Ambystoma andersoni — Details

Anderson's Salamander learn more about names for this taxon

Articles on this page are available in 1 other language: Spanish (8) (learn more)

Overview

Distribution

Range Description

Learn more about this article

This species is known only from one lake (Lago Zacapu) and its surrounding streams, in north-western Michoacan, Mexico, at 2,000m asl.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Physical Description

Type Information

Learn more about this article

Paratype for Ambystoma andersoni
Catalog Number: USNM 206935
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Sex/Stage: Male;
Preparation: Ethanol
Year Collected: 1970
Locality: Laguna de Zacapu, ditch leading from, Michoacan, Mexico
  • Paratype: Krebs, S. L. & Brandon, R. A. 1984. Herpetologica. 40 (3): 238.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Learn more about this article

Paratype for Ambystoma andersoni
Catalog Number: USNM 206934
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Sex/Stage: Female;
Preparation: Ethanol
Year Collected: 1970
Locality: Laguna de Zacapu, ditch leading from, Michoacan, Mexico
  • Paratype: Krebs, S. L. & Brandon, R. A. 1984. Herpetologica. 40 (3): 238.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Learn more about this article

Paratype for Ambystoma andersoni
Catalog Number: USNM 206933
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Year Collected: 1970
Locality: Laguna de Zacapu, ditch leading from, Michoacan, Mexico
  • Paratype: Krebs, S. L. & Brandon, R. A. 1984. Herpetologica. 40 (3): 238.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Learn more about this article

Paratype for Ambystoma andersoni
Catalog Number: USNM 206932
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Sex/Stage: Male;
Preparation: Ethanol
Year Collected: 1970
Locality: Laguna de Zacapu, ditch leading from, Michoacan, Mexico
  • Paratype: Krebs, S. L. & Brandon, R. A. 1984. Herpetologica. 40 (3): 238.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Learn more about this article

Paratype for Ambystoma andersoni
Catalog Number: USNM 206931
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Sex/Stage: Male;
Preparation: Ethanol
Year Collected: 1970
Locality: Laguna de Zacapu, ditch leading from, Michoacan, Mexico
  • Paratype: Krebs, S. L. & Brandon, R. A. 1984. Herpetologica. 40 (3): 238.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Learn more about this article

Paratype for Ambystoma andersoni
Catalog Number: USNM 206930
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Sex/Stage: Male;
Preparation: Ethanol
Year Collected: 1970
Locality: Laguna de Zacapu, ditch leading from, Michoacan, Mexico
  • Paratype: Krebs, S. L. & Brandon, R. A. 1984. Herpetologica. 40 (3): 238.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Learn more about this article

Paratype for Ambystoma andersoni
Catalog Number: USNM 206929
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Sex/Stage: Male;
Preparation: Ethanol
Year Collected: 1970
Locality: Laguna de Zacapu, ditch leading from, Michoacan, Mexico
  • Paratype: Krebs, S. L. & Brandon, R. A. 1984. Herpetologica. 40 (3): 238.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Learn more about this article

Paratype for Ambystoma andersoni
Catalog Number: USNM 206928
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Sex/Stage: Male;
Preparation: Ethanol
Year Collected: 1970
Locality: Laguna de Zacapu, ditch leading from, Michoacan, Mexico
  • Paratype: Krebs, S. L. & Brandon, R. A. 1984. Herpetologica. 40 (3): 238.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Learn more about this article

Paratype for Ambystoma andersoni
Catalog Number: USNM 206927
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Sex/Stage: Female;
Preparation: Ethanol
Year Collected: 1970
Locality: Laguna de Zacapu, ditch leading from, Michoacan, Mexico
  • Paratype: Krebs, S. L. & Brandon, R. A. 1984. Herpetologica. 40 (3): 238.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Learn more about this article

Paratype for Ambystoma andersoni
Catalog Number: USNM 206926
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Sex/Stage: Female;
Preparation: Ethanol
Year Collected: 1970
Locality: Laguna de Zacapu, ditch leading from, Michoacan, Mexico
  • Paratype: Krebs, S. L. & Brandon, R. A. 1984. Herpetologica. 40 (3): 238.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Ecology

Habitat

Habitat and Ecology

Learn more about this article

Habitat and Ecology
This species is paedomorphic, and requires a clean, cool aquatic habitat. It is found only in Lago Zacapu and the spring-fed streams and canals associated with the lake. They do not metamorphose in nature, and individuals that have been artificially induced to metamorphose with thyroid hormone in the laboratory do not thrive. Their diet consists largely of snails and crawfish.

