Articles on this page are available in 1 other language: Spanish (8) (learn more)

Overview

Brief Summary

Caption

Phyllobates lugubris is extremely toxic.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Myra Hughey

Source: Amphibians of Panama

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Description

Phyllobates lugubris is a small frog (adult males reach 21 mm in SVL, while adult females can reach 24 mm). The skin is slightly granular on the dorsum, the dorsal surface of the limbs, the belly, and the ventral surface of the thighs. Skin is smooth on the ventrum and ventral surface of the limbs. The head is longer than wide, with a rounded and truncate snout. Both maxillary and premaxillary teeth are present. The first finger is longer than the second and the toes are webless. A weak tarsal fold or tubercle is present. An elongated inner metatarsal tubercle is present, as is a rounded and smaller outer metatarsal tubercle (Savage 2002; Silverstone 1976; Guyer and Donnelly 2005). Males have a thick, dark nuptial pad along the inside of each thumb, and thicker forearms than the females (Leenders 2001; Guyer and Donnelly 2005).

This frog has a jet black dorsum, with wide, paired dorsolateral stripes that can either yellow, orange, gold, or turquoise. There is also a thinner, lighter turquoise or white ventrolateral stripe, running on each side from the tip of the snout below the eye, along the upper lips and to the arm. On the upper surfaces of the limbs, there is marbling with black and gold to yellowish green. The lower surfaces of the limbs, and the venter, are marbled with black and blue, green, white, or silver. This species has large eyes with jet black or dark brown irises. The eye is difficult to distinguish against the dark color of the head (Savage 2002; Silverstone 1976; Guyer and Donnelly 2005).

Phyllobates lugubris tadpoles are also small, reaching 24 mm in total length. Tail length is 58% of the total tadpole length. The tadpole has a depressed body, and tail height does not increase relative to increasing total length as the tadpole grows. The snout is rounded, with lateral nostrils. Eyes are dorsolateral. The mouth is directed ventrally, with a small and emarginate oral disc and serrated beaks. There are 2/3 rows of denticles, with a gap above the mouth at the median of the A2 denticle row. Papillae are present in a single large row as well as in two rows laterally under the mouth, but are not continuous above the mouth. As development progresses, the number of rows of papillae on the oral disc increases. In the early stages of development, the vent is medial and the spiracle is located at the mid-body, while in later stages, the vent is twisted right-clockwise and the spiracle is sinistral (on the left side of the body). The body and caudal musculature are dark brown, shading to a lighter brown ventrally. The fins are transparent with brown spots (Savage 2002; Donnelly 1990).

The genus Phyllobates is known to produce batrachotoxins in the skin, which can cause heart failure in predators that eat these frogs (Myers et al. 1978). These toxins are some of the most poisonous small molecules known and owe their effects to the irreversible interaction with voltage-gated sodium channels, resulting in membrane depolarization (Daly 1980). However, in Phyllobates lugubris, the amount of toxin is relatively low, ranging from none to 0.8 micrograms per frog (Daly 1980).

Phyllobates lugubris is sympatric with another species, Eleutherodactylus gaigeae, known as the "false poison-dart frog." This species mimics the appearance of P. lugubris in order to fend off predators, by having two paired red stripes running the length of the body. However, E. gaigae is a non-toxic mimic and does not produce batrachotoxins (Leenders 2001).

A Spanish-language species account can be found at the website of Instituto Nacional de Biodiversidad (INBio).

