Penaeus monodon — Details

Tiger Prawn, Giant Tiger Prawn, Black Tiger Shrimp (german: Großgarnele) learn more about names for this taxon

Overview

Distribution

Giant tiger prawns are native to the coasts of the Arabian peninsula and the Pacific and Indian Ocean coasts of Australia, Indonesia, south and southeast Asia, and South Africa. They were accidentally introduced to the United States off the coast of South Carolina in 1988, by an unexpected release from an aquaculture center. They had spread as far south as Florida's coastline by 1990 and, since 2006, have been found in the Gulf of Mexico; they are found along the coastlines of Alabama, Florida, Georgia, Louisiana, Mississippi, North Carolina, South Carolina and Texas.

Biogeographic Regions: nearctic (Introduced ); palearctic (Native ); oriental (Native ); ethiopian (Native ); australian (Native ); indian ocean (Native ); atlantic ocean (Introduced ); pacific ocean (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Giant tiger prawns have a typical prawn body plan including a head, tail, five pairs of swimming legs (pleopods) and five pairs of walking legs (pereopods), as well as numerous head appendages. A carapace (hard exoskeleton) encloses the cephalothorax. Their heads have a rostrum (an extension of the carapace in front of the eyes) and six to eight dorsal teeth, as well as two to four sigmoidally-shaped ventral teeth. A posterior ridge called the adrostral carina extends from the rostrum to the edge of the epigastric spine, which reaches to the posterior end of the carapace. Their first three pairs of pereopods have claws and they are distinguished from other shrimp species by the lack of an exopod (an external branch) on their fifth pleopodia. The telson at the posterior end of the prawn is unarmed, with no spines.

Giant tiger prawns are identified by distinct black and white stripes on their backs and tails; on their abdomens, these stripes alternate black/yellow or blue/yellow. Base body color varies from green, brown, red, grey, or blue. These prawns are very large, reaching 330 mm or greater in length (largest individual found at 336 mm total length) and are sexually dimorphic, with females are larger than males. At sexual maturity, female carapace lengths range from 47-164 mm and their total lengths from 164-190 mm, while male carapace lengths fall between 37 and 71 mm, with total lengths of up to 134 mm. On average, females weigh 200-320 g and males weigh 100-170 g.

Females have a sperm receptacle (thyelycum) located ventrally on the last thoracic segment. After mating, sperm remain in this receptacle until eggs are released. Females have a pair of internal fused ovaries that extend almost the entire length of their bodies, from the cardiac region of the stomach to the anterior portion of the telson. Males have a copulatory organ (petasma, formed by the longitudinally folded endopods of the first pair of pleopods. The presence of an appendix masculina (an oval flap on the second pleopod) can distinguish males from females. Testes are unpigmented/translucent and are found dorsal to the hepatopancreas under the carapace. The vas deferens is also internal, and arises from the posterior margins of the main axis of the testes. Sperm are released through genital pores on the fifth pereopod.

Range mass: 100 to 320 g.

Range length: 37 to 174 mm.

Other Physical Features: ectothermic ; bilateral symmetry

Sexual Dimorphism: female larger

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Young giant tiger prawns are most commonly found in estuaries, lagoons and mangroves; they are very tolerant to a range of salinity levels from 2-30 ppt. Adults move into deeper waters and live on rocky or muddy bottoms, ranging in depth from 0-110 m (most commonly at 20-50 m). These shrimps may bury themselves in the substrate during the day, emerging to feed at night. They live in waters ranging from 28-33°C and are unlikely to survive in waters colder than 13°C.

Range depth: 0 to 110 m.

Habitat Regions: temperate ; tropical ; saltwater or marine

Aquatic Biomes: benthic ; coastal ; brackish water

Other Habitat Features: estuarine ; intertidal or littoral

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 10 specimens in 1 taxon.
Water temperature and chemistry ranges based on 2 samples.