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Molecular Biology and Genetics

Molecular Biology

Barcode data: Ambystoma andersoni

Learn more about this article

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACTCGATGACTATTTTCTACAAATCATAAAGATATTGGCGCCCTTTATTTAGTATTTGGTGCTTGAGCCGGGATAGTTGGCACTGCATTAAGCCTTCTAATCCGAGCAGAATTAAGCCAACCAGGAGCCCTACTAGGGGAT---GATCAAATCTATAATGTTATTGTAACAGCACACGCATTTGTAATAATTTTTTTTATAGTAATACCTGTTATAATCGGGGGATTCGGAAACTGATTAGTACCATTAATAATTGGTGCACCAGATATGGCCTTCCCCCGTATAAACAATATAAGCTTTTGGCTTCTTCCTCCTTCATTCCTCCTTCTATTAGCCTCCTCTGGAGTTGAGGCAGGAGCTGGAACGGGATGAACTGTATATCCCCCACTTGCAGGGAACCTAGCCCATGCCGGGGCCTCAGTCGATTTAACAATTTTTTCACTTCATTTAGCAGGTGTTTCATCTATCCTAGGTGCAATTAATTTTATTACAACCTCAATTAATATAAAACCCGCATCAATATCACAATATCAAACCCCTTTATTTGTTTGATCAGTATTAATTACAGCAGTTCTTCTATTACTTTCTCTTCCGGTTTTAGCAGCGGGAATTACAATACTGCTGACAGATCGAAACTTAAACACAACATTCTTTGATCCTGCCGGAGGGGGTGACCCTGTACTTTATCAACACCTATTTTGATTTTTTGGGCACCCAGAAGTATATATCTTAATCTTACCCGGATTTGGAATAATTTCACATATTGTGACTTATTATTCTGCAAAAAAAGAACCATTTGGTTACATAGGAATAGCATGAACTATAATATCTATTGGGCTTCTAGGGTTTATCGTATGGGCACATCATATATTTACAGTAGATTTAAATGTTGATACACGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Statistics of barcoding coverage: Ambystoma andersoni

Learn more about this article

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Conservation

Conservation Status

IUCN Red List Assessment

Learn more about this article


Red List Category
CR
Critically Endangered

Red List Criteria
B1ab(iii)+2ab(iii)

Version
3.1

Year Assessed
2004

Assessor/s
Brad Shaffer, Oscar Flores-Villela, Gabriela Parra-Olea, David Wake

Reviewer/s
Global Amphibian Assessment Coordinating Team (Simon Stuart, Janice Chanson, Neil Cox and Bruce Young)

Contributor/s

Justification
Listed as Critically Endangered because its Extent of Occurrence is less than 100 km2 and its Area Of Occupancy is less than 10km2, all individuals are in a single sub-population, and there is continuing decline in the extent and quality of the lake habitat around the city of Zacapu.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Population

Learn more about this article

Population
Although it is not rare, it is probably declining.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Threats

Learn more about this article

Major Threats
The major threat to this species is the pollution of the lake, although the animals are also heavily harvested for food, and predatory fish have been introduced into the lake, which might well pose a major problem for the species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Management

Conservation Actions

Learn more about this article

Conservation Actions
It does not occur in any protected area. However, this is a species that could recover its numbers if the lake can be kept clean and restored. Conservation and restoration of its habitat is therefore urgent. This species can be bred in laboratory conditions, and so captive animals could be a source of new individuals to repopulate the natural habitats. Studies are needed to evaluate the sustainability of the harvest as well as the impacts of introduced predatory fishes. This species is protected under the category Pr (Special protection) by the Government of Mexico.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Wikipedia

Anderson's salamander

Learn more about this article

Anderson's Salamander (Ambystoma andersoni) is a neotenic salamander from Laguna de Zacapú in the Mexican state of Michoacán.

This salamander is a relatively recent discovery, first described by Brandon and Krebs in 1984. Ambystoma andersoni is named after James Anderson, a herpetologist with the American Museum of Natural History who did extensive fieldwork studying Ambystoma and other herp species in Mexico.

Like all neotenic Ambystoma species, andersoni retains its larval features into adulthood. The mature salamander has medium-sized external gills with bright red filaments, and a prominent caudal fin. It has a large head and small limbs, as do the larvae. Its coloration is a strange pattern of black blotches on a red-brown base. The salamanders are totally aquatic and spend their whole lives in the same body of water.

Habitat

Lake Zacapu is small lake near Zacapu, sitting at an altitude of 2000 meters. The lake is located within the Mesa Central portion of Mexico, an area home to many neotenic Ambystoma species. It is temperate, with low salinity, and has a single stream originating from it.

Anderson's Salamander is listed as critically endangered on the IUCN Red List.

References

Wikispecies has information related to: Ambystoma andersoni
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!