Articles on this page are available in 1 other language: Spanish (8) (learn more)

Overview

Comprehensive Description

Description

Ambystoma andersoni is a pedomorphic species of Tiger Salamanders with adult male and females snout-vent length range from 100 to140 mm, 14 to 25 gill rakers on the anterior face of the third gill arch, and a short tail that is 56-78% of snout-vent length. The two sexes do not show sexual dimorphism in body proportions or in number of teeth. This species presents 14 costal grooves, 15 trunk vertebrae, 103 premaxillary/maxillary teeth, 35-38 vomerine teeth, and 19-16 palatine teeth. Toes are flattened and extensively webbed, extending nearly half the length of digits and two-thirds on hind feet. The posterior margin of hind foot conspicuously keeled and there are three rather than four phalanges in the fourth hind toe (Krebs and Brandon 1984).

Similar species include A. dumerilii, which also has short, highly webbed toes and 14 – 25 gill rackers, but A. andersoni is reddish-brown with spotting while A. dumerilii is uniformly brown with no markings. The two species also differ in A. dumerilii having hyperfilamentous gills, a smaller eye, smaller eggs, and larger body size at sexual maturity (Krebs and Brandon 1984).

In life, the body is reddish-brown marked with black dots that are sometimes interconnected, The dorsal coloring is reddish-brown even in preservative (Krebs and Brandon 1984).

The species authorities are Krebs and Brandon (1984).

  • Krebs, S.L. and Brandon, R.A. 1984. A new species of salamander (Family Ambystomatidae) from Michoacan, Mexico. Herpetologica: 238-245
  • Shaffer, H.B, Flores-Villela, O., Parra-Olea, G., Wake, D. 2004. Ambystoma andersoni. In: IUCN 2012. IUCN Red List of Threatened Species. Version 2012.2. Downloaded on 03 May 2013.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2015 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

Ambystoma andersoni is a pedomorphic species of Tiger Salamanders with adult male and females snout-vent length range from 100 to140 mm, 14 to 25 gill rakers on the anterior face of the third gill arch, and a short tail that is 56-78% of snout-vent length. The two sexes do not show sexual dimorphism in body proportions or in number of teeth. This species presents 14 costal grooves, 15 trunk vertebrae, 103 premaxillary/maxillary teeth, 35-38 vomerine teeth, and 19-16 palatine teeth. Toes are flattened and extensively webbed, extending nearly half the length of digits and two-thirds on hind feet. The posterior margin of hind foot conspicuously keeled and there are three rather than four phalanges in the fourth hind toe (Krebs and Brandon 1984).

Similar species include A. dumerilii, which also has short, highly webbed toes and 14 - 25 gill rackers, but A. andersoni is reddish-brown with spotting while A. dumerilii is uniformly brown with no markings. The two species also differ in A. dumerilii having hyperfilamentous gills, a smaller eye, smaller eggs, and larger body size at sexual maturity (Krebs and Brandon 1984).

In life, the body is reddish-brown marked with black dots that are sometimes interconnected, The dorsal coloring is reddish-brown even in preservative (Krebs and Brandon 1984).

The species authorities are Krebs and Brandon (1984).

  • Krebs, S.L. and Brandon, R.A. 1984. A new species of salamander (Family Ambystomatidae) from Michoacan, Mexico. Herpetologica: 238-245
  • Shaffer, H.B, Flores-Villela, O., Parra-Olea, G., Wake, D. 2004. Ambystoma andersoni. In: IUCN 2012. IUCN Red List of Threatened Species. Version 2012.2. Downloaded on 03 May 2013.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

This species is known only from one lake (Lago Zacapu) and its surrounding streams, in north-western Michoacan, Mexico, at 2,000 m asl. It has an extent of occurrence and area of occupancy of 19 km2.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution and Habitat

Ambystoma andersoni has only been found at Laguna de Zacapu and the surrounding streams and canals that are above 2000 meters in elevation in Michoacan, Mexico. This lake is surrounded by soft mud and extensive vegetation (Krebs and Brandon 1984). This paedomorphic species lives in a cool, freshwater habitat (Shaffer et al. 2004). Many salamanders can be found hidden in vegetation at the deepest section of the stream where currents are strong. It is believed that their robust bodies, short tails, and reduced body fin are characteristic features adapted to live in the bottom vegetation with high currents (Krebs and Brandon 1984).