Environmental ranges
  Depth range (m): 0.5 - 37.7025
  Temperature range (°C): 28.027 - 28.784
  Nitrate (umol/L): 0.049 - 0.195
  Salinity (PPS): 31.018 - 31.457
  Oxygen (ml/l): 4.168 - 4.658
  Phosphate (umol/l): 0.078 - 0.081
  Silicate (umol/l): 6.118 - 8.443

Graphical representation

Depth range (m): 0.5 - 37.7025

Temperature range (°C): 28.027 - 28.784

Nitrate (umol/L): 0.049 - 0.195

Salinity (PPS): 31.018 - 31.457

Oxygen (ml/l): 4.168 - 4.658

Phosphate (umol/l): 0.078 - 0.081

Silicate (umol/l): 6.118 - 8.443
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

In their first larval stage, giant tiger prawns feed on their yolk reserves. Later larval stages filter feed on plankton, diatoms, and other small organisms in the water column before becoming benthic feeders with a diet composed of organisms such as polycheate worms (Sabellaridae, Spionidae, Unicidae), as well as detritus. In the wild, adult giant tiger prawns feed on mollusks (including squid, blood clams (Arca sp.) and oysters), small crustaceans (including isopods, crabs and their eggs, and young penaeid prawns, including their own species). In aquaculture, these prawns feed on artificial diets consisting mainly of fishmeal; it has been noted that individuals grow more quickly when fed this diet.

Animal Foods: fish; eggs; carrion ; mollusks; aquatic or marine worms; aquatic crustaceans; other marine invertebrates

Plant Foods: phytoplankton

Other Foods: detritus

Foraging Behavior: filter-feeding

Primary Diet: carnivore (Eats non-insect arthropods, Molluscivore , Vermivore, Scavenger ); omnivore ; planktivore ; detritivore

  • Abu Hena, M., O. Hishamuddin. 2012. Food selection preference of different ages and sizes of black tiger shrimp, Penaeus monodon Fabricius, in tropical aquaculture ponds in Malaysia. African Journal of Biotechnology, 11/22: 6153-6159. Accessed January 30, 2013 at http://www.academicjournals.org/ajb/PDF/pdf2012/15Mar/Abu%20Hena%20and%20Hishamuddin.pdf.
  • Thomas, M. 1972. FOOD AND FEEDING HABITS OF PENAEUS MONODON FABRICIUS FROM KORAPUZHA ESTUARY. Indian Journal of Fisheries, Volume 19. Issue 1&2: 202-204.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Giant tiger prawns are detritivores and consumers of small invertebrates. They also are prey for many species of fishes and invertebrates.

Giant tiger prawns are a host for a variety of viruses, all of which are extremely contagious within populations and cause high mortality rates. The Yellowhead virus, originally isolated from this species, causes the hepatopancreas and cephalothorax to become discoloured and swollen. WSSV (White Spot Syndrome Virus) causes white spot disease, symptoms of which include lesions and white deposits on the skin and connective tissue. There are two types of Baculovirus infections commonly seen in these prawns: Baculoviral Midgut Gland Necrosis, which affects mainly larvae, and Monodon baculovirus disease, which is typically followed by secondary bacterial infections. These diseases are of particular concern in aquaculture environments and in areas where this species has been introduced.

Giant tiger prawns are also host to a number of protozoan ectoparasites and endoparasites. Their ectoparasites attach themselves to the gills and limbs, potentially interfering with breathing and motility, while their endoparasites live in the gut and can affect nutrient absorption. This species is also known to host of a number of fungal microsporidians.

Commensal/Parasitic Species:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Throughout their lifetimes, giant tiger prawns face a variety of predators, including birds, comb jellies, crustaceans, and fishes. When adult prawns move from shallow inshore areas to deeper water, their rate of mortality drops.

Giant tiger prawns have developed a variety of defenses to protect themselves from predation. Prawns have spines on either end of their body (a rostrum above the mouth, and a telson located at the dorsal end of the body). Their distinctive stripes and body color, which is similar to their muddy environment, help to camouflage them from predators. These prawns also bury themselves in substrate, not only hiding their bodies but also masking their waste, which would otherwise likely be detected by potential fish predators' chemosensory systems.

