Overview

Comprehensive Description

Type locality

Off North Carolina, 36°16´30”N, 68°21´W, 4710 m.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Taylor, Joanne

Source: Squat Lobsters LIFEDESK

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Data

Holotype, fragments, ovigerous female, USNM 8563.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Baba, Keiji

Source: Squat Lobsters LIFEDESK

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Synonymy

Munidopsis crassa Smith, 1885: 494 (off North Carolina, 4710 m). — Smith, 1886: 645, pl. 4 (off Virginia, 4710 m). — A. Milne Edwards & Bouvier, 1894a: 275 (key). — A. Milne Edwards & Bouvier, 1899: 82 (NE of Azores, 4360 m). — Benedict, 1902: 276 (key), 318 (list). — Fowler, 1912: 574. — Doflein & Balss, 1913: 176 (list), 177 (table) — Bouvier, 1922: 47 (Bay of Biscay, 46°17´30N, 5°42´W, 4380 m). — Nobre, 1936: 117 (no record). — Chace, 1942: 73 (key). — Gordon, 1955: 239, figs 1A, 2A, 2A', 3A, pl. 1 (off Canary Islands (29°48´N, 17°39´W), 4255–4267 m). — Sivertsen & Holthuis, 1956: 46, pl. 4, fig. 1 (Bay of Biscay (45°26´N, 9°20´W), 4700 m). — Zariquiey Álvarez, 1968: 269, fig. 95b (compilation). — Miyake & Baba, 1970: 93 (list). — Pequegnat & Pequegnat, 1970: 93 (list). — Pequegnat & Pequegnat, 1971: 18 (Colombian Basin and Yucatan Basin, 4150–4554 m). — Türkay, 1975: 67, fig. 2 (Iberian deep sea (West Europe Basin), 5315 m). — Wenner, 1982: 367 (Middle Atlantic Bight, 2679 m). — Gore, 1983: 206 (Venezuelan Basin, 3934–5060 m). — de Saint Laurent, 1985: table 2 (Bay of Biscay, 3992– 4510 m). — Williams & Turner, 1986: 619 (Woods Hole, 3506 m, St Croix, 4000 m). — Segonzac, 1992: 596 (Snake Pit, Mid-Atlantic Ridge, 23°N, hydrothermal active site, 3480 m). — González Pérez, 1995: 161 (no record). — Chevaldonné & Olu, 1996: 290 (no record). — Olu et al., 1996: 115 (list of occurrences). — d'Udekem d'Acoz, 1999: 167 (compilation). — Tiefenbacher, 2001: 63 (West Europe Basin, 4635–4723 m). — Baba, 2005: 140, figs 58–60, 286 (key, synonymies, Tasman Sea, 3580 m and North Atlantic Ocean, 3506 m). — Martin & Haney, 2005: 478 (hydrothermal vents and cold seeps review). — Macpherson, 2007: 57 (NW Madagascar, 3700 m).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Baba, Keiji

Source: Squat Lobsters LIFEDESK

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Atlantic Ocean, from North Carolina (type locality) to the Bay of Biscay, Azores, Canary Islands, Middle Atlantic Bight, Caribbean Sea and off Namibia, between 2679 and 5315 m (Smith 1885, A. Milne-Edwards & Bouvier 1899, Bouvier 1922, Gordon 1955, Sivertsen & Holthuis 1956, Pequegnat & Pequegnat 1971, Turkay 1975, Wenner 1982, Macpherson & Segonzac 2005). Recently the species has been cited in the Tasman Sea, at 3580 m (Baba 2005).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Baba, Keiji

Source: Squat Lobsters LIFEDESK

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Type Information

Type for Munidopsis crassa Smith, 1885
Catalog Number: USNM 8563
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Sex/Stage: female;
Preparation: Alcohol (Ethanol)
Collector(s): United States Fish Commission
Year Collected: 1884
Locality: Georges Bank, South of, Massachusetts, United States, North Atlantic Ocean
Depth (m): 4707 to 4707
Vessel: Albatross R/V
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Depth range based on 41 specimens in 1 taxon.
Water temperature and chemistry ranges based on 34 samples.

Environmental ranges
  Depth range (m): 1830 - 5012
  Temperature range (°C): 0.368 - 4.386
  Nitrate (umol/L): 17.490 - 33.338
  Salinity (PPS): 34.700 - 34.982
  Oxygen (ml/l): 4.457 - 6.178
  Phosphate (umol/l): 1.182 - 2.394
  Silicate (umol/l): 13.912 - 130.485

Graphical representation

Depth range (m): 1830 - 5012

Temperature range (°C): 0.368 - 4.386

Nitrate (umol/L): 17.490 - 33.338

Salinity (PPS): 34.700 - 34.982

Oxygen (ml/l): 4.457 - 6.178

Phosphate (umol/l): 1.182 - 2.394

Silicate (umol/l): 13.912 - 130.485
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Munidopsis exuta

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

TGGTGACGACCA---------ATTTACAATGTAATTGTAACTGCTCACGCTTTTGTAATAATCTTTTTCATAGTAATACCAATTATAATTGGTGGATTTGGAAATTGACTAATCCCACTAATATTAGGAGCCCCTGATATAGCTTTCCCACGAATAAATAACATGAGATTTTGACTTCTACCCCCATCTCTTACACTCTTATTAATAAGTGGAATAGTGGAGAGAGGAGTAGGAACAGGATGAACCGTTTATCCCCCTTTAGCCTCCAGTATTGCCCACGCTGGGGCCTCAGTTGACATGGCAATTTTTTCTCTTCATTTAGCGGGAGTTTCTTCAATCTTAGGGTCAGTCAACTTCATAACAACCGTAATCAACATACGAGCTAAAGGTATAACACTAGACCGAGTCCCATTATTTATTTGAGCCGTATTTATTACTACCGTACTTTTACTCCTGTCTCTTCCGGTGCTAGCCGGAGCCATCACCATATTATTAACGGACCGTAACCTTAATACATCTTTCTTTGATCCG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Munidopsis exuta

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!