  • Krebs, S.L. and Brandon, R.A. 1984. A new species of salamander (Family Ambystomatidae) from Michoacan, Mexico. Herpetologica: 238-245
  • Shaffer, H.B, Flores-Villela, O., Parra-Olea, G., Wake, D. 2004. Ambystoma andersoni. In: IUCN 2012. IUCN Red List of Threatened Species. Version 2012.2. Downloaded on 03 May 2013.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2015 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution and Habitat

Ambystoma andersoni has only been found at Laguna de Zacapu and the surrounding streams and canals that are above 2000 meters in elevation in Michoacan, Mexico. This lake is surrounded by soft mud and extensive vegetation (Krebs and Brandon 1984). This paedomorphic species lives in a cool, freshwater habitat (Shaffer et al. 2004). Many salamanders can be found hidden in vegetation at the deepest section of the stream where currents are strong. It is believed that their robust bodies, short tails, and reduced body fin are characteristic features adapted to live in the bottom vegetation with high currents (Krebs and Brandon 1984).

  • Krebs, S.L. and Brandon, R.A. 1984. A new species of salamander (Family Ambystomatidae) from Michoacan, Mexico. Herpetologica: 238-245
  • Shaffer, H.B, Flores-Villela, O., Parra-Olea, G., Wake, D. 2004. Ambystoma andersoni. In: IUCN 2012. IUCN Red List of Threatened Species. Version 2012.2. Downloaded on 03 May 2013.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Type Information

Paratype for Ambystoma andersoni
Catalog Number: USNM 206935
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Sex/Stage: Male;
Preparation: Ethanol
Year Collected: 1970
Locality: Laguna de Zacapu, ditch leading from, Michoacan, Mexico
  • Paratype: Krebs, S. L. & Brandon, R. A. 1984. Herpetologica. 40 (3): 238.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Paratype for Ambystoma andersoni
Catalog Number: USNM 206934
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Sex/Stage: Female;
Preparation: Ethanol
Year Collected: 1970
Locality: Laguna de Zacapu, ditch leading from, Michoacan, Mexico
  • Paratype: Krebs, S. L. & Brandon, R. A. 1984. Herpetologica. 40 (3): 238.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Paratype for Ambystoma andersoni
Catalog Number: USNM 206933
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Year Collected: 1970
Locality: Laguna de Zacapu, ditch leading from, Michoacan, Mexico
  • Paratype: Krebs, S. L. & Brandon, R. A. 1984. Herpetologica. 40 (3): 238.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Paratype for Ambystoma andersoni
Catalog Number: USNM 206932
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Sex/Stage: Male;
Preparation: Ethanol
Year Collected: 1970
Locality: Laguna de Zacapu, ditch leading from, Michoacan, Mexico
  • Paratype: Krebs, S. L. & Brandon, R. A. 1984. Herpetologica. 40 (3): 238.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Paratype for Ambystoma andersoni
Catalog Number: USNM 206931
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Sex/Stage: Male;
Preparation: Ethanol
Year Collected: 1970
Locality: Laguna de Zacapu, ditch leading from, Michoacan, Mexico
  • Paratype: Krebs, S. L. & Brandon, R. A. 1984. Herpetologica. 40 (3): 238.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Paratype for Ambystoma andersoni
Catalog Number: USNM 206930
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Sex/Stage: Male;
Preparation: Ethanol
Year Collected: 1970
Locality: Laguna de Zacapu, ditch leading from, Michoacan, Mexico
  • Paratype: Krebs, S. L. & Brandon, R. A. 1984. Herpetologica. 40 (3): 238.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Paratype for Ambystoma andersoni
Catalog Number: USNM 206929
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Sex/Stage: Male;
Preparation: Ethanol
Year Collected: 1970
Locality: Laguna de Zacapu, ditch leading from, Michoacan, Mexico
  • Paratype: Krebs, S. L. & Brandon, R. A. 1984. Herpetologica. 40 (3): 238.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Paratype for Ambystoma andersoni
Catalog Number: USNM 206928
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Sex/Stage: Male;
Preparation: Ethanol
Year Collected: 1970
Locality: Laguna de Zacapu, ditch leading from, Michoacan, Mexico
  • Paratype: Krebs, S. L. & Brandon, R. A. 1984. Herpetologica. 40 (3): 238.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Paratype for Ambystoma andersoni
Catalog Number: USNM 206927
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Sex/Stage: Female;
Preparation: Ethanol
Year Collected: 1970
Locality: Laguna de Zacapu, ditch leading from, Michoacan, Mexico
  • Paratype: Krebs, S. L. & Brandon, R. A. 1984. Herpetologica. 40 (3): 238.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Paratype for Ambystoma andersoni
Catalog Number: USNM 206926
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Sex/Stage: Female;
Preparation: Ethanol
Year Collected: 1970
Locality: Laguna de Zacapu, ditch leading from, Michoacan, Mexico
  • Paratype: Krebs, S. L. & Brandon, R. A. 1984. Herpetologica. 40 (3): 238.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species is paedomorphic, and requires a clean, cool aquatic habitat. It is found only in Lago Zacapu and the spring-fed streams and canals associated with the lake. They do not metamorphose in nature, and individuals that have been artificially induced to metamorphose with thyroid hormone in the laboratory do not thrive. Their diet consists largely of snails and crawfish.