  • Caldwell, J. P. (1994). ''Natural history and survival of eggs and early larval stages of Agalychnis calcarifer (Anura: Hylidae).'' Herpetological Natural History, 2, 57-66.
  • Daly, J. W. (1995). ''The chemistry of poisons in amphibian skin.'' Proceedings of the National Academy of Sciences of the United States of America, 92, 9-13.
  • Daly, J. W., Myers, C. W., Warnick, J. E., and Albuquerque, E. X. (1980). ''Levels of batrachotoxin and lack of sensitivity to its action in poison-dart frogs (Phyllobates).'' Science, 208, 1383-1385.
  • Daly, J.W., Secunda, S.I., Garraffo, H.M., Spande, T.F., Wisnieski, A., Nishihara, C., and Cover, J.F. (1992). ''Variability in alkaloid profiles in neotropical poison dart frogs (Dendrobatidae): genetic versus environmental determinants.'' Toxicon, 30, 887-898.
  • Donnelly, M. A., Guyer, C., and de Sá, R. O. (1990). ''The tadpole of a dart poison frog, Phyllobates lugubris (Anura: Dendrobatidae).'' Proceedings of the Biological Society of Washington, 103, 427-431.
  • Dumbacher, J.P., Wako, A., Derrickson, S.R., Samuelson, A., Spande, T.F., and Daly, J.W (2004). ''Melyrid beetles (Choresine): a putative source for the batrachotoxin alkaloids found in poison-dart frogs and toxic passerine birds.'' Proceedings of the National Academy of Sciences of the United States of America, 101, 15857â€"15860.
  • Guyer, C., and Donnelly, M. A. (2005). Amphibians and Reptiles of La Selva, Costa Rica and the Caribbean Slope: A Comprehensive Guide. University of California Press, Berkeley.
  • IUCN, Conservation International, and NatureServe. 2006. Global Amphibian Assessment: Phyllobates vittatus. <www.globalamphibians.org>. Accessed on 5 May 2008.
  • Leenders, T. (2001). A Guide to Amphibians And Reptiles of Costa Rica. Zona Tropical, Miami.
  • Lieberman, S. S. (1986). ''Ecology of the leaf litter herpetofauna of a Neotropical rainforest: La Selva, Costa Rica.'' Acta Zoológica Mexicana, 15, 1-72.
  • Myers, C. W., Daly, J. W., and Malkin, B. (1978). ''A dangerously toxic new frog (Phyllobates) used by Emberá Indians of Western Colombia, with discussion of blowgun fabrication and dart poisoning.'' Bulletin of the American Museum of Natural History, 161, 307-366.
  • Savage, J. M. (1968). ''The dendrobatid frogs of Central America.'' Copeia, 1968(4), 745-776.
  • Savage, J. M. (2002). The Amphibians and Reptiles of Costa Rica. University of Chicago Press, Chicago and London.
  • Silverstone, P.A. (1976). ''A revision of the poison arrow frogs of the genus Phyllobates Bibron in Sagra (Family Dendrobatidae).'' Natural History Museum of Los Angeles County Science Bulletin, 27, 1-53.
  • Weygoldt, P. (1987). ''Evolution of parental care in dart poison frogs (Amphibia: Anura: Dendrobatidae).'' Zeitschrift für Zoologische Systematik und Evolutions Forschung, 25(1), 51-67.
  • Zimmermann, H. and Zimmermann, E. (1988). ''Etho-Taxonomie und zoogeographische Artengruppenbildung bei Pfeilgiftfröschen (Anura: Dendrobatidae).'' Salamandra, 24, 125-160.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

This species is known from humid lowlands and marginally in the premontane zone of the Atlantic versant from extreme southeastern Nicaragua to central Panama (including islands in the Bocas del Toro Province), a single specimen from just west of the Panama Canal, from 10-601m asl (Savage, 2002).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution and Habitat

Phyllobates lugubris occurs in the Caribbean lowlands, from the extreme southeastern tip of Nicaragua through Costa Rica and into northwestern Panama, including on the islands of the Bocas del Toros archipelago in Panama (Leenders 2001; Savage 2002). This species is found from sea level to 650 m.(IUCN 2004). It prefers lowland wet and moist forests, but also occurs at the margin of premontane wet forests (Savage 2002). It has been found in leaf litter in both primary and secondary forests in La Selva, Costa Rica, preferring to live near slow-moving waters (Guyer and Donnelly 2005).

