Overview

Comprehensive Description

Etymology

From the Latin exutus, bared, naked, in reference to the absence of spines (except epigastric spines) on the carapace and abdomen.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Macpherson, Enrique

Source: Squat Lobsters LIFEDESK

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type locality

Mid-Atlantic Ridge, vent site Snake Pit-Les-Ruches, 3502 m.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Macpherson, Enrique

Source: Squat Lobsters LIFEDESK

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Data

Holotype, ovigerous female, MNHN Ga 4621.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Macpherson, Enrique

Source: Squat Lobsters LIFEDESK

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Synonymy

Munidopsis exuta Macpherson & Segonzac, 2005: 22, fig. 5 (Bay of Biscay, Mid-Atlantic Ridge, 2860–3502 m). — Macpherson & Segonzac, 2006: 442, fig. (no record).
Munidopsis subsquamosa. — de Saint Laurent, 1985: 475 (Bay of Biscay, 2775–4260 m) (not Henderson, 1885).
Munidopsis crassa. — Segonzac, 1992: 596 (Mid-Atlantic Ridge) (not Smith, 1885).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Macpherson, Enrique

Source: Squat Lobsters LIFEDESK

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type locality

Off North Carolina, 36°16´30”N, 68°21´W, 4710 m.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Taylor, Joanne

Source: Squat Lobsters LIFEDESK

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Data

Holotype, fragments, ovigerous female, USNM 8563.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Baba, Keiji

Source: Squat Lobsters LIFEDESK

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Synonymy

Munidopsis crassa Smith, 1885: 494 (off North Carolina, 4710 m). — Smith, 1886: 645, pl. 4 (off Virginia, 4710 m). — A. Milne Edwards & Bouvier, 1894a: 275 (key). — A. Milne Edwards & Bouvier, 1899: 82 (NE of Azores, 4360 m). — Benedict, 1902: 276 (key), 318 (list). — Fowler, 1912: 574. — Doflein & Balss, 1913: 176 (list), 177 (table) — Bouvier, 1922: 47 (Bay of Biscay, 46°17´30N, 5°42´W, 4380 m). — Nobre, 1936: 117 (no record). — Chace, 1942: 73 (key). — Gordon, 1955: 239, figs 1A, 2A, 2A', 3A, pl. 1 (off Canary Islands (29°48´N, 17°39´W), 4255–4267 m). — Sivertsen & Holthuis, 1956: 46, pl. 4, fig. 1 (Bay of Biscay (45°26´N, 9°20´W), 4700 m). — Zariquiey Álvarez, 1968: 269, fig. 95b (compilation). — Miyake & Baba, 1970: 93 (list). — Pequegnat & Pequegnat, 1970: 93 (list). — Pequegnat & Pequegnat, 1971: 18 (Colombian Basin and Yucatan Basin, 4150–4554 m). — Türkay, 1975: 67, fig. 2 (Iberian deep sea (West Europe Basin), 5315 m). — Wenner, 1982: 367 (Middle Atlantic Bight, 2679 m). — Gore, 1983: 206 (Venezuelan Basin, 3934–5060 m). — de Saint Laurent, 1985: table 2 (Bay of Biscay, 3992– 4510 m). — Williams & Turner, 1986: 619 (Woods Hole, 3506 m, St Croix, 4000 m). — Segonzac, 1992: 596 (Snake Pit, Mid-Atlantic Ridge, 23°N, hydrothermal active site, 3480 m). — González Pérez, 1995: 161 (no record). — Chevaldonné & Olu, 1996: 290 (no record). — Olu et al., 1996: 115 (list of occurrences). — d'Udekem d'Acoz, 1999: 167 (compilation). — Tiefenbacher, 2001: 63 (West Europe Basin, 4635–4723 m). — Baba, 2005: 140, figs 58–60, 286 (key, synonymies, Tasman Sea, 3580 m and North Atlantic Ocean, 3506 m). — Martin & Haney, 2005: 478 (hydrothermal vents and cold seeps review). — Macpherson, 2007: 57 (NW Madagascar, 3700 m).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Baba, Keiji

Source: Squat Lobsters LIFEDESK

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

This species occurs in both abyssal (Gulf of Biscay, 2860 m) and hydrothermal vent environments (Mid-Atlantic Ridge: Snake Pit, Elan). It has been collected by baited trap together with a nephropid lobster Thymopides laurentae SEGONZAC & MACPHERSON, and a macrurid fish Coryphaenoides armatus (HECTOR), at the base of the active edifice, on sulphide rocks, among scattered sea anemones, chaetopterid tubeworms and alvinocaridid shrimps. The species has also been collected at the base of inactive chimney complex, among dead mytilid bivalves. An additional specimen (unfortunately lost) was collected during the cruise BRIDGE 1993 at the Mid-Atlantic Ridge hydrothermal vent site Broken Spur site (dive Alvin 2625, 27.06.1993, E. Southward, personal communication).
  • MACPHERSON E. & M. SEGONZAC (2005) Zootaxa 1095: 1-60.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Atlantic Ocean, from North Carolina (type locality) to the Bay of Biscay, Azores, Canary Islands, Middle Atlantic Bight, Caribbean Sea and off Namibia, between 2679 and 5315 m (Smith 1885, A. Milne-Edwards & Bouvier 1899, Bouvier 1922, Gordon 1955, Sivertsen & Holthuis 1956, Pequegnat & Pequegnat 1971, Turkay 1975, Wenner 1982, Macpherson & Segonzac 2005). Recently the species has been cited in the Tasman Sea, at 3580 m (Baba 2005).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Baba, Keiji

