Penaeus monodon — Details

Tiger Prawn, Giant Tiger Prawn, Black Tiger Shrimp (german: Großgarnele) learn more about names for this taxon

Ecology

Habitat

Depth range based on 10 specimens in 1 taxon.
Water temperature and chemistry ranges based on 2 samples.

Environmental ranges
  Depth range (m): 0.5 - 37.7025
  Temperature range (°C): 28.027 - 28.784
  Nitrate (umol/L): 0.049 - 0.195
  Salinity (PPS): 31.018 - 31.457
  Oxygen (ml/l): 4.168 - 4.658
  Phosphate (umol/l): 0.078 - 0.081
  Silicate (umol/l): 6.118 - 8.443

Graphical representation

Depth range (m): 0.5 - 37.7025

Temperature range (°C): 28.027 - 28.784

Nitrate (umol/L): 0.049 - 0.195

Salinity (PPS): 31.018 - 31.457

Oxygen (ml/l): 4.168 - 4.658

Phosphate (umol/l): 0.078 - 0.081

Silicate (umol/l): 6.118 - 8.443
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Penaeus monodon

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 113
Specimens with Barcodes: 125
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Penaeus monodon

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACGCAACGATGATTATTTTCTACAAATCATAAAGACATCGGAACTCTATATTTTATTTTCGGAGCTTGAGCTGGAATAGTAGGTACAGCCCTTAGTCTTATTATTCGTGCTGAATTAGGTCAACCAGGAAGCCTTATTGGAGATGACCAAATTTACAATGTAGTAGTTACAGCTCACGCTTTCGTTATAATTTTCTTTATAGTTATGCCTATTATAATTGGAGGTTTCGGGAATTGGCTTGTCCCTTTAATGTTAGGTGCTCCAGATATGGCATTTCCCCGAATAAATAATATAAGTTTCTGACTTTTACCCCCTTCGCTAACTTTACTTTTATCTAGAGGTATAGTCGAAAGAGGAGTGGGAACTGGATGAACAGTATACCCTCCTTTATCAGCCAGAATTGCTCACGCAGGTGCTTCAGTTGATCTAGGTATTTTTTCATTACATTTAGCAGGGGTCTCATCAATCTTAGGAGCTGTAAACTTTATAACGACCGTTATCAATATACGATCTACAGGGATAACTATAGACCGAATACCACTTTTTGTTTGAGCAGTATTTATTACAGCTCTACTCCTACTGTTATCTTTACCAGTCCTAGCAGGAGCTATTACTATACTATTAACAGATCGTAATTTAAATACATCCTTCTTTGATCCAGCAGGAGGTGGTGACCCAGTCTTATATCAACATTTATTTTGATTTTTCGGTCATCCTGAAGTATATATTTTAATTCTTCCTGCCTTTGGGATAATCTCACATATTATTAGTCAAGAATCTGGTAAAAAAGAAGCTTTTGGAACATTAGGAATAATCTATGCTATACTAGCCATTGGTGTTCTAGGATTTGTAGTATGAGCTCATCATATATTTACTGTAGGTATAGACGTTGATACTCGTGCTTACTTTACATCTGCTACGATAATTATTGCTGTCCCGACGGGTATTAAGATCTTCAGCTGACTAGGAACATTACACGGTACTCAATTGAATTATAGTCCTTCTTTAATTTGGGCATTAGGGTTTGTATTTTTATTTACAGTTGGGGGTCTAACAGGAGTTGTCCTTGCTAATTCATCTATTGATATTATCTTGCACGATACTTATTATGTAGTAGCCCACTTCCACTATGTTCTTTCAATAGGAGCCGTATTTGGTATTTTTGCAGGTATTGCCCACTGATTTCCTCTTTTTACCGGTTTAACCCTGAACCCAAAATGATTAAAAATCCACTTTCTAGTTATATTTATTGGGGTAAACATTACATTTTTCCCTCAACATTTTTTAGGGCTTAATGGTATACCTCGACGCTATTCAGATTATCCAGACGCCTACACAGCATGAAATGTTATATCATCTATTGGATCTACAGTATCATTAATTGCAGTACTAGGTTTTGTTATAATTGTATGAGAAGCCTTAACTGTAGCTCGGCCAGTTATATTTTCTTