In: Burns, Russell M.; Honkala, Barbara H., technical coordinators. Silvics of North America. Volume 1. Conifers. Agric. Handb. 654. Washington, DC: U.S. Department of Agriculture, Forest Service: 280-293. [13391]
  • 69. Shirley, Hardy L. 1945. Reproduction of upland conifers in the Lake States as affected by root competition and light. The American Midland Naturalist. 33(3): 537-612. [10367]
  • 74. Stocks, B. J. 1987. Fire behavior in immature jack pine. Canadian Journal of Forest Research. 17: 80-86. [20003]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Growth Form (according to Raunkiær Life-form classification)

More info on this topic.

More info for the term: phanerophyte

  
   Phanerophyte

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Form

More info for the term: tree

Tree

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reaction to Competition

Jack pine is one of the most  shade-intolerant trees in its native range. It is the least tolerant of  its associated pine species and is slightly more tolerant than aspen,  birch, and tamarack. Jack pine may be more tolerant in the seedling stage  and often requires some shade on dry sites to reduce surface temperatures  and evapotranspiration. Soon after seedlings are established, however,  they should receive full sunlight to assure survival (10,61). Overall,  jack pine can most accurately be classed as intolerant of shade.

    Overstocked jack pine seedling and sapling stands with 4,950 or more  trees per hectare (2,000/acre) should be weeded or cleaned (precommercial  thinning) to improve growth and development. Otherwise such stands may  stagnate because natural thinning in jack pine stands is slow except on  the best sites (10). A study in northern Minnesota, wherein direct seeding  produced a stand averaging 32,100 trees per hectare (13,000/acre) at age 5  years, compared the growth of no thinning with thinning to square spacings  of 1.2, 1.8, and 2.4 m (4, 6, and 8 ft). Twenty-two years later the  treatments averaged 9, 10, 13, and 15 cm (3.7, 4.1, 5.1, and 5.8 in) in  d.b.h., respectively (14). Planting, direct seedings, and precommercial  thinnings should have a goal of 2,000 to 3,000 trees per hectare (800 to  1,200/acre) by age 10 years (19,30).

    Jack pine is a pioneer species on burns or other exposed sites. In the  absence of fire or other catastrophes, jack pine is succeeded by more  tolerant species, but on the poorest, driest sites it may persist and form  an edaphic climax. In loamy sands and sandy loams in northern Minnesota,  the usual succession is from jack pine to red pine to eastern white pine  to a hardwood type composed of sugar maple (Acer saccharum), basswood  (Tilia americana), and northern red oak. Frequently, the red pine  and white pine stages are absent and jack pine is followed by speckled  alder (Alnus rugosa), American hazel (Corylus americana), beaked  hazel (C. cornuta), paper birch, and quaking aspen. This stage is  followed by either the sugar maple-basswood association or spruce-fir. On  loamy soils in northeastern Minnesota and parts of Canada, jack pine is  succeeded by black spruce, white spruce, balsam fir, and paper birch.  Eventually, the paper birch is eliminated from this association. In parts  of northwestern Canada, jack pine may be replaced directly by white  spruce; in parts of eastern Canada, the immediate succession may be to   pure black spruce (10,26,61).

  • Burns, Russell M., and Barbara H. Honkala, technical coordinators. 1990. Silvics of North America: 1. Conifers; 2. Hardwoods.   Agriculture Handbook 654 (Supersedes Agriculture Handbook 271,Silvics of Forest Trees of the United States, 1965).   U.S. Department of Agriculture, Forest Service, Washington, DC. vol.2, 877 pp.   http://www.na.fs.fed.us/spfo/pubs/silvics_manual/table_of_contents.htm External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

T. D. Rudolph

Source: Silvics of North America

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Rooting Habit

Jack pine frequently develops a taproot as a  seedling and maintains it to maturity. During the first growing season  under natural conditions the seedling root system penetrates to a depth of  13 to 25 cm (5 to 10 in). By the end of the second growing season jack  pine seedlings on typical sandy soils in the open have a dry weight  between 1 and 2 g (0.04 and 0.08 oz), have developed 8 to 10 cm (3 to 4  in) tops, and have root systems from 28 to 33 cm (11 to 13 in) deep and   from 46 to 61 cm (18 to 24 in) wide. On a moist sandy soil with the water  table about 76 cm (30 in) below the surface in Upper Michigan, roots  penetrated to 53 cm (21 in) in 2 years but only to 61 cm (24 in) by 7  years; the lateral spread, however, increased from 0.9 to 1.2 m (3 to 4  ft) at 2 years to 4.3 to 4.9 m (14.0 to 16.2 ft) at 7 years. In the  7-year-old trees the average volume of the top, stem, branches, and  foliage was about 4000 cm³ (244 in³) as compared to 1200 cm³  (73 in³) for the root system (61).

    In northern Minnesota, root growth begins when the temperature reaches 4°  C (40° F) in the upper 15 cm (6 in) of soil, usually within a week of  the onset of shoot growth. Root growth ceases in the fall when soil  temperature drops to 7° C (45° F) for 6 days or more. In some  years root growth may begin in April and continue to late October.  Seven-year-old trees elongated their lateral roots an average of 38 cm (15  in) in 1 year (61). In Manitoba, root development of jack pine growing on  dry and fresh sands was confined mainly to the taproot for the first 1 to  3 years, but lateral branching became increasingly common on 3- to  4-year-old seedlings. Mycorrhizae were found on 1-year-old seedlings (16).

    On deep, well-drained soils the roots may penetrate below 2.7 m (9 ft).  Trees without distinct taproots usually have lateral roots that turn and  grow downward as they approach other trees. The bulk of the root system,  however, consists of laterals confined largely to the upper 46 cm (18 in)  of soil; much of the root system is in the upper 15 cm (6 in) of soil. In  25-year-old jack pine stands in central Wisconsin, the dry weight of all  roots in the upper 1.5 m (5 ft) of soil was 10 980 to 13 790 kg/ha (9,800  to 12,300 lb/acre) (61). A 40-year-old stand of jack pine in northern  Minnesota produced 28 000 kg/ha (24,978 lb/acre), ovendry weight, of roots  greater than 0.5 cm (0.2 in) and stumps less than 15 cm (6 in) tall (73).