  • Caldwell, J. P. (1994). ''Natural history and survival of eggs and early larval stages of Agalychnis calcarifer (Anura: Hylidae).'' Herpetological Natural History, 2, 57-66.
  • Daly, J. W. (1995). ''The chemistry of poisons in amphibian skin.'' Proceedings of the National Academy of Sciences of the United States of America, 92, 9-13.
  • Daly, J. W., Myers, C. W., Warnick, J. E., and Albuquerque, E. X. (1980). ''Levels of batrachotoxin and lack of sensitivity to its action in poison-dart frogs (Phyllobates).'' Science, 208, 1383-1385.
  • Daly, J.W., Secunda, S.I., Garraffo, H.M., Spande, T.F., Wisnieski, A., Nishihara, C., and Cover, J.F. (1992). ''Variability in alkaloid profiles in neotropical poison dart frogs (Dendrobatidae): genetic versus environmental determinants.'' Toxicon, 30, 887-898.
  • Donnelly, M. A., Guyer, C., and de Sá, R. O. (1990). ''The tadpole of a dart poison frog, Phyllobates lugubris (Anura: Dendrobatidae).'' Proceedings of the Biological Society of Washington, 103, 427-431.
  • Dumbacher, J.P., Wako, A., Derrickson, S.R., Samuelson, A., Spande, T.F., and Daly, J.W (2004). ''Melyrid beetles (Choresine): a putative source for the batrachotoxin alkaloids found in poison-dart frogs and toxic passerine birds.'' Proceedings of the National Academy of Sciences of the United States of America, 101, 15857â€"15860.
  • Guyer, C., and Donnelly, M. A. (2005). Amphibians and Reptiles of La Selva, Costa Rica and the Caribbean Slope: A Comprehensive Guide. University of California Press, Berkeley.
  • IUCN, Conservation International, and NatureServe. 2006. Global Amphibian Assessment: Phyllobates vittatus. <www.globalamphibians.org>. Accessed on 5 May 2008.
  • Leenders, T. (2001). A Guide to Amphibians And Reptiles of Costa Rica. Zona Tropical, Miami.
  • Lieberman, S. S. (1986). ''Ecology of the leaf litter herpetofauna of a Neotropical rainforest: La Selva, Costa Rica.'' Acta Zoológica Mexicana, 15, 1-72.
  • Myers, C. W., Daly, J. W., and Malkin, B. (1978). ''A dangerously toxic new frog (Phyllobates) used by Emberá Indians of Western Colombia, with discussion of blowgun fabrication and dart poisoning.'' Bulletin of the American Museum of Natural History, 161, 307-366.
  • Savage, J. M. (1968). ''The dendrobatid frogs of Central America.'' Copeia, 1968(4), 745-776.
  • Savage, J. M. (2002). The Amphibians and Reptiles of Costa Rica. University of Chicago Press, Chicago and London.
  • Silverstone, P.A. (1976). ''A revision of the poison arrow frogs of the genus Phyllobates Bibron in Sagra (Family Dendrobatidae).'' Natural History Museum of Los Angeles County Science Bulletin, 27, 1-53.
  • Weygoldt, P. (1987). ''Evolution of parental care in dart poison frogs (Amphibia: Anura: Dendrobatidae).'' Zeitschrift für Zoologische Systematik und Evolutions Forschung, 25(1), 51-67.
  • Zimmermann, H. and Zimmermann, E. (1988). ''Etho-Taxonomie und zoogeographische Artengruppenbildung bei Pfeilgiftfröschen (Anura: Dendrobatidae).'' Salamandra, 24, 125-160.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Countries

Countries

Costa Rica, Nicaragua, Panama

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Myra Hughey

Source: Amphibians of Panama

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Diagnostic Description

Identification

Adult

Species description based on Savage (2002).  A tiny poison frog (males to 21 mm, females to 24 mm).

Dorsal

The dorsal surface is black, with a narrow gold, yellow, or orange stripe that extends all the way around the forward part of the body--across the snout, above the eyes, back along the sides of the dorsum. The upper surfaces of the arms and legs are speckled with similar colors. A light blue or white wavy stripe extends down from below the eye to just in front of the arm.

Eye

The eye is black.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Myra Hughey

Source: Amphibians of Panama

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
It is a terrestrial, diurnal species of humid lowland forest; it may be present in secondary growth and plantations. Adults are often found in the rocky sections of forest streams. Eggs are deposited in dry leaf-litter; the males transport hatching tadpoles to forest streams to complete metamorphosis.

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat

Lowland and premontane forest to 600 m.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Myra Hughey

Source: Amphibians of Panama

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Behaviour

Call

A low, raspy trill (Savage 2002)

Behavior and communication

Males are not territorial (Savage 2002). In captivity, a male and female may court for many days prior to amplexus, frequently touching one another (Zimmerman 1982, Weygoldt 1987). Males stay close to eggs, and will rehydrate them if they begin to dry out (Zimmerman 1982, Weygoldt 1987). At hatching, the male carries the tadpoles, a few at a time, to a small body of water to continue development (Zimmerman 1982, Weygoldt 1987).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Myra Hughey

Source: Amphibians of Panama

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

Life History

Egg

Eggs hatch in 9-14 days (Zimmerman 1982, Weygoldt 1987).

