Overview

Distribution

Common
  • Hayward, P.J.; Ryland, J.S. (Ed.) (1990). The marine fauna of the British Isles and North-West Europe: 1. Introduction and protozoans to arthropods. Clarendon Press: Oxford, UK. ISBN 0-19-857356-1. 627 pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Baffin Island to Long Island Sound and off New Jersey
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

intertidal, bathyal, infralittoral and circalittoral of the Gulf and estuary
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 165 specimens in 1 taxon.
Water temperature and chemistry ranges based on 64 samples.

Environmental ranges
  Depth range (m): 0 - 214
  Temperature range (°C): 6.281 - 12.631
  Nitrate (umol/L): 1.141 - 17.262
  Salinity (PPS): 6.559 - 34.748
  Oxygen (ml/l): 4.493 - 8.091
  Phosphate (umol/l): 0.314 - 1.270
  Silicate (umol/l): 2.377 - 13.978

Graphical representation

Depth range (m): 0 - 214

Temperature range (°C): 6.281 - 12.631

Nitrate (umol/L): 1.141 - 17.262

Salinity (PPS): 6.559 - 34.748

Oxygen (ml/l): 4.493 - 8.091

Phosphate (umol/l): 0.314 - 1.270

Silicate (umol/l): 2.377 - 13.978
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Calliopius laeviusculus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 29
Specimens with Barcodes: 37
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Calliopius laeviusculus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 29 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TACCTTGTACTTTATTTTGGGTGCCTGAGCCAGGGTGGTCGGCACTTCTTTAAGAGTTATTATCCGAACTGAGCTAAGTACTCCTGGTAATTTAATTGGCGACGACCAGGTTTACAACACTATGGTCACAGCCCACGCTTTCGTAATAATCTTCTTCATAGTAATACCAATCATAATTGGTGGTTTCGGTAATTGACTTGTCCCGCTGATGTTGGGGAGACCTGACATGGCCTTCCCCCGTATAAATAACATGAGATTCTGGTTACTTCCTCCCTCACTTACATTCCTGCTCGTTAGTGGCTTAATTGAAAGTGGTGTCGGCACTGGCTGAACTGTTTACCCCCCATTATCCGCAGCTGCAGCTCACAGTGGTAGTTCAGTTGATGTGGCTATCTTCTCTCTTCATTTGGCCGGGGCCTCTTCTATCCTAGGCGCTATTAATTTTATCTCCACTGTTATTAACATGCGAGCGCCTAGTATATTCATAGACCGCATGCCTTTATTTGTGTGGTCTGTCTTTATCACTGCTATTTTACTGCTTCTATCTTTACCTGTGCTAGCTGGCGCTATTACCATGCTACTTACTGATCGAAACCTAAACACATCCTTCTTCGACCCTAGAGGCGGAGGAGATCCTATCCTTTATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!