  • Burns, Russell M., and Barbara H. Honkala, technical coordinators. 1990. Silvics of North America: 1. Conifers; 2. Hardwoods.   Agriculture Handbook 654 (Supersedes Agriculture Handbook 271,Silvics of Forest Trees of the United States, 1965).   U.S. Department of Agriculture, Forest Service, Washington, DC. vol.2, 877 pp.   http://www.na.fs.fed.us/spfo/pubs/silvics_manual/table_of_contents.htm External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

T. D. Rudolph

Source: Silvics of North America

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Cyclicity

Phenology

More info on this topic.

Jack pine staminate and ovulate cone primordia are initiated in late
summer and then go dormant until spring.  Pollen shedding usually occurs
in late spring or early summer but is highly dependent on the weather.
Fertilization occurs 13 months after pollination.  Cones mature in late
summer or early fall, 2 years after initiation [67].
  • 67. Rudolph, T. D.; Laidly, P. R. 1990. Pinus banksiana Lamb. jack pine. In: Burns, Russell M.; Honkala, Barbara H., technical coordinators. Silvics of North America. Volume 1. Conifers. Agric. Handb. 654. Washington, DC: U.S. Department of Agriculture, Forest Service: 280-293. [13391]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Vegetative Reproduction

Under natural conditions jack pine does  not reproduce vegetatively. Jack pine cuttings from young trees can be  rooted but rooting ability decreases rapidly with increasing ortet age.  Cuttings from 4-month-old seedlings gave 75 percent rooting (7) but  average rooting was only 7 percent in cuttings from 6-year-old ortets and  5 percent in those from 10-year-old ortets (90). Clonal variation in  rooting percentage ranged from 0 to 31.

    Aryl esters of indole auxins can enhance rooting of jack pine cuttings  taken from young seedlings. Phenyl indole-3-butyric (P-IBA) treatment  caused 12 percent more jack pine cuttings to root than did treatment with  indole-3-butyric acid (IBA), and up to 30 percent more than no treatment  (34).

    Rooting needle fascicles has potential for establishing large clones in  a short time. Shearing the terminal buds on trees up to 5 years old  induces the fascicular buds to differentiate and develops shoots. Treating  such shoots from 2-year-old trees with IBA (0.1 percent) and placing them  in a heated rooting medium under a 20-hour photoperiod resulted in up to  70 percent rooting (71).

    Jack pine can be grafted, most successfully using dormant scions and  when grafting is done just as the rootstock resumes growth in the spring.  Both early and delayed graft incompatibility may occur; the causes are  unknown (72). No complete jack pine plants have yet been propagated from  either callus tissue or cell suspension cultures (72).

  • Burns, Russell M., and Barbara H. Honkala, technical coordinators. 1990. Silvics of North America: 1. Conifers; 2. Hardwoods.   Agriculture Handbook 654 (Supersedes Agriculture Handbook 271,Silvics of Forest Trees of the United States, 1965).   U.S. Department of Agriculture, Forest Service, Washington, DC. vol.2, 877 pp.   http://www.na.fs.fed.us/spfo/pubs/silvics_manual/table_of_contents.htm External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

T. D. Rudolph

Source: Silvics of North America

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Seedling Development

Germination is epigeal (45). Jack pine  seed usually germinates within 15 to 60 days under favorable conditions  (61), but some seeds require more than 100 days to germinate (72). Delayed  germination of direct seeding increased stocking between the first and  third year after sowing (60).

    Under forest conditions with adequate moisture, seeds germinate when air  temperatures reach 18° C (64° F) but light also influences  germination (2,61). Under continuous light, germination was complete at a  range of temperatures from 16° to 27° C (60° to 80° F)  (2). Germination was markedly reduced at all temperatures when light was  excluded. The shade cast by slash and snags on burned-over or cut-over  areas to reduce surface temperature and drying undoubtedly contributes  substantially to the good germination often observed on such areas (16).

    Type of seedbed is an important factor affecting jack pine seed  germination (16,61). In northeastern Minnesota, germination under clearcut  and partially cut jack pine stands averaged 60 percent on mineral soil, 49  percent on burned duff, 47 percent on scarified and shaded duff, and 17  percent on undisturbed duff (61). The poor germination on litter and humus  is caused by poor moisture conditions and it can be satisfactory in years  of above normal precipitation. Germination may be delayed by spring  drought (16). Associated species can affect germination, survival, and  growth of jack pine differentially, probably as a result of allelopathy  (13).

    Survival on various seedbeds shows the same trend as germination (61).  Optimum conditions for jack pine seedling establishment and survival are  provided by mineral soil and burned seedbeds where competition from other  vegetation is not severe (16), the water table is high, and there is some  shade (61). Competition from shrubs and herbaceous vegetation, together  with smothering by fallen leaves, are important causes of seedling  mortality on sandy soils in Ontario. On clay soils in Manitoba and  Saskatchewan, competition from aspen and hazel are responsible for poor  survival. On similar soils in western Manitoba competing grasses kill many  seedlings (16).

    Most of the older jack pine stands appear to have been established  following fires (61). Although jack pine seed usually germinates following  fire, most of the seedlings die unless the organic matter left on the soil  is less than 1.3 cm (0.5 in) thick. Most germination occurs the first and  second season following fire, with most mortality between the first and  second growing season. Unless conditions for germination and early  survival are favorable, good regeneration does not necessarily follow  burns (20,61).

    Young seedlings grow tallest in full sunlight (48), although under  stands their initial abundance may be greatest in light intensities of 11  to 30 percent of full sunlight, but no seedlings are found at 60 percent  and higher crown cover (61).

    Under forest conditions, seedling growth is slow in the first 3 years  but increases rapidly beginning in the fourth and fifth years. Seedlings  attain a height of about 5 cm (2 in) the first year, 15 cm (6 in) at 2  years, and 30 to 90 cm (12 to 36 in) at 4 years. Early growth of 2-0  seedlings in plantations is more rapid, amounting to 30 to 45 cm (12 to 18  in) per year on medium sites (61).

    Shoot growth begins in late April and early May at Cloquet, MN, and  Chalk River, ON (62,63,80), and about May 10 in the Upper Peninsula of  Michigan (61). Essentially all height growth is completed in 61 to 68 days  at the three locations. Maximum growth rate approaches 1 cm (0.4 in) per  day in both Minnesota and Ontario. Although shoot growth in jack pine  ceases long before the end of the frost-free season, the remaining time  may be necessary to complete latewood growth, lignification, terminal bud  development, and hardening off to resist frost (80).

    If favorable moisture conditions prevail in late summer, jack pine  frequently has a second period of shoot elongation and produces lammas and  proleptic shoots (62,63). Trees with lammas shoots had a longer growth  period than those without them but did not grow significantly less the  following year. The late growth does not result in detectable increases in  diameter growth and it may or may not result in false rings. Fall frost  injury resulting in frost rings, however, may be frequent in the current  shoots of trees with lammas growth.

  • Burns, Russell M., and Barbara H. Honkala, technical coordinators. 1990. Silvics of North America: 1. Conifers; 2. Hardwoods.   Agriculture Handbook 654 (Supersedes Agriculture Handbook 271,Silvics of Forest Trees of the United States, 1965).   U.S. Department of Agriculture, Forest Service, Washington, DC. vol.2, 877 pp.   http://www.na.fs.fed.us/spfo/pubs/silvics_manual/table_of_contents.htm External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

T. D. Rudolph

Source: Silvics of North America

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Seed Production and Dissemination

Jack pine trees, particularly  under good early growing conditions, begin to flower at a younger age than  most other pine species (41,65,68). Under near optimum growing conditions  in the greenhouse and nursery, female flowering can be induced in a small  percentage of seedlings as early as 12 months from seed sowing (68). Male  flowering under these conditions usually does not begin until the fourth  year. An accumulated yield of 2,861,000 filled seeds per hectare  (1,158,000/acre) can be produced through the first 8 years in plantations  with 2.4 m (8 ft) between trees (67).

    In naturally regenerated stands, jack pine typically begins to flower at  5 to 10 years under open-grown conditions but not until later in closed  stands (61). Once cone production in jack pine begins, it is fairly  regular and increases until crown competition becomes a factor. Seed  production differs from year to year but some seed is usually produced  every year and total crop failures are rare (31,61).

    Seed yields per cone range from about 15 to 75 (72). Strongly curved  cones yield less seed than straight ones (72). Ovulate abortion on the  inner curvature of cones is twice that on the outer curvature (17). The  average number of scales per cone can be more than 80 but usually only a  little more than one-third of the scales, those in the upper end of the  cones, bear seeds (72).

    Over much of its natural range jack pine bears predominantly serotinous  cones, but in the southern part cones are nonserotinous. Total seeds  stored on the trees in serotinous cones can reach more than 14.6 kg or 4  million seeds per hectare (13.0 lb or 1.6 million/acre) in well stocked  mature stands (61). As viability after 5 to 10 years may be significantly  reduced, however, only cones 6 years old or less should be collected (8).  Commercially cleaned seeds range between 156,500 and 551,000/kg (71,000  and 250,000/lb) with an average of 288,800/kg (131,000/lb) (45).

    Well-stocked, mature stands in the Lake States dispersed an annual  average of 6,670 to 25,950 seeds per hectare (2,700 to 10,500/acre) over 5  years; much of the total crop remained in the unopened cones. In areas  with nonserotinous or partially serotinous cones, seed may be disseminated  during any season. The effective range of seed dissemination, as measured  by established seedlings, is about two tree heights although it is low  beyond one tree height (61).

    The melting temperature of the resinous bonding material of the cone  scales is 50° C (122° F), but it is likely that the bonding  resin softens at lower temperatures in the nonserotinous types in the  southern portion of the species' range. The mechanism of cone opening in  both serotinous and nonserotinous cones is hygroscopic. Once the bonding  material of the cone scales is broken, the quantity of water in the scales  is the limiting factor in scale movement and flexing outward under drying  condition (35,61).

    Jack pine cones open most readily during dry weather when the  temperature is at least 27° C (80° F), although many of them  remain closed until they are exposed to fire or high temperatures near the  ground after wind breakage or logging. Over most of its range where  serotinous cones are common, up to 50 percent may open on the sunny part  of the crown. Cones may also open in very cold winters when the  temperature is -46° C (-50° F) or colder (61).

    Cone and seed crops in jack pine may be reduced by numerous agents (61).  Rainy weather at time of pollination may reduce seed set. Cone and seed  production are also reduced by cone and ovulate abortion (17,66), but the  severe losses previously attributed to abortion may be partially the  result of insect attacks. Within a cone, all the ovules near the base of  the cone abort and abortion decreases toward the tip (17).

  • Burns, Russell M., and Barbara H. Honkala, technical coordinators. 1990. Silvics of North America: 1. Conifers; 2. Hardwoods.   Agriculture Handbook 654 (Supersedes Agriculture Handbook 271,Silvics of Forest Trees of the United States, 1965).   U.S. Department of Agriculture, Forest Service, Washington, DC. vol.2, 877 pp.   http://www.na.fs.fed.us/spfo/pubs/silvics_manual/table_of_contents.htm External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

T. D. Rudolph

Source: Silvics of North America

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Flowering and Fruiting

Jack pine is a monoecious species.  Ovulate cones are usually borne on primary and secondary branches in the  upper tree crown and staminate cones are usually borne on tertiary  branches lower in the crown. Ovulate cones are modified long shoots and  staminate cones are modified dwarf shoots (24).

    In northeastern Wisconsin, bud initiation for the following year's shoot  systems begins in late June or early July. Staminate cone primordia are  initiated in early or mid-July but ovulate primordia are not initiated  until August. By early September the staminate cone primordia are about 1  mm (0.04 in) long and remain that size until spring. Then they elongate to  about 5 mm (0.2 in) by the middle of May and early June just before pollen  is shed. Rapid elongation up to several more millimeters occurs as the  pollen is shed. Time of pollen shedding (anthesis) varies greatly from  year to year depending on the weather (23).

