Overview

Distribution

Range Description

Known from two localities within the Municipality of Pacaraima, Roraima, Brazil (Caramaschi 2010). This species has been found from the lowlands to 121 m altitude at Vila Surumu, Municipality of Pacaraima, Roraima, Brazil (Caramaschi 2010).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

This species is found in Mesoamerica in the western Pacific lowlands of Panama. In South America this species has been recorded in Bolivia, Paraguay, Brazil, Colombia, Venezuela (Sucre and Bolìvar states), Trinidad Island, Trinidad and Tobago and the Guianas. Its distribution is poorly known, and its taxonomic status is in need of revision. It occurs up to 500m asl.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

Individuals of this species are known from west-central Brazil, in the southwestern State of Mato Grosso and northwestern State of Mato Grosso do Sul, between 142-221 m asl (Caramaschi 2010). Taking its range as a proxy for extent of occurrence (EOO) this is estimated at 12,853 km2. Given its relatively widespread distribution within the Amazon basin, which still contains suitable habitat, this species may have a wider distribution.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

This species is known from the states of Amazonas, Pará and Rondônia, in northern Brazil, and from the departments of Beni and Santa Cruz, in Bolivia (Caramaschi 2010). It occurs in lowland areas of the Amazon basin at about 90 m asl.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

This species is currently known from ten sites in northwestern Tocantins and southeastern Para, Brazil, from 84-345 m asl (Caramaschi 2010). Its range, taken as a proxy for extent of occurrence (EOO), is estimated to be 19,545 km2; however, it is possible that it may occur more widely.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

This species is known from the type locality (Usina Hidrelétrica Ponta da Madeira, São Luís, state of Maranhão, at 24 m asl), and a second locality (345 m asl) also in Maranhão, northern Brazil (Caramaschi 2010).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Countries

Countries

Bolivia, Brazil, Colombia, French Guiana, Guyana, Panama, Paraguay, Suriname, Trinidad and Tobago, Venezuela

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Myra Hughey

Source: Amphibians of Panama

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Diagnostic Description

Identification

Adult

Species description based on Cochran and Goin (1970) and Murphy (1997).  A smallish frog with a rather flattened, oval-shaped body, and a tiny head with a pointed snout (up to 39-40 mm). In males, the throat is black; in females it is white mottled with black.

Dorsal

The dorsum is speckled, white, dark grey and black. A very thin, white middorsal line is apparent. The skin of the dorsum is smooth.

Concealed surfaces

A narrow, horizontal yellow line is present along the rear surfaces of the thighs.

Eye

The eyes are very small.

Extremities

The limbs are short and robust.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Myra Hughey

Source: Amphibians of Panama

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology

It inhabits lowland rainforests. Based on information from congeners it is presumed to be a fossorial species that can be found within leaf litter, breeds in ponds and has aquatic larvae (Toledo et al. 2011).


Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
It lives in leaf-litter and in tree holes in tropical rainforests and on the forest edge, as well as grasslands and shrublands. Breeding takes place in ponds, and eggs and tadpoles in water. Male specimens have been found calling from water up to 30cm deep, in flooded forest. It is tolerant of some habitat modification and can survive in rural gardens and pastureland.

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology

It inhabits lowland rainforests. Based on information from congeners it is presumed to be a fossorial species that can be found within leaf litter, breeds in ponds and has aquatic larvae (Toledo et al. 2011).


Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
It is a terrestrial species, likely a lowland forest leaf litter dweller like its congeners. It has been reported in proximity to an urban area (Fonseca et al. 2012). A male has been reported calling from a temporary pond (Fonseca et al. 2012), suggesting that this species may breed in ponds with aquatic tadpoles.

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology

It inhabits lowland rainforests. Based on information from congeners it is presumed to be a fossorial species that can be found within leaf litter, breeds in ponds and has aquatic larvae (Toledo et al. 2011).



Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology

It inhabits lowland rainforests. Based on information from congeners it is presumed to be a fossorial species that can be found within leaf litter, breeds in ponds and has aquatic larvae (Toledo et al. 2011).


Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat

Open savannah to 500 m.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Myra Hughey

Source: Amphibians of Panama

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Ecology

Ecology

During the dry season, frogs seek refuge underground (Hoogmoed and Gorzula 1979).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Myra Hughey

Source: Amphibians of Panama

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Behaviour

Call

A sharp "eeee" (Murphy 1997).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Myra Hughey

Source: Amphibians of Panama

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

Life History

Breeding season

Breeding takes place during the rainy season in open flooded areas, including agricultural land (Murphy 1997).

Egg

Eggs hatch in two days (Kenny 1969).

Tadpole

Tadpoles metamorphose in eight weeks (Kenny 1969).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Myra Hughey

Source: Amphibians of Panama

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Elachistocleis ovalis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CTTATTTTCGGGGCCTGAGCCGGAATAGTAGGCACAGCCCTTAGTCTCCTTATTCGAGCCGAACTAAGCCAACCTGGCAGCCTCCTCGGTGATGATCAAATTTATAATGTTATTGTCACTGCCCATGCCTTCGTAATAATCTTCTTCATAGTAATACCAATCATAATTGGTGGGTTTGGTAACTGATTAGTCCCACTTATGCTTGGAGCACCAGACATAGCCTTCCCACGAATAAACAACATAAGCTTTTGACTACTACCCCCATCTTTTCTTCTCCTTCTAGCGTCATCTGCAGTAGAAGCAGGGGCCGGAACCGGATGAACAGTCTATCCACCTCTAGCTAGTAATCTAGCCCATGCAGGACCATCAGTTGACTTAACCATTTTTTCTCTTCATTTGGCAGGAGTTTCTTCAATCCTGGGGGCAATCAACTTTATTACAACTATTATTAACATAAAACCCCCCTCAGTTACCCAATATCAAACCCCTCTATTTGTCTGATCCGTAATTATTACGGCTGTCCTCCTTCTTCTTTCACTGCCAGTCCTTGCAGCAGGAATTACTATACTTTTAACTGACCGAAATTTAAACACCACATTTTTTGACCCTGCCGGAGGAGGTGATCCAATTCTCTATCAACACCTTTTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Elachistocleis ovalis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 32
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
DD
Data Deficient

Red List Criteria

Version
3.1

Year Assessed
2013

Assessor/s
IUCN SSC Amphibian Specialist Group,

Reviewer/s
Cox, N.A.

Contributor/s
Jarvis, L.

Justification

Listed as Data Deficient given that it has recently been described and there is little information on its extent of occurrence, population status, habitat requirements and threats.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Miguel Trefaut Rodrigues, Andrés Acosta-Galvis, Esteban Lavilla, Frank Solís, Roberto Ibáñez, César Jaramillo, Querube Fuenmayor, Jerry Hardy

Reviewer/s
Global Amphibian Assessment Coordinating Team (Simon Stuart, Janice Chanson, Neil Cox and Bruce Young)

Contributor/s

Justification
Listed as Least Concern in view of its wide distribution, tolerance of a degree of habitat modification, presumed large population, and because it is unlikely to be declining to qualify for listing in a more threatened category.

History
  • 2004
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2013

Assessor/s
IUCN SSC Amphibian Specialist Group,

Reviewer/s
Cox, N.A.

Contributor/s
Jarvis, L.

Justification

Listed as Least Concern given that it has a widespread distribution over a large area of the Amazon basin which still contains suitable habitat.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2013

Assessor/s
IUCN SSC Amphibian Specialist Group,

Reviewer/s
Cox, N.A.

Contributor/s
Angulo, A. & Jarvis, L.

Justification
Listed as Least Concern given that it has a widespread distribution over a large area of the Amazon basin which still contains suitable habitat.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2013

Assessor/s
IUCN SSC Amphibian Specialist Group,

Reviewer/s
Cox, N.A.