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Ambystoma andersoni

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACTCGATGACTATTTTCTACAAATCATAAAGATATTGGCGCCCTTTATTTAGTATTTGGTGCTTGAGCCGGGATAGTTGGCACTGCATTAAGCCTTCTAATCCGAGCAGAATTAAGCCAACCAGGAGCCCTACTAGGGGAT---GATCAAATCTATAATGTTATTGTAACAGCACACGCATTTGTAATAATTTTTTTTATAGTAATACCTGTTATAATCGGGGGATTCGGAAACTGATTAGTACCATTAATAATTGGTGCACCAGATATGGCCTTCCCCCGTATAAACAATATAAGCTTTTGGCTTCTTCCTCCTTCATTCCTCCTTCTATTAGCCTCCTCTGGAGTTGAGGCAGGAGCTGGAACGGGATGAACTGTATATCCCCCACTTGCAGGGAACCTAGCCCATGCCGGGGCCTCAGTCGATTTAACAATTTTTTCACTTCATTTAGCAGGTGTTTCATCTATCCTAGGTGCAATTAATTTTATTACAACCTCAATTAATATAAAACCCGCATCAATATCACAATATCAAACCCCTTTATTTGTTTGATCAGTATTAATTACAGCAGTTCTTCTATTACTTTCTCTTCCGGTTTTAGCAGCGGGAATTACAATACTGCTGACAGATCGAAACTTAAACACAACATTCTTTGATCCTGCCGGAGGGGGTGACCCTGTACTTTATCAACACCTATTTTGATTTTTTGGGCACCCAGAAGTATATATCTTAATCTTACCCGGATTTGGAATAATTTCACATATTGTGACTTATTATTCTGCAAAAAAAGAACCATTTGGTTACATAGGAATAGCATGAACTATAATATCTATTGGGCTTCTAGGGTTTATCGTATGGGCACATCATATATTTACAGTAGATTTAAATGTTGATACACGAG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Ambystoma andersoni

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
CR
Critically Endangered

Red List Criteria
B1ab(iii)

Version
3.1

Year Assessed
2015

Assessor/s
IUCN SSC Amphibian Specialist Group

Reviewer/s
Lamoreux, J.

Contributor/s
Shaffer, H.B., Wake, D., Parra-Olea, G. & Flores-Villela, O.

Justification
Listed as Critically Endangered because its extent of occurrence is 19 km2, all individuals are in a single location, and there is continuing decline in the extent and quality of the lake habitat around Zacapu.

History
  • 2008
    Critically Endangered (CR)
  • 2004
    Critically Endangered (CR)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The species is uncommon and its population is probably declining.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History, Abundance, Activity, and Special Behaviors

Ambystoma andersoni reach sexual maturity at one year of age (~87 mm snout-vent length), which can be observed by the swelling of the cloacal walls, and are believed to have comparable rate of growth, age, and size at maturity as Ambystoma mexicanum. This species follows a spring/summer breeding season. They produce dark yellow-brown colored eggs that are approximately 2.3 mm in diameter, and hatchlings are 12 - 13 mm in length and lack balancers (Krebs and Brandon 1984). This species does not metamorphose in nature, and those that are artificially induced do not thrive (Shaffer et al. 2004).

Though this species is not believed to be rare, Ambystoma andersoni has only been found in one location and pollution of its habitat and predatory fish have contributed to a decreasing population trend. Ambystoma andersoni are known to eat snail and crawfish (Shaffer et al. 2004).

  • Krebs, S.L. and Brandon, R.A. 1984. A new species of salamander (Family Ambystomatidae) from Michoacan, Mexico. Herpetologica: 238-245
  • Shaffer, H.B, Flores-Villela, O., Parra-Olea, G., Wake, D. 2004. Ambystoma andersoni. In: IUCN 2012. IUCN Red List of Threatened Species. Version 2012.2. Downloaded on 03 May 2013.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2015 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History, Abundance, Activity, and Special Behaviors

Ambystoma andersoni reach sexual maturity at one year of age (~87 mm snout-vent length), which can be observed by the swelling of the cloacal walls, and are believed to have comparable rate of growth, age, and size at maturity as Ambystoma mexicanum. This species follows a spring/summer breeding season. They produce dark yellow-brown colored eggs that are approximately 2.3 mm in diameter, and hatchlings are 12 - 13 mm in length and lack balancers (Krebs and Brandon 1984). This species does not metamorphose in nature, and those that are artificially induced do not thrive (Shaffer et al. 2004).

Though this species is not believed to be rare, Ambystoma andersoni has only been found in one location and pollution of its habitat and predatory fish have contributed to a decreasing population trend. Ambystoma andersoni are known to eat snail and crawfish (Shaffer et al. 2004).