    Fertilization occurs about 13 months after pollination when the female  cone is approaching its maximum size (27). Jack pine is normally a  wind-pollinated, cross-fertilizing species but up to 25 percent or rarely  more natural selfing can occur (29,64). Under natural conditions, however,  survival of selfed and other inbred seedlings is severely reduced by  natural selection against the semilethal and other deleterious  characteristics carried by the inbred seedlings (67).

    Cones mature and the seeds ripen late in the growing season of the year  after pollination. Various cone and seed characteristics, including cone  color, volume, fresh and dry weight, specific gravity, scale color, seed  color, and embryo length, can aid in determining seed ripeness. In  northeastern Wisconsin the best indicators of cone and seed ripeness are  cone color, 75 percent brown; insides of the cone scales, reddish brown;  seeds, dark brown or black; and cone moisture content, less than 45  percent of fresh weight. These indicators of cone and seed ripeness  coincide with the beginning of cone harvesting by squirrels about  September 10. Because specific gravity of the serotinous cones usually  remains above 1.0 at least until February, flotation techniques cannot be  used to evaluate cone and seed ripeness in jack pine (18).

  • Burns, Russell M., and Barbara H. Honkala, technical coordinators. 1990. Silvics of North America: 1. Conifers; 2. Hardwoods.   Agriculture Handbook 654 (Supersedes Agriculture Handbook 271,Silvics of Forest Trees of the United States, 1965).   U.S. Department of Agriculture, Forest Service, Washington, DC. vol.2, 877 pp.   http://www.na.fs.fed.us/spfo/pubs/silvics_manual/table_of_contents.htm External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

T. D. Rudolph

Source: Silvics of North America

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Growth

Growth and Yield

During the first 20 years, jack pine in its  native range is the fastest growing conifer other than tamarack (61).  Seedlings reach 1.4 m (4.5 ft) tall in 5 to 8 years, depending on site. In  the Lake States, 20-year-old stands with 2,470 trees per hectare  (1,000/acre) on sites ranging from site index 12 to 21 m (40 to 70 ft)  average between 5.5 and 9.8 m (18 and 32 ft) tall, 6.7 and 20.0 m²  (29 and 87 ft²) in basal area, 5.8 and 10.2 cm (2.3 and 4.0 in) in  d.b.h. (46), and 14 600 and 62 800 kg/ha (13,000 and 56,000 lb/acre) in  ovendry weight of above-ground biomass (3).

    The generalized equations used to derive these biomass estimates (3)  give results similar to biomass production reported in other natural jack  pine stands (22,32,37,51). Mean annual biomass production of 43-year-old  natural jack pine stands in Quebec ranged from 1.42 to 2.47 t/ha (0.63 to  1.10 tons/acre) (28); in 7- to 57-year-old jack pine in New Brunswick from  0.94 to 2.76 t/ha (0.42 to 1.23 tons/acre) (51); and in 20- to  100-year-old stands in Ontario from about 1.17 to 3.38 t/ha (0.52 to 1.51  tons/acre) (45). In 24- and 25-year-old plantations in the Lake States,  the highest mean annual biomass production was 58 percent higher than the  maximum reported in the literature, when seed source and site were  properly matched (89).

    Annual height growth on medium sites (site index 17 m (55 ft)) in the  Lake States averages from 33 cm (13 in) at age 30 to 23 cm (9 in) at age  50. At age 80 years, annual height growth is only 13 cm (5 in) (46) On  typical sand plains sites, growth is about one site quality better where  the water table is 1.2 to 1.8 m (4 to 6 ft) from the soil surface than  where it is deeper (61).

    Normally, mature trees are about 17 to 20 m (55 to 65 ft) tall and 20 to  25 cm (8 to 10 in) d.b.h., although some trees have attained 30 m (100 ft)  in height and 64 cm (25 in) in d.b.h. (46,61), and one tree listed by the  American Forestry Association in 1982 measured 73.4 cm (28.9 in) in d.b.h.  and 25.6 m (84 ft) tall. Stand basal areas seldom exceed 37 m²/ha  (160 ft²/acre) (46). Jack pine stands begin to disintegrate after 80  years on the best sites and after 60 years on the poorest sites. Vigorous  trees 185 years old have been found in northwestern Minnesota, however.  The oldest tree reported- 230 years old- was found east of Lake Nipigon in  Ontario (61).

    Growth is somewhat slower, but maintained longer, in Canada. Average  stocking on sites having a site index range of 14 to 17 m (45 to 55 ft) in  southern Manitoba produces a culmination of mean annual increment at 50 to  60 years with 1.6 to 3.2 m³/ha (23 to 46 ft³/acre) of  merchantable material (9). For average site (site index 14 m (45 ft)) and  stocking in Saskatchewan, mean annual increment culminates at about 70  years with 2.0 merchantable m³/ha (28 ft³/acre) (42). In fully  stocked stands on average sites (site class 2) in Ontario, mean annual  increment culminates at about age 60 with 2.7 m³/ha (38 ft³/acre)  of merchantable material (54).

    Yields from well-stocked, unmanaged jack pine stands in the Lake States  at 60 years are shown in table 1 (46), along with yields from well-stocked  unmanaged stands in Saskatchewan (42). Rotation age of 40 to 50 years is  recommended to produce pulpwood and 60 to 70 years is recommended to  produce poles and sawtimber.