Tadpole

The tadpole is small and dark brown, with some darker blotches on the tail (Savage 2002). The tail is moderately long with reduced tail fins (Savage 2002). Metamorphosis takes place after 60 days (Zimmerman 1982, Weygoldt 1987).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Myra Hughey

Source: Amphibians of Panama

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physiology and Cell Biology

Cell Biology

Karyotype

Karyotype

2N = 24 (Rasotto et al 1987)

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Myra Hughey

Source: Amphibians of Panama

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Phyllobates lugubris

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACCTTATACCTAGTATTCGGCGCATGGGCCGGGATAGTCGGCACAGCCCTCAGCCTCTTAATTCGAGCAGAATTAAGCCAACCTGGCTCACTGCTTGGGGAC---GATCAAATTTATAATGTGATCGTCACCGCTCACGCTTTCGTAATGATTTTTTTTATGGTTATGCCAATTCTTATTGGGGGATTCGGAAATTGGCTCGTGCCTCTAATGATTGGTGCCCCAGACATAGCCTTCCCCCGTATAAATAATATAAGTTTTTGGCTACTCCCACCTTCTTTCCTTCTTTTACTAGCCTCCGCAGGGGTTGAAGCGGGTGCTGGAACAGGTTGAACGGTTTATCCCCCTCTTGCAAGTAATTTGGCCCACGCTGGACCATCAGTGGATTTAACAATTTTTTCACTCCATCTGGCTGGAGTCTCATCTATCCTAGGAGCCATTAATTTTATTACTACAACTTTAAACATAAAACCCCCGTCATTAACACAGTATCAAACTCCTCTATTCGTATGGTCCGTTTTAATTACTGCCATTCTTCTTCTCCTCTCCCTCCCAGTTTTAGCCGCAGGCATTACAATATTACTTACTGATCGAAACTTAAATACAACCTTTTTTGACCCTGCTGGGGGCGGAGACCCAGTTCTTTATCAACACTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Phyllobates lugubris

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Solís, F., Ibáñez, R., Chaves, G., Savage, J., Jaramillo, C., Fuenmayor, Q., Young, B.E. & Bolaños, F.

Reviewer/s
Stuart, S.N., Chanson, J.S., Cox, N.A. & Young, B.E.

Contributor/s

Justification
Listed as Least Concern in view of its wide distribution, tolerance of a degree of habitat modification, presumed large population, and because it is unlikely to be declining fast enough to qualify for listing in a more threatened category.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
This species is uncommon in northern Costa Rica, but more common in the south; presumably, it is also common in Panama.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History, Abundance, Activity, and Special Behaviors

Phyllobates lugubris is diurnal, inhabiting leaf litter on the forest floor (Savage, 2002). The bright coloration is aposematic, serving as a warning of skin toxins to predators. This frog is not territorial (Savage 2002).

Breeding occurs during the wet season. Males usually call from within protected areas of low visibility, such as water surrounded by thick vegetation, to attract females (Leenders 2001). The call is a constant high trill, composed of squalls and chortles that last several seconds, and sounds similar to rubbing a hand across an inflated balloon (Guyer and Donnelly 2005). Savage (2002) states that Silverstone's (1976) description of the call of P. lugubris as a low raspy trill is in error, and that the call described by Silverstone (1976) is actually that of the related species Phyllobates vittatus. The male and female work together to create a ground nest in dry leaf litter (Savage 2002; Guyer and Donnelly 2005). The female then deposits her eggs, which the male fertilizes (Savage 2002; Guyer and Donnelly 2005). Development from oviposition to hatching takes nine to fourteen days (Savage 2002).

This species exhibits uniparental male care (Weygoldt 1987; Zimmermann and Zimmermann 1988). After the female deposits the eggs in a ground nest, they are periodically moistened by the male parent (hydric brooding)(Savage 2002; Guyer and Donnelly 2005). Once the eggs are hatched, the male transports his offspring to aquatic rearing sites by carrying five to ten tadpoles at a time on his back(Donnelly et al. 1990; Caldwell et al. 1994). In about two months they metamorphose into froglets of about 12 mm (Savage 2002). Frogs are sexually mature at about 10 months (Savage 2002). The adult diet consists of a wide variety of invertebrate prey, most of which are insects such as formicids (ants) and areneids (Lieberman 1986; Guyer and Donnelly 2005).