Known Predators:

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Giant tiger prawns have eyestalks on their heads which enable them to detect predators and search out prey. The eyes are called ommatidia, and are composed of clusters of photoreceptors. Since giant tiger prawns are nocturnal, they must have very good vision at night to detect predators and prey, but can also see well in daylight. Eyestalks have the ability to change their optical properties based on light-dark adaptations. In dark light, eyestalks receive light from a wide angle and create a superposition image, formed by mirrors in the sides of the cornea instead of by lenses. This superposition image is very effective at detecting movement. In bright light, eyestalks have the ability to see almost 360 degrees and form apposition images, a more efficient detector of light than superposition images. Molting Inhibition Hormone (MIH), which controls the molting cycle, is produced in the eyestalks; a recent study showed that when eyestalks are ablated, molting is accelerated. It is also known that ablating eyestalks in this species induces ovulation and jeopardizes growth. Giant tiger prawns also have flagellae on their antennae, which detect predators and prey through vibrations. These flagellae also have chemosensors, which detect amino acids and differences in pH, salinity and food stimulants.

Communication Channels: visual ; tactile ; chemical

Other Communication Modes: vibrations

Perception Channels: visual ; tactile ; vibrations ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

Eggs begin development by slowly sinking to the bottom of outer littoral areas. Giant tiger prawns develop through a complex life cycle beginning with three larval stages. Naupilii hatch twelve to fifteen hours after spawning is completed and look like tiny spiders. Larvae at this stage do not feed, instead surviving on their yolks as they are carried by tidal currents from open ocean towards shore. Naupilii larvae pass through six quick molts, increasing their body size. Individuals in the next larval stage, called protozoea, are identified by increased body size and length, the appearance of feathery appendages and, though still planktonic, beginning to feed. After molting three more times, protozoea proceed into the mysis larval stage. At this stage, they begin to have characteristics of adult prawns including segmented bodies, eye stalks, and tails. Mysis larvae molt three more times, becoming postlarvae. At this point in the life cycle, they change from planktonic to benthic feeding. This entire process takes two to three weeks. Prawns continue to molt through a juvenile phase, lasting 1-6 months. Juveniles and adults are distinguished mainly by location and carapace length. Carapace lengths of juveniles range from 2.2-11 mm and they are found mainly in estuarine areas located at the mouth or middle of bays and mangroves while adults are found in outer littoral areas of full salinity, and have carapace lengths ranging from 37-81 mm.

Development - Life Cycle: metamorphosis

  • Motoh, H. 1981. Studies on the fisheries biology of the giant tigen prawn, Penaeus monodon in the Philippines. Tigbauan, Philippines: Aquaculture Dept., Southeast Asian Fisheries Development Center.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

The lifespan for wild and captive giant tiger prawns is about 2 years, though it has been suggested that individuals introduced into the Gulf of Mexico have a lifespan closer to 3 years.

Typical lifespan

Status: wild:
2 to 3 years.

Average lifespan

Status: captivity:
2 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Giant tiger prawns are known to mate prior to ovarian maturation; females store sperm in sacs within their closed thelycum until eggs are fully mature. Although little is known regarding specific mating behaviors, it has been noted that this species mates nocturnally, in off-shore waters, shortly after females have molted and their carapaces are still soft (males typically still have hard carapaces during breeding). Copulation begins with a male swimming parallel to a female. The male bends his body and first pair of pleopods with the petasma (caught by the appendix masculina) stretched vertically down, in order to facilitate the forward swinging of the second pair of pleopods. The first pair of pleopods pulls apart the petasmal halves, preventing the loss of sperm during copulation. The pair then takes an abdomen-to-abdomen position. The female exerts pressure on the male's petasma using her 4th pair of pereiopods and a spermatophore (sac of sperm) is thrust into her thyelycum, after which the pair separate. A majority of adult individuals copulate more than once; females are known to spawn 4 times during their lives, at carapace lengths of 50, 62, 66, and 72 mm.

Mating System: polygynandrous (promiscuous)

It is difficult to estimate age at sexual maturity, but males become mature upon reaching an average carapace size of 37 mm, females at 47 mm. Females can produce 248,000-810,000 eggs at a time and are known to spawn up to four times during their lifespan. Once eggs are mature, they are expelled in a greenish-white cloud, along with stored spermatophores, into the ocean where external fertilization occurs. Eggs range in size from 0.27-0.31 mm.