    Table 1- Yields of unmanaged jack pine stands in the  Lakes States and in Saskatchewan by age and site index           
Age    
Height¹  Basal 
area  Total 
volume  Merchantable volume            yr  m  m²/ha  m³/ha  m³/ha      Lakes States      Site index² 12.2 m              30     8.2   12.2    41  31      40  10.4  15.8    67  52      50  12.2  18.4    92  71      60  13.7  20.4  114  88      Site index 18.3 m              30  12.2  23.0  115    89      40  15.5  27.3  174  134      50  18.3  30.1  224  173      60  20.4  31.7  265  206      Saskatchewan      Site index 10.1 m              30    5.8  11.7    45  10      40    8.2  14.0    66  34      50  10.1  15.8    85  56      60  11.9  17.0  102  75      Site index 17.4 m              30  11.6  19.3  112    61      40  14.6  23.2  140    98      50  17.4  26.2  168  134      60  19.8  28.2  195  165        ft  ft²/acre  ft³/acre  ft³/acre      Lakes States      Site index 40 ft              30  27  53     580     448      40  34  69     956     736      50  40  80  1,311  1,008      60  45  89  1,631  1,264      Site index 60 ft              30  40  100  1,647  1,272      40  51  119  2,484  1,920      50  60  131  3,194  2,472      60  67  138  3,789  2,936      Saskatchewan      Site index 33 ft              30  19  51     645     150      40  27  61     940     485      50  33  69  1,210     800      60  39  74  1,460  1,070      Site index 57 ft              30  38  84  1,600     865      40  48  101  2,000  1,403      50  57  114  2,405  1,910      60  65  123  2,785  2,360      ¹Mean  height of dominants and codominants. 
²Height of dominants and codominants at 50 years.
  • Burns, Russell M., and Barbara H. Honkala, technical coordinators. 1990. Silvics of North America: 1. Conifers; 2. Hardwoods.   Agriculture Handbook 654 (Supersedes Agriculture Handbook 271,Silvics of Forest Trees of the United States, 1965).   U.S. Department of Agriculture, Forest Service, Washington, DC. vol.2, 877 pp.   http://www.na.fs.fed.us/spfo/pubs/silvics_manual/table_of_contents.htm External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

T. D. Rudolph

Source: Silvics of North America

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

Functional adaptation

Root grafting enhances growth: jack pine
 

Roots of jack pines distribute limited resources by root grafting.

       
  "Trees are traditionally considered as distinct entities even though  they can share a communal root system through root grafts, which are  morphological unions between two or more roots...During periods of root  graft formation, root grafting tended to reduce radial growth of jack  pine trees, after which growth generally increased. The influence of  root grafting on growth was more significant in natural stands, where  root grafting was more frequent than in plantations...These results  suggest that root grafting initially is an energetically costly process  but that it is afterward nonprejudicial and maybe beneficial to tree  growth. The use of a communal root system allows for a maximum use of  resources by redistributing them among trees, leading to increased tree  growth." (Tarroux and DesRochers 2011:967)
  Learn more about this functional adaptation.
  • Tarroux E; DesRochers A. 2011. Effect of natural root grafting on growth response of jack pine (Pinus banksiana; Pinaceae). American Journal of Botany. 98(6): 967–974.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Genetics

The various environments in which jack pine grows over its wide range  have provided ample opportunity for differentiation and natural selection  (72).

    Virtually the entire present range of jack pine was glaciated during the  most recent Wisconsin stage that reached its maximum about 18,000 years  ago. The present distribution of the species therefore results from  re-invasion and migration over huge areas and great distances in a  relatively short time, estimated at 15,000 years since the retreat of the  ice began in earnest. Available paleobotanical evidence suggests that jack  pine survived the Wisconsin glacial maximum at low elevations in the  Appalachian Mountains south of latitude 34° N. and also in the  western Ozark Mountains. From these refugia it migrated to the north and  east and up the Mississippi Valley, and westward around the southern end  of the Lake Agassiz basin (72).

  • Burns, Russell M., and Barbara H. Honkala, technical coordinators. 1990. Silvics of North America: 1. Conifers; 2. Hardwoods.   Agriculture Handbook 654 (Supersedes Agriculture Handbook 271,Silvics of Forest Trees of the United States, 1965).   U.S. Department of Agriculture, Forest Service, Washington, DC. vol.2, 877 pp.   http://www.na.fs.fed.us/spfo/pubs/silvics_manual/table_of_contents.htm External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

T. D. Rudolph

Source: Silvics of North America

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology

Barcode data: Pinus banksiana

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GGATATAGGGACTCCACATTCAATCTTCGGTGCCATTGCTGGAGTAATGGGCACATGCTTCTCAGTATCAATTCGTATGGAATTAGCACAACCCGGCGATCAAATTCTTGGTGGGAATCATCAACCTCATAATGTGTCAATAACGGCTCACGCTTCTCCAATGATCCCTTTTATGGTTATGCCGGCGGTGATAGGTGGATCTGGTAATTGGTCCGTTCCGATTCCTATAGGTGCACCTGACATGGCATTTCCACGATTGAATAATATTCCATCCCGGTTGTTGCCACCTTCGCTGTTGCTCCCATTAAGCCCAGCCTCGGTAGAAGTGGGTAGCGGCACTGGGTGGACGGTCTATCCGCCCCTAAGTGGTATTACCAGTCATTCCGGAGGAGCTGCTGATCCAGCGATTTCTAGTCCTCATCTATCAGGTGTTTCATCCATTTCAGGTTCTATCAATCTCATAACTACTATCCCCAACATGCGCGGGCCTGGAATGACTATGCATAGATCACCCCTATTTGTGCGGTCCGTTCCAGTGACAGCATTCCTACTCTTATCATCACTTCCGGTACCGGCAGGGGCAATTACCATGTTATCAACTGATCGAAGCTTTAATACAACCTTTTTCGATCCTGCTGGAGGGGGAGACCCGATA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Pinus banksiana

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 10
Specimens with Barcodes: 22
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LR/lc
Lower Risk/least concern

Red List Criteria

Version
2.3

Year Assessed
1998
  • Needs updating

Assessor/s
Conifer Specialist Group

Reviewer/s
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Please consult the PLANTS Web site and your State Department of Natural Resources for this plant’s current status (e.g. threatened or endangered species, states noxious status, and wetland indicator values).

Public Domain

USDA NRCS National Plant Data Center

Source: USDA NRCS PLANTS Database

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Pests and potential problems

The jack pine budworm (Choristoneura pinus) defoliates mature jack pine. The jack pine budworm, native to North America, has a range that coincides almost exactly with jack pine, its preferred host. Root borers, root feeders, shoot and stem borers, leaf feeders, needle miners, and sucking insects affect the survival and growth of seedlings. Many other insects feed on jack pine cones. Young stands of jack pine are susceptible to defoliation by the redheaded pine sawfly (Neodiprion lecontei). Jack pine is susceptible to many fungi, diseases and rust.