  • Caldwell, J. P. (1994). ''Natural history and survival of eggs and early larval stages of Agalychnis calcarifer (Anura: Hylidae).'' Herpetological Natural History, 2, 57-66.
  • Daly, J. W. (1995). ''The chemistry of poisons in amphibian skin.'' Proceedings of the National Academy of Sciences of the United States of America, 92, 9-13.
  • Daly, J. W., Myers, C. W., Warnick, J. E., and Albuquerque, E. X. (1980). ''Levels of batrachotoxin and lack of sensitivity to its action in poison-dart frogs (Phyllobates).'' Science, 208, 1383-1385.
  • Daly, J.W., Secunda, S.I., Garraffo, H.M., Spande, T.F., Wisnieski, A., Nishihara, C., and Cover, J.F. (1992). ''Variability in alkaloid profiles in neotropical poison dart frogs (Dendrobatidae): genetic versus environmental determinants.'' Toxicon, 30, 887-898.
  • Donnelly, M. A., Guyer, C., and de Sá, R. O. (1990). ''The tadpole of a dart poison frog, Phyllobates lugubris (Anura: Dendrobatidae).'' Proceedings of the Biological Society of Washington, 103, 427-431.
  • Dumbacher, J.P., Wako, A., Derrickson, S.R., Samuelson, A., Spande, T.F., and Daly, J.W (2004). ''Melyrid beetles (Choresine): a putative source for the batrachotoxin alkaloids found in poison-dart frogs and toxic passerine birds.'' Proceedings of the National Academy of Sciences of the United States of America, 101, 15857â€"15860.
  • Guyer, C., and Donnelly, M. A. (2005). Amphibians and Reptiles of La Selva, Costa Rica and the Caribbean Slope: A Comprehensive Guide. University of California Press, Berkeley.
  • IUCN, Conservation International, and NatureServe. 2006. Global Amphibian Assessment: Phyllobates vittatus. <www.globalamphibians.org>. Accessed on 5 May 2008.
  • Leenders, T. (2001). A Guide to Amphibians And Reptiles of Costa Rica. Zona Tropical, Miami.
  • Lieberman, S. S. (1986). ''Ecology of the leaf litter herpetofauna of a Neotropical rainforest: La Selva, Costa Rica.'' Acta Zoológica Mexicana, 15, 1-72.
  • Myers, C. W., Daly, J. W., and Malkin, B. (1978). ''A dangerously toxic new frog (Phyllobates) used by Emberá Indians of Western Colombia, with discussion of blowgun fabrication and dart poisoning.'' Bulletin of the American Museum of Natural History, 161, 307-366.
  • Savage, J. M. (1968). ''The dendrobatid frogs of Central America.'' Copeia, 1968(4), 745-776.
  • Savage, J. M. (2002). The Amphibians and Reptiles of Costa Rica. University of Chicago Press, Chicago and London.
  • Silverstone, P.A. (1976). ''A revision of the poison arrow frogs of the genus Phyllobates Bibron in Sagra (Family Dendrobatidae).'' Natural History Museum of Los Angeles County Science Bulletin, 27, 1-53.
  • Weygoldt, P. (1987). ''Evolution of parental care in dart poison frogs (Amphibia: Anura: Dendrobatidae).'' Zeitschrift für Zoologische Systematik und Evolutions Forschung, 25(1), 51-67.
  • Zimmermann, H. and Zimmermann, E. (1988). ''Etho-Taxonomie und zoogeographische Artengruppenbildung bei Pfeilgiftfröschen (Anura: Dendrobatidae).'' Salamandra, 24, 125-160.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
General habitat loss occurs by the destruction of natural forests and water pollution. In Costa Rica, there is some illegal collection of thi species for the international pet trade, however this is at a low level and probably does not constitute a major threat (Federico Bolaños pers. comm. 2007). Museum specimens of this species have been found to have chytrid fungi; the current impact of this pathogen on populations is unclear.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History, Abundance, Activity, and Special Behaviors

Habitat loss is due mainly to deforestation and human-induced water pollution. This species shows tolerance to a degree of habitat modification, and is found in three protected areas in Panama and three in Costa Rica. Some collected specimens have been found to be infected with Batrachochytrium dendrobatidis (chytrid fungus), but the pathogenic impacts are unclear (IUCN, 2004).