Breeding interval: Females spawn 4 times during their lifespan at carapace lengths of 50, 62, 66, and 72 mm. It is unknown how many times males mate.

Breeding season: This species breeds year round.

Range number of offspring: 248,000 to 810,000.

Range gestation period: 12 to 15 hours.

Key Reproductive Features: iteroparous ; year-round breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (External ); broadcast (group) spawning; oviparous ; sperm-storing ; delayed fertilization

Males exhibit no parental involvement after mating. Females invest by yolking and protecting eggs while they are still in their bodies. They exhibit no further parental involvement once eggs and sperm have been released.

Parental Investment: female parental care ; pre-fertilization (Provisioning, Protecting: Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Penaeus monodon

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACGCAACGATGATTATTTTCTACAAATCATAAAGACATCGGAACTCTATATTTTATTTTCGGAGCTTGAGCTGGAATAGTAGGTACAGCCCTTAGTCTTATTATTCGTGCTGAATTAGGTCAACCAGGAAGCCTTATTGGAGATGACCAAATTTACAATGTAGTAGTTACAGCTCACGCTTTCGTTATAATTTTCTTTATAGTTATGCCTATTATAATTGGAGGTTTCGGGAATTGGCTTGTCCCTTTAATGTTAGGTGCTCCAGATATGGCATTTCCCCGAATAAATAATATAAGTTTCTGACTTTTACCCCCTTCGCTAACTTTACTTTTATCTAGAGGTATAGTCGAAAGAGGAGTGGGAACTGGATGAACAGTATACCCTCCTTTATCAGCCAGAATTGCTCACGCAGGTGCTTCAGTTGATCTAGGTATTTTTTCATTACATTTAGCAGGGGTCTCATCAATCTTAGGAGCTGTAAACTTTATAACGACCGTTATCAATATACGATCTACAGGGATAACTATAGACCGAATACCACTTTTTGTTTGAGCAGTATTTATTACAGCTCTACTCCTACTGTTATCTTTACCAGTCCTAGCAGGAGCTATTACTATACTATTAACAGATCGTAATTTAAATACATCCTTCTTTGATCCAGCAGGAGGTGGTGACCCAGTCTTATATCAACATTTATTTTGATTTTTCGGTCATCCTGAAGTATATATTTTAATTCTTCCTGCCTTTGGGATAATCTCACATATTATTAGTCAAGAATCTGGTAAAAAAGAAGCTTTTGGAACATTAGGAATAATCTATGCTATACTAGCCATTGGTGTTCTAGGATTTGTAGTATGAGCTCATCATATATTTACTGTAGGTATAGACGTTGATACTCGTGCTTACTTTACATCTGCTACGATAATTATTGCTGTCCCGACGGGTATTAAGATCTTCAGCTGACTAGGAACATTACACGGTACTCAATTGAATTATAGTCCTTCTTTAATTTGGGCATTAGGGTTTGTATTTTTATTTACAGTTGGGGGTCTAACAGGAGTTGTCCTTGCTAATTCATCTATTGATATTATCTTGCACGATACTTATTATGTAGTAGCCCACTTCCACTATGTTCTTTCAATAGGAGCCGTATTTGGTATTTTTGCAGGTATTGCCCACTGATTTCCTCTTTTTACCGGTTTAACCCTGAACCCAAAATGATTAAAAATCCACTTTCTAGTTATATTTATTGGGGTAAACATTACATTTTTCCCTCAACATTTTTTAGGGCTTAATGGTATACCTCGACGCTATTCAGATTATCCAGACGCCTACACAGCATGAAATGTTATATCATCTATTGGATCTACAGTATCATTAATTGCAGTACTAGGTTTTGTTATAATTGTATGAGAAGCCTTAACTGTAGCTCGGCCAGTTATATTTTCTTTATTTTTACCTACTTCGATTGAATGACAACATAATCTCCCACCCGCAGATCATAGTTATATAGAAATTCCTTTAATTACTAATTTCTAA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Penaeus monodon

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 113
Specimens with Barcodes: 125
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

This species has no special conservation status.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

  • 2013. "Penaeus monodon Fabricius, 1798" (On-line). IUCN Red List of Threatened Species. Accessed January 30, 2013 at http://www.iucnredlist.org/search.
  • IUCN, 2012. "The IUCN Red List of Threatened Species" (On-line). Accessed February 04, 2013 at www.iucnredlist.org.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

This species is invasive in waters around the United States. Diseases carried by giant tiger prawns are highly contagious and can infect native shrimp populations, harming local fishing industries.