Public Domain

USDA NRCS National Plant Data Center

Source: USDA NRCS PLANTS Database

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Management considerations

More info for the term: prescribed fire

Jack pine is intensively managed for lumber in the Lake States.  Stands
are regenerated by planting, direct seeding, scattering cone-bearing
slash on mechanically scarified ground, or using the seed tree
silviculture method combined with prescribed fire.  Jack pine is also
managed to provide habitat for the federally endangered Kirtland's
Warbler.

Root borers, root feeders, shoot and stem borers, leaf feeders, needle
miners, and sucking insects affect the survival and growth of seedlings.
Many other insects feed on jack pine cones [67].  Young stands of jack
pine are susceptible to defoliation by the redheaded pine sawfly
(Neodiprion lecontei) [84].

The jack pine budworm (Choristoneura pinus) defoliates mature jack pine.
There is often a 20- to 30-year lag after major fire before the jack
pine budworm invades.  The regenerated stand does not produce abundant
cones on average for about 20 years and the jack pine budworm
population thrives in years of abundant cone production.  A model has
been developed to forecast the area to be infested with this pest [83].
In one study, all trees that died from jack pine budworm infestation had
roots infected with Armillaria root rot (Armillaria ostoyae) [52].

Jack pine is susceptible to many diseases including rust fungi [67].
Pine gall rust (Endocronartium harknessii) accounted for more than 99
percent of all stem rusts in a survey of 71 young jack pine plantations
in northwestern Ontario [43].
  • 43. Juzwik, Jennifer; Chong, Nancy. 1990. Pine-pine gall rust on young jack pine in northwestern Ontario. Northern Journal of Applied Forestry. 7: 133-136. [14189]
  • 52. Mallett, K. I.; Volney, W. J. A. 1990. Relationships among jack pine budworm damage, selected tree characteristics, and Armillaria root rot in jack pine. Canadian Journal of Forest Research. 20: 1791-1795. [12760]
  • 67. Rudolph, T. D.; Laidly, P. R. 1990. Pinus banksiana Lamb. jack pine. In: Burns, Russell M.; Honkala, Barbara H., technical coordinators. Silvics of North America. Volume 1. Conifers. Agric. Handb. 654. Washington, DC: U.S. Department of Agriculture, Forest Service: 280-293. [13391]
  • 83. Volney, W. Jan A. 1988. Analysis of historic jack pine budworm outbreaks in the Prairie provinces of Canada. Canadian Journal of Forest Research. 18(9): 1152-1158. [19242]
  • 84. Wilson, Louis F.; Wilkinson, Robert C., Jr.; Averill, Robert C. 1992. Redheaded pine sawfly--Its ecology and management. Agric. Handb. 694. Washington, DC: U.S. Department of Agriculture, Forest Service. 53 p. [18524]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cultivars, improved and selected materials (and area of origin)

These materials are readily available from commercial plant sources. Contact your local Natural Resources Conservation Service (formerly Soil Conservation Service) office for more information. Look in the phone book under ”United States Government.” The Natural Resources Conservation Service will be listed under the subheading “Department of Agriculture.”

Public Domain

USDA NRCS National Plant Data Center

Source: USDA NRCS PLANTS Database

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Other uses and values

Jack pine is planted for Christmas trees [17].
  • 17. Cayford, J. H.; McRae, D. J. 1983. The ecological role of fire in jack pine forests. In: Wein, Ross W.; MacLean, David A., eds. The role of fire in northern circumpolar ecosystems. Scope 18. New York: John Wiley & Sons: 183-199. [18509]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Value for rehabilitation of disturbed sites

More info for the terms: density, natural

Jack pine is adapted to acidic, dry, and sandy disturbed sites with a
lower pH limit of 4.0 [82].  In Ohio, jack pine is recommended for
planting on drier upper slopes, on moister and better drained lower
slopes, on all sandy and loamy mine spoils, and on clay spoils that have
a high proportion of coarse material [49].  This species has performed
well on anthracite spoils in Pennsylvania, with 48 percent survival at
age 10.  Survival was low (13 percent after 30 years), however, on coal
mine spoils in Missouri and Kansas.  In mixed plantings with hardwoods
in Illinois and Indiana, jack pine showed only 8 percent survival after
30 years [82].

Jack pine is recommended for planting on mined oil sands in northeastern
Alberta [16,39].  A planting density of 182 jack pine stems per acre
(450/ha) for tailing sands and 112 stems per acre (278/ha) for
overburden sites is recommended to provide 61 surviving stems per acre
(150/ha), a density considered sufficient for the natural perpetuation
of either a fully stocked jack pine stand or a mixed pine/deciduous
stand [39].
  • 16. Carroll, S. B.; Bliss, L. C. 1982. Jack pine - lichen woodland on sandy soils in northern Saskatchewan and northeastern Alberta. Canadian Journal of Botany. 60: 2270-2282. [7283]
  • 39. Guy, Peter R.; Bateman, J. Cam. 1989. Determining optimal initial stocking densities during mine reclamation. In: Walker, D. G.; Powter, C. B.; Pole, M. W., compilers. Reclamation, a global perspective: Proceedings of the conference; 1989 August 27-31; Calgary, AB. Edmonton, AB: Alberta Land Conservation and Reclamation Council: 317-326. [14349]
  • 49. Limstrom, G. A.; Merz, R. W. 1949. Rehabilitation of lands stripped for coal in Ohio. Tech. Pap. No. 113. Columbus, OH: The Ohio Reclamation Association. 41 p. In cooperation with: U.S. Department of Agriculture, Forest Service, Central States Forest Experiment Station. [4427]
  • 82. Vogel, Willis G. 1981. A guide for revegetating coal minespoils in the eastern United States. Gen. Tech. Rep. NE-68. Broomall, PA: U.S. Department of Agriculture, Forest Service, Northeastern Forest Experiment Station. 190 p. [15577]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cover Value