Source: Squat Lobsters LIFEDESK

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Mid-Atlantic Ridge: Snake Pit, TAG, probably Broken Spur, and Logatchev; Gulf of Biscay.
  • MACPHERSON E. & M. SEGONZAC (2005) Zootaxa 1095: 1-60.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Carapace with pair of epigastric spines, sometimes 2-3 additional small spines, covered by scale-like rugosities. Rostrum broad at base, distally narrowed and upturned, weakly carinated dorsally. Front margin oblique, antennal spine absent. Abdomen unarmed. Eyes not movable, cornea relatively large, clearly wider than eyespine. Chelipeds with several spines on merus and carpus, palm spineless, fixed finger moderately ridged along distal third of lateral margin. First walking leg slightly exceeding cheliped, dorsal crest of merus and carpus with row of spines along dorsal border; dactylus smoothly narrowed distally, flexor margin slightly curving, bearing low spines. Epipods on chelipeds, not on walking legs. The species was identified as M. subsquamosa by SAINT LAURENT (1985) and M. crassa by SEGONZAC (1992).
  • MACPHERSON E. & M. SEGONZAC (2005) Zootaxa 1095: 1-60.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Up to 39.5 mm carapace length.
  • MACPHERSON E. & M. SEGONZAC (2005) Zootaxa 1095: 1-60.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Type for Munidopsis crassa Smith, 1885
Catalog Number: USNM 8563
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Sex/Stage: female;
Preparation: Alcohol (Ethanol)
Collector(s): United States Fish Commission
Year Collected: 1884
Locality: Georges Bank, South of, Massachusetts, United States, North Atlantic Ocean
Depth (m): 4707 to 4707
Vessel: Albatross R/V
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Depth range based on 4 specimens in 1 taxon.
Water temperature and chemistry ranges based on 4 samples.

Environmental ranges
  Depth range (m): 3050 - 3650
  Temperature range (°C): 2.523 - 2.889
  Nitrate (umol/L): 21.028 - 22.153
  Salinity (PPS): 34.913 - 34.944
  Oxygen (ml/l): 5.657 - 5.742
  Phosphate (umol/l): 1.396 - 1.496
  Silicate (umol/l): 34.435 - 42.727

Graphical representation

Depth range (m): 3050 - 3650

Temperature range (°C): 2.523 - 2.889

Nitrate (umol/L): 21.028 - 22.153

Salinity (PPS): 34.913 - 34.944

Oxygen (ml/l): 5.657 - 5.742

Phosphate (umol/l): 1.396 - 1.496

Silicate (umol/l): 34.435 - 42.727
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 41 specimens in 1 taxon.
Water temperature and chemistry ranges based on 34 samples.

Environmental ranges
  Depth range (m): 1830 - 5012
  Temperature range (°C): 0.368 - 4.386
  Nitrate (umol/L): 17.490 - 33.338
  Salinity (PPS): 34.700 - 34.982
  Oxygen (ml/l): 4.457 - 6.178
  Phosphate (umol/l): 1.182 - 2.394
  Silicate (umol/l): 13.912 - 130.485

Graphical representation

Depth range (m): 1830 - 5012

Temperature range (°C): 0.368 - 4.386

Nitrate (umol/L): 17.490 - 33.338

Salinity (PPS): 34.700 - 34.982

Oxygen (ml/l): 4.457 - 6.178

Phosphate (umol/l): 1.182 - 2.394

Silicate (umol/l): 13.912 - 130.485
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Munidopsis exuta

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

TGGTGACGACCA---------ATTTACAATGTAATTGTAACTGCTCACGCTTTTGTAATAATCTTTTTCATAGTAATACCAATTATAATTGGTGGATTTGGAAATTGACTAATCCCACTAATATTAGGAGCCCCTGATATAGCTTTCCCACGAATAAATAACATGAGATTTTGACTTCTACCCCCATCTCTTACACTCTTATTAATAAGTGGAATAGTGGAGAGAGGAGTAGGAACAGGATGAACCGTTTATCCCCCTTTAGCCTCCAGTATTGCCCACGCTGGGGCCTCAGTTGACATGGCAATTTTTTCTCTTCATTTAGCGGGAGTTTCTTCAATCTTAGGGTCAGTCAACTTCATAACAACCGTAATCAACATACGAGCTAAAGGTATAACACTAGACCGAGTCCCATTATTTATTTGAGCCGTATTTATTACTACCGTACTTTTACTCCTGTCTCTTCCGGTGCTAGCCGGAGCCATCACCATATTATTAACGGACCGTAACCTTAATACATCTTTCTTTGATCCG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Munidopsis exuta

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!