It has been estimated that up to 38% of native mangrove forests in Asia have been destroyed to be converted into ponds for shrimp farming, triggering erosion and harming habitat for mollusks and many other species, including shorebirds. Farming pools are sprayed with many chemicals and antibiotics to maximize shrimp production and these chemicals can enter natural waterways, harming animals and humans alike. These pools are often abandoned after a few years and there is typically no effort to return these lands to their original conditions.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Farming of Giant tiger prawns constitutes 47% of total world shrimp production giving it significant economic importance, particularly in Asian countries. With a high demand in Asian and international markets, building and running farms to produce these shrimp can be highly profitable and create many jobs.

Positive Impacts: food

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Penaeus monodon

Penaeus monodon, the giant tiger prawn[1][2] or Asian tiger shrimp[3][4] (and also known by other common names), is a marine crustacean that is widely reared for food.

Distribution[edit]

Its natural distribution is the Indo-Pacific, ranging from the eastern coast of Africa and the Arabian Peninsula, as far as Southeast Asia, the Sea of Japan, and northern Australia.[5]

It is an invasive species in the northern waters of the Gulf of Mexico.[4]

Description[edit]

Females can reach approximately 33 centimetres (13 in) long, but are typically 25–30 cm (10–12 in) long and weight 200–320 grams (7–11 oz); males are slightly smaller at 20–25 cm (8–10 in) long and weighing 100–170 g (3.5–6.0 oz).[1]

Aquaculture[edit]

Penaeus monodon is the second most widely cultured prawn species in the world, after only whiteleg shrimp, Litopenaeus vannamei.[1] In 2009, 770,000 tonnes were produced, with a total value of US$3,650,000,000.[1]

Sustainable consumption[edit]

In 2010, Greenpeace added Penaeus monodon to its seafood red list – "a list of fish that are commonly sold in supermarkets around the world, and which have a very high risk of being sourced from unsustainable fisheries".[6] The reasons given by Greenpeace were "destruction of vast areas of mangroves in several countries, over-fishing of juvenile shrimp from the wild to supply farms, and significant human rights abuses".[6]

Taxonomy[edit]

Penaeus monodon was first described by Johan Christian Fabricius in 1798. That name was overlooked for a long time, however, until 1949, when Lipke Holthuis clarified which species it referred to.[7] Holthuis also showed that P. monodon had to be the type species of the genus Penaeus.[7]

References[edit]

  1. ^ a b c d e "Species Fact Sheets: Penaeus monodon (Fabricius, 1798)". FAO Species Identification and Data Programme (SIDP). FAO. Retrieved January 10, 2010. 
  2. ^ "Giant Tiger Prawn". Sea Grant Extension Project. Louisiana State University. Retrieved 2013-09-24. 
  3. ^ "Penaeus monodon". Nonindigenous Aquatic Species. United States Geological Survey. 2013-06-14. Retrieved 2013-09-24. 
  4. ^ a b Tresaugue, Matthew (2011-12-24). "Giant shrimp raises big concern as it invades the Gulf". Houston Chronicle. Retrieved 2013-09-24. 
  5. ^ L. B. Holthuis (1980). "Penaeus (Penaeus) monodon". Shrimps and Prawns of the World. An Annotated Catalogue of Species of Interest to Fisheries. FAO Species Catalogue 1. Food and Agriculture Organization. p. 50. ISBN 92-5-100896-5. 
  6. ^ a b "Greenpeace International Seafood Red list". Greenpeace. Retrieved February 16, 2010. 
  7. ^ a b L. B. Holthuis (1949). "The identity of Penaeus monodon Fabr." (PDF). Proceedings of the Koninklijke Nederlandse Akadademie van Wetenschappen 52 (9): 1051–1057. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!