  • Caldwell, J. P. (1994). ''Natural history and survival of eggs and early larval stages of Agalychnis calcarifer (Anura: Hylidae).'' Herpetological Natural History, 2, 57-66.
  • Daly, J. W. (1995). ''The chemistry of poisons in amphibian skin.'' Proceedings of the National Academy of Sciences of the United States of America, 92, 9-13.
  • Daly, J. W., Myers, C. W., Warnick, J. E., and Albuquerque, E. X. (1980). ''Levels of batrachotoxin and lack of sensitivity to its action in poison-dart frogs (Phyllobates).'' Science, 208, 1383-1385.
  • Daly, J.W., Secunda, S.I., Garraffo, H.M., Spande, T.F., Wisnieski, A., Nishihara, C., and Cover, J.F. (1992). ''Variability in alkaloid profiles in neotropical poison dart frogs (Dendrobatidae): genetic versus environmental determinants.'' Toxicon, 30, 887-898.
  • Donnelly, M. A., Guyer, C., and de Sá, R. O. (1990). ''The tadpole of a dart poison frog, Phyllobates lugubris (Anura: Dendrobatidae).'' Proceedings of the Biological Society of Washington, 103, 427-431.
  • Dumbacher, J.P., Wako, A., Derrickson, S.R., Samuelson, A., Spande, T.F., and Daly, J.W (2004). ''Melyrid beetles (Choresine): a putative source for the batrachotoxin alkaloids found in poison-dart frogs and toxic passerine birds.'' Proceedings of the National Academy of Sciences of the United States of America, 101, 15857â€"15860.
  • Guyer, C., and Donnelly, M. A. (2005). Amphibians and Reptiles of La Selva, Costa Rica and the Caribbean Slope: A Comprehensive Guide. University of California Press, Berkeley.
  • IUCN, Conservation International, and NatureServe. 2006. Global Amphibian Assessment: Phyllobates vittatus. <www.globalamphibians.org>. Accessed on 5 May 2008.
  • Leenders, T. (2001). A Guide to Amphibians And Reptiles of Costa Rica. Zona Tropical, Miami.
  • Lieberman, S. S. (1986). ''Ecology of the leaf litter herpetofauna of a Neotropical rainforest: La Selva, Costa Rica.'' Acta Zoológica Mexicana, 15, 1-72.
  • Myers, C. W., Daly, J. W., and Malkin, B. (1978). ''A dangerously toxic new frog (Phyllobates) used by Emberá Indians of Western Colombia, with discussion of blowgun fabrication and dart poisoning.'' Bulletin of the American Museum of Natural History, 161, 307-366.
  • Savage, J. M. (1968). ''The dendrobatid frogs of Central America.'' Copeia, 1968(4), 745-776.
  • Savage, J. M. (2002). The Amphibians and Reptiles of Costa Rica. University of Chicago Press, Chicago and London.
  • Silverstone, P.A. (1976). ''A revision of the poison arrow frogs of the genus Phyllobates Bibron in Sagra (Family Dendrobatidae).'' Natural History Museum of Los Angeles County Science Bulletin, 27, 1-53.
  • Weygoldt, P. (1987). ''Evolution of parental care in dart poison frogs (Amphibia: Anura: Dendrobatidae).'' Zeitschrift für Zoologische Systematik und Evolutions Forschung, 25(1), 51-67.
  • Zimmermann, H. and Zimmermann, E. (1988). ''Etho-Taxonomie und zoogeographische Artengruppenbildung bei Pfeilgiftfröschen (Anura: Dendrobatidae).'' Salamandra, 24, 125-160.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
This species has been recorded from three protected areas in Panama and three in Costa Rica. It is listed on CITES Appendix II.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Risks

Relation to Humans

Striped Poison Dart Frogs have become popular pets and are collected for the pet trade. Some South American cultures capture other members of this genus (Phyllobates terribilis, P. bicolor, P. aurotaenia) to poison blow-gun darts (Myers et al. 1978). However, Phyllobates lugubris is not as toxic as other species in its genus and has not been documented to have been hunted primarily for its poison(Myers et al. 1978; Guyer and Donnelly 2005). Some populations do contain batrachotoxins in the skin, but a few populations of Phyllobates lugubris have been found to contain no detectable amounts of toxin (Daly 1995). If toxins are present in wild-caught dendrobatid frogs, they persist even when the frogs are maintained in captivity (Daly et al. 1978). However, captive-born and bred dendrobatid frogs lack toxicity, since the toxins are acquired from dietary sources such as ants, mites or beetles (Daly et al. 1980; Daly et al. 1992; Dumbacher et al. 2004).