More info for the term: cover

Jack pine stands provide cover to mammals such as moose [8] and snowshoe
hares [12].  Debris and seedlings in burned stands provide cover for
smaller mammals such as red-backed voles [44].
  • 8. Allen, Arthur W.; Jordan, Peter A.; Terrell, James W. 1987. Habitat suitability index models: moose, Lake Superior region. Biol. Rep. 82 (10.155). Washington, DC: U.S. Department of the Interior, Fish and Wildlife Service. 47 p. [11710]
  • 12. Bergeron, Jean-Marie; Tardif, Josee. 1988. Winter browsing preferences of snowshoe hares for coniferous seedlings and its implication in large-scale reforestation programs. Canadian Journal of Forest Research. 18: 280-282. [8659]
  • 44. Krefting, Laurits W.; Ahlgren, Clifford E. 1974. Small mammals and vegetation changes after fire in a mixed conifer-hardwood forest. Ecology. 55: 1391-1398. [9874]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Importance to Livestock and Wildlife

More info for the terms: cover, lichens, tree

Jack pine provides food and cover for numerous wildlife species.  Jack
pine seeds are eaten by rodents and birds.  The stomach contents of red
squirrels, chipmunks, and white-footed mice showed that they had eaten
on average 392 seeds, 31 seeds, and 19 seeds apiece, respectively.
Red-backed voles also consume jack pine seeds [72].  White-tailed deer,
caribou, and snowshoe hares browse jack pine [12,68,80].  Woodland and
barren-ground caribou eat lichens growing on the ground and on tree bark
in jack pine stands [3,68].

The federally endangered Kirtland's warbler is endemic to jack pine
barrens.  Nests are located on the ground near or at the edge of fairly
dense young jack pine stands.  For further information on this bird and
its relationship to jack pine, see FEIS review of Kirtland's warbler.
  • 3. Ahti, T.; Hepburn, T. L. 1967. Preliminary studies on woodland caribou range, especially on lichen stands, in Ontario. Res. Rep. (Wildlife) No. 74. Toronto, ON: Ontario Department of Lands and Forests, Research Branch. 134 p. [13294]
  • 12. Bergeron, Jean-Marie; Tardif, Josee. 1988. Winter browsing preferences of snowshoe hares for coniferous seedlings and its implication in large-scale reforestation programs. Canadian Journal of Forest Research. 18: 280-282. [8659]
  • 68. Scotter, George W. 1967. The winter diet of barren-ground caribou in northern Canada. Canadian Field-Naturalist. 81: 33-39. [16672]
  • 72. Smith, Clarence F.; Aldous, Shaler E. 1947. The influence of mammals and birds in retarding artificial and natural reeseeding of coniferous forests in the United States. Journal of Forestry. 45: 361-369. [26767]
  • 80. Ullrey, D. E.; Youatt, W. G.; Johnson, S. E.; [and others]. 1967. Digestibility of cedar and jack pine browse for the white-tailed deer. Journal of Wildlife Management. 31(3): 448-454. [19531]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wood Products Value

Jack pine is an important commercial timber species in the United States
and Canada.  The moderately hard and heavy wood is used for pulpwood,
lumber, telephone poles, fence posts, mine timbers, and railroad ties
[17,41].
  • 17. Cayford, J. H.; McRae, D. J. 1983. The ecological role of fire in jack pine forests. In: Wein, Ross W.; MacLean, David A., eds. The role of fire in northern circumpolar ecosystems. Scope 18. New York: John Wiley & Sons: 183-199. [18509]
  • 41. Hosie, R. C. 1969. Native trees of Canada. 7th ed. Ottawa, ON: Canadian Forestry Service, Department of Fisheries and Forestry. 380 p. [3375]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cultivation

Jack Pine prefers full sunlight, dry conditions, and an acidic mineral-rich soil that is sandy or rocky. Young trees start to produce cones after only 4-5 years. This tree is very winter-hardy. It is vulnerable to various disease organisms.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© John Hilty

Source: Illinois Wildflowers

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Nutritional Value

Jack pine browse is on average, by wet weight, 3.8 percent crude
protein, 4.2 percent fat, 15.1 percent crude fiber, and 22.2 percent
nitrogen-free-extract.  It is more digestible than northern white-cedar
(Thuja occidentalis) browse, although much less preferred [80].
  • 80. Ullrey, D. E.; Youatt, W. G.; Johnson, S. E.; [and others]. 1967. Digestibility of cedar and jack pine browse for the white-tailed deer. Journal of Wildlife Management. 31(3): 448-454. [19531]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Palatability

Jack pine browse is of intermediate preference to white-tailed deer [36]
and highly preferred by snowshoe hares in the winter [12].  Moose do not
prefer this browse, and it constitutes less than 1 percent of their diet
[8,30].  Caribou only browse jack pine occasionally; it constituted 1.7
to 3.9 percent air-dry weight of barren-ground caribou rumens in one
study [68].
  • 8. Allen, Arthur W.; Jordan, Peter A.; Terrell, James W. 1987. Habitat suitability index models: moose, Lake Superior region. Biol. Rep. 82 (10.155). Washington, DC: U.S. Department of the Interior, Fish and Wildlife Service. 47 p. [11710]
  • 12. Bergeron, Jean-Marie; Tardif, Josee. 1988. Winter browsing preferences of snowshoe hares for coniferous seedlings and its implication in large-scale reforestation programs. Canadian Journal of Forest Research. 18: 280-282. [8659]
  • 30. Cumming, H. G. 1987. Sixteen years of moose browse surveys in Ontario. Alces. 23: 125-156. [8859]
  • 36. Fashingbauer, Bernard A.; Moyle, John B. 1963. Nutritive value of red-osier dogwood and mountain maple as deer browse. Minnesota Academy of Science Proceedings. 31(1): 73-77. [9246]
  • 68. Scotter, George W. 1967. The winter diet of barren-ground caribou in northern Canada. Canadian Field-Naturalist. 81: 33-39. [16672]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Special Uses

The most notable special use for jack pine is as a breeding area for the  Kirtland's warbler, a rare and endangered species. The Kirtland's warbler  requires homogeneous stands of jack pine between 1.5 and 6 m (5 to 20 ft)  tall (about 7 to 20 years old); stands are preferably larger than 32 ha  (80 acres) (52).

    Jack pine stands can be an important part of the visual resource for  recreation areas; they stabilize watersheds, produce areas for blueberry  picking, and provide food and shelter for wild game species, including the  snowshoe hare and the white-tailed deer (10).