Contributor/s
Jarvis, L.

Justification

Listed as Least Concern based on the number and spread of geographical localities where the species has been found, that it appears to occur over a large area of Amazon rainforest in inland Brazil, and that it may likely have a more widespread distribution. However, further information on its extent of occurrence (EOO), population status, habitat requirements and threats are required.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
DD
Data Deficient

Red List Criteria

Version
3.1

Year Assessed
2013

Assessor/s
IUCN SSC Amphibian Specialist Group,

Reviewer/s
Cox, N.A.

Contributor/s
Jarvis, L.

Justification

Listed as Data Deficient given that it has recently been described and there is little information on its extent of occurrence, population status, habitat requirements and threats.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population

There is no population status information currently available for this species.


Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
It is considered to be common at some sites.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
It is known only from the type series. Its population status is currently unknown.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
No direct information on population status is currently available for this species; however, assuming that it has been treated as Elachistocleis bicolor in the past (see Caramaschi 2010), it is possible that it may be a locally common species.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population

It has been described from 11 individuals (Caramaschi 2010). Its population status is currently unknown.


Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population

It was described from 10 individuals captured in 2008 (Caramaschi 2010). There is no information on the population status of this species.


Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats

There is no information on major threats to this species.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Major Threats
There are no major threats to this species. But shifting cultivation, logging, fire, infrastructure development, agro industrial farming and water pollution might impact local populations.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Major Threats

There is no direct information on major threats to this species, although given its widespread occurrence it is possible that there may be localized threats in the form of human settlement development, agriculture, livestock farming and logging.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Major Threats

There is no direct information on major threats to this species, although given its widespread occurrence it is possible that there may be localized threats in the form of human settlement development, agriculture, livestock farming and logging.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Major Threats

There is no information on major threats to this species. However, as it occurs over a large area and based on satellite imagery it is thought that there may be localized threats such as habitat loss and fragmentation due to agricultural expansion, livestock farming human settlement and logging.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Major Threats

There is no information on major threats to this species.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions

No conservation actions are currently known for this species. More information is needed on this species' distribution, population status, natural history and threats.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation Actions

Conservation Actions
It occurs in several protected areas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation Actions

Conservation Actions
There are no conservation actions currently known for this species. More information is needed on this species' population status, natural history and threats.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation Actions

Conservation Actions

Its current range includes a number of protected areas, so it is likely that it may occur within one or more of these. More information is needed on this species' population status, natural history and threats.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation Actions

Conservation Actions

No conservation actions are currently known for this species. More information is needed on this species' distribution, population status, natural history and threats.


Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation Actions

Conservation Actions

No conservation actions are currently known for this species. More information is needed on this species' distribution, population status, natural history and threats.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Elachistocleis ovalis

Elachistocleis ovalis (common name: common oval frog, Spanish: sapito apuntado bicolor) is a species of frog in the Microhylidae family. Technically, Elachistocleis ovalis is species inquirenda, and it is not known to which population the name applies. The Amphibian Species of the World restricts this species to Panama, Colombia, Trinidad and Tobago, and Bolivia. Frogs from Brazil has been allocated to other species.[2]

Elachistocleis ovalis lives in leaf litter and in tree holes in tropical rainforests and on the forest edges, grasslands, and shrublands. It breeds in ponds where eggs and larvae develop.[1]

References[edit]

  1. ^ a b Miguel Trefaut Rodrigues, Andrés Acosta-Galvis, Esteban Lavilla, Frank Solís, Roberto Ibáñez, César Jaramillo, Querube Fuenmayor, Jerry Hardy (2010). "Elachistocleis ovalis". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 22 March 2014. 
  2. ^ Frost, Darrel R. (2014). "Elachistocleis ovalis (Schneider, 1799)". Amphibian Species of the World: an Online Reference. Version 6.0. American Museum of Natural History. Retrieved 22 March 2014. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!