  • Caldwell, J. P. (1994). ''Natural history and survival of eggs and early larval stages of Agalychnis calcarifer (Anura: Hylidae).'' Herpetological Natural History, 2, 57-66.
  • Daly, J. W. (1995). ''The chemistry of poisons in amphibian skin.'' Proceedings of the National Academy of Sciences of the United States of America, 92, 9-13.
  • Daly, J. W., Myers, C. W., Warnick, J. E., and Albuquerque, E. X. (1980). ''Levels of batrachotoxin and lack of sensitivity to its action in poison-dart frogs (Phyllobates).'' Science, 208, 1383-1385.
  • Daly, J.W., Secunda, S.I., Garraffo, H.M., Spande, T.F., Wisnieski, A., Nishihara, C., and Cover, J.F. (1992). ''Variability in alkaloid profiles in neotropical poison dart frogs (Dendrobatidae): genetic versus environmental determinants.'' Toxicon, 30, 887-898.
  • Donnelly, M. A., Guyer, C., and de Sá, R. O. (1990). ''The tadpole of a dart poison frog, Phyllobates lugubris (Anura: Dendrobatidae).'' Proceedings of the Biological Society of Washington, 103, 427-431.
  • Dumbacher, J.P., Wako, A., Derrickson, S.R., Samuelson, A., Spande, T.F., and Daly, J.W (2004). ''Melyrid beetles (Choresine): a putative source for the batrachotoxin alkaloids found in poison-dart frogs and toxic passerine birds.'' Proceedings of the National Academy of Sciences of the United States of America, 101, 15857â€"15860.
  • Guyer, C., and Donnelly, M. A. (2005). Amphibians and Reptiles of La Selva, Costa Rica and the Caribbean Slope: A Comprehensive Guide. University of California Press, Berkeley.
  • IUCN, Conservation International, and NatureServe. 2006. Global Amphibian Assessment: Phyllobates vittatus. <www.globalamphibians.org>. Accessed on 5 May 2008.
  • Leenders, T. (2001). A Guide to Amphibians And Reptiles of Costa Rica. Zona Tropical, Miami.
  • Lieberman, S. S. (1986). ''Ecology of the leaf litter herpetofauna of a Neotropical rainforest: La Selva, Costa Rica.'' Acta Zoológica Mexicana, 15, 1-72.
  • Myers, C. W., Daly, J. W., and Malkin, B. (1978). ''A dangerously toxic new frog (Phyllobates) used by Emberá Indians of Western Colombia, with discussion of blowgun fabrication and dart poisoning.'' Bulletin of the American Museum of Natural History, 161, 307-366.
  • Savage, J. M. (1968). ''The dendrobatid frogs of Central America.'' Copeia, 1968(4), 745-776.
  • Savage, J. M. (2002). The Amphibians and Reptiles of Costa Rica. University of Chicago Press, Chicago and London.
  • Silverstone, P.A. (1976). ''A revision of the poison arrow frogs of the genus Phyllobates Bibron in Sagra (Family Dendrobatidae).'' Natural History Museum of Los Angeles County Science Bulletin, 27, 1-53.
  • Weygoldt, P. (1987). ''Evolution of parental care in dart poison frogs (Amphibia: Anura: Dendrobatidae).'' Zeitschrift für Zoologische Systematik und Evolutions Forschung, 25(1), 51-67.
  • Zimmermann, H. and Zimmermann, E. (1988). ''Etho-Taxonomie und zoogeographische Artengruppenbildung bei Pfeilgiftfröschen (Anura: Dendrobatidae).'' Salamandra, 24, 125-160.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Lovely Poison Frog

The lovely poison frog (Phyllobates lugubris) is a species of frog in the Dendrobatidae family found in Costa Rica, Nicaragua, and Panama. Its natural habitats are subtropical or tropical, moist, lowland forests, rivers, plantations, and heavily degraded former forests. It is threatened by habitat loss.[1]

References[edit]

  1. ^ Solís, F., Ibáñez, R., Chaves, G., Savage, J., Jaramillo, C., Fuenmayor, Q. & Young, B. 2004. Phyllobates lugubris. 2006 IUCN Red List of Threatened Species. Downloaded on 21 July 2007.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!