  • Burns, Russell M., and Barbara H. Honkala, technical coordinators. 1990. Silvics of North America: 1. Conifers; 2. Hardwoods.   Agriculture Handbook 654 (Supersedes Agriculture Handbook 271,Silvics of Forest Trees of the United States, 1965).   U.S. Department of Agriculture, Forest Service, Washington, DC. vol.2, 877 pp.   http://www.na.fs.fed.us/spfo/pubs/silvics_manual/table_of_contents.htm External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

T. D. Rudolph

Source: Silvics of North America

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Uses

Comments: Menomini - used every part of tree as medicine including the cone. Small roots were boiled to render them pliable and used to sew birch bark canoes. Stitching was sealed with pitch or boiled resin.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Uses

Ethnobotanic use. Canadian Indians used jack pine wood as frames in their canoes.

Commercial uses: Jack pine is important timber species in the Lake States of the United States and Canada. These trees produce pulpwood, lumber for construction, telephone poles, fence posts, mine timbers, and railroad ties. Jack pine is used as Christmas trees and for stabilization of watersheds.

Wildlife uses: Serves as habitat and breeding area for the endangered Kirtland's warbler (Dendroica kirtlandii), federally endangered bird. These small birds utilize jack pine stands ranging from 1.5 and 6 m (5 to 20 ft) tall larger than 32 ha (80 acres) as nesting grounds. White-tailed deer (Odocoileus virginianus) browse saplings and young trees and snowshoe hares (Lepus americanus) feed on young seedlings. Porcupines (Erethizon dorsatum) feed on bark that often leads to deformed trees. Red squirrels (Tamiasciurus hudsonicus), chipmunks (Eutamias spp.), mice (Peromyscus leucopus), goldfinches (Carduelis tristis), and robins (Turdus migratorius) consume seeds.

Public Domain

USDA NRCS National Plant Data Center

Source: USDA NRCS PLANTS Database

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Jack Pine

Jack pine, Pinus banksiana, is an eastern North American pine. Its native range in Canada is east of the Rocky Mountains from Northwest Territories to Nova Scotia, and the north-central and northeast of the United States from Minnesota to Maine, with the southernmost part of the range just into northwest Indiana.

In the far west of its range, Pinus banksiana hybridizes readily with the closely related lodgepole pine (Pinus contorta). Banksiana is after the English botanist Sir Joseph Banks.[4]

Contents

Description [edit]

Foliage
Closed, mature cones

Pinus banksiana ranges from 9–22 m (30–72 ft) in height. Some jack pines are shrub-sized, due to poor growing conditions. They do not usually grow perfectly straight, resulting in an irregular shape similar to pitch pine (Pinus rigida). This pine often forms pure stands on sandy or rocky soil. It is fire-adapted to stand-replacing fires, with the cones remaining closed for many years, until a forest fire kills the mature trees and opens the cones, reseeding the burnt ground.

The leaves are in fascicles of two, needle-like, twisted, slightly yellowish-green, and 2–4 centimetres (0.79–1.6 in) long.

Jack pine cones are usually 5 centimetres (2.0 in) and curved at the tip.[5] The cones are 3–5 cm (1.2–2.0 in) long, the scales with a small, fragile prickle that usually wears off before maturity, leaving the cones smooth.

Unusually for a pine, the cones normally point forward along the branch, sometimes curling around it. That is an easy way to tell it apart from the similar lodgepole pine in more western areas of North America. The cones on mature trees are serotinous. They open when exposed to intense heat, greater than or equal to 50 °C (122 °F). The typical case is in a fire, however cones on the lower branches can open when temperatures reach 27 °C (81 °F) due to the heat being reflected off the ground. Additionally, when temperatures reach −46 °C (−51 °F), the cones will open, due to the nature of the resin.

Ecology [edit]

P. banksiana forest with Vaccinium groundcover

Kirtland's Warbler (Dendroica kirtlandii), an endangered bird, depends on pure stands of young jack pine in a very limited area in the north of the Lower Peninsula of Michigan for breeding. Mature jack pine forests are usually open, and the fall of their needles creates acidic soil, so blueberries are often abundant in the understory.

Young jack pines are an alternate host for sweet fern blister rust (Cronartium comptoniae). Infected Sweet ferns (Comptonia peregrina) release powdery orange spores in the summer and nearby trees become infected in the fall. Diseased trees show vertical orange cankers on the trunk and galls on the lower branches. The disease does not tend to affect older trees.[6]

Jack pines are also susceptible to Scleroderris canker (Gremmeniella abietina). This disease manifests by yellowing at the base of the needles. Prolonged exposure may lead to eventual death of the tree.[6]

Insects that attack jack pine stands include white pine weevil (Pissodes strobi), jack pine sawfly, and jack pine budworm.[6]

Commercial uses [edit]

Like other species of pine, Pinus banksiana has use as timber, although its wood tends to be knotty and not highly resistant to decay. Products include pulpwood, fuel, decking, and utility poles.[4]

References [edit]

  1. ^ "The Plant List: A Working List of All Plant Species". 
  2. ^ "World Checklist of Selected Plant Families". 
  3. ^ "The International Plant Names Index". 
  4. ^ a b Center for Wood Anatomy Research. "Pinus banksiana Lamb.". United States Forest Service. Retrieved 2010-12-27. 
  5. ^ Moore, Gerry; Kershner, Bruce; Craig Tufts; Daniel Mathews; Gil Nelson; Spellenberg, Richard; Thieret, John W.; Terry Purinton; Block, Andrew (2008). National Wildlife Federation Field Guide to Trees of North America. New York: Sterling. p. 68. ISBN 1-4027-3875-7. 
  6. ^ a b c Blouin, Glen. An Eclectic Guide to Trees: east of the rockies. 2001. Boston Mills Press, Erin, Ontario. pp 152-159.

Bibliography [edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Notes

Comments

Pinus banksiana reaches its largest size and best form in Canada. In western Alberta and in northeastern British Columbia, it is sympatric with P . contorta and forms hybrid swarms with that species. 

 Jack pine ( Pinus banksiana ) is the territorial tree of the Northwest Territories.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Missouri Botanical Garden, 4344 Shaw Boulevard, St. Louis, MO, 63110 USA

Source: Missouri Botanical Garden

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!