  • Krebs, S.L. and Brandon, R.A. 1984. A new species of salamander (Family Ambystomatidae) from Michoacan, Mexico. Herpetologica: 238-245
  • Shaffer, H.B, Flores-Villela, O., Parra-Olea, G., Wake, D. 2004. Ambystoma andersoni. In: IUCN 2012. IUCN Red List of Threatened Species. Version 2012.2. Downloaded on 03 May 2013.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
The major threat to this species is the pollution of the lake due to surrounding agricultural and tourist activities, next to the lagoon and in conjunction with it is a new bathing area. The animals are also heavily harvested for food, and predatory fish have been introduced into the lake, which might well pose a major problem for the species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History, Abundance, Activity, and Special Behaviors

The major threat that has caused a decline in this species population is pollution of its habitat (IUCN 2004). Though Lake Zacapu is not a protected area, Ambystoma andersoni is classified as a protected species by the Mexican government (Shaffer et al. 2004).

  • Krebs, S.L. and Brandon, R.A. 1984. A new species of salamander (Family Ambystomatidae) from Michoacan, Mexico. Herpetologica: 238-245
  • Shaffer, H.B, Flores-Villela, O., Parra-Olea, G., Wake, D. 2004. Ambystoma andersoni. In: IUCN 2012. IUCN Red List of Threatened Species. Version 2012.2. Downloaded on 03 May 2013.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2015 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History, Abundance, Activity, and Special Behaviors

The major threat that has caused a decline in this species population is pollution of its habitat (IUCN 2004). Though Lake Zacapu is not a protected area, Ambystoma andersoni is classified as a protected species by the Mexican government (Shaffer et al. 2004).

  • Krebs, S.L. and Brandon, R.A. 1984. A new species of salamander (Family Ambystomatidae) from Michoacan, Mexico. Herpetologica: 238-245
  • Shaffer, H.B, Flores-Villela, O., Parra-Olea, G., Wake, D. 2004. Ambystoma andersoni. In: IUCN 2012. IUCN Red List of Threatened Species. Version 2012.2. Downloaded on 03 May 2013.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Conservation Actions
It does not occur in any protected areas. However, this is a species that could recover its numbers if the lake can be kept clean and restored.This species is protected under the category Pr (Special protection) by the Government of Mexico.

Conservation Needed
Conservation and restoration of its habitat is urgent. This species can be bred in laboratory conditions, and so captive animals could be a source of new individuals to repopulate the natural habitats.

Research Needed
Studies are needed to evaluate the sustainability of the harvest as well as the impacts of introduced predatory fishes. There is a strong need to have a species management plan and a water management plan.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Risks

Relation to Humans

This species is heavily harvested for food, which is a major contribution to its decreasing population (Shaffer et al. 2004).

  • Krebs, S.L. and Brandon, R.A. 1984. A new species of salamander (Family Ambystomatidae) from Michoacan, Mexico. Herpetologica: 238-245
  • Shaffer, H.B, Flores-Villela, O., Parra-Olea, G., Wake, D. 2004. Ambystoma andersoni. In: IUCN 2012. IUCN Red List of Threatened Species. Version 2012.2. Downloaded on 03 May 2013.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2015 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relation to Humans

This species is heavily harvested for food, which is a major contribution to its decreasing population (Shaffer et al. 2004).

  • Krebs, S.L. and Brandon, R.A. 1984. A new species of salamander (Family Ambystomatidae) from Michoacan, Mexico. Herpetologica: 238-245
  • Shaffer, H.B, Flores-Villela, O., Parra-Olea, G., Wake, D. 2004. Ambystoma andersoni. In: IUCN 2012. IUCN Red List of Threatened Species. Version 2012.2. Downloaded on 03 May 2013.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Anderson's salamander

Anderson's Salamander (Ambystoma andersoni) is a neotenic salamander from Laguna de Zacapú in the Mexican state of Michoacán.

This salamander is a relatively recent discovery, first described by Brandon and Krebs in 1984. Ambystoma andersoni is named after James Anderson, a herpetologist with the American Museum of Natural History, who did extensive fieldwork studying Ambystoma and other herp species in Mexico.

Like all neotenic Ambystoma species, A. andersoni retains its larval features into adulthood. The mature salamander has medium-sized external gills with bright red filaments, and a prominent caudal fin. It has a large head and small limbs, as do the larvae. Its coloration is a strange pattern of black blotches on a red-brown base. The salamanders are totally aquatic and spend their whole lives in the same body of water.

Habitat[edit]

Lake Zacapu is small lake near Zacapu, sitting at an altitude of 2000 meters. The lake is located within the Mesa Central portion of Mexico, an area home to many neotenic Ambystoma species. It is temperate, with low salinity, and has a single stream originating from it.

Anderson's Salamander is listed as critically endangered on the IUCN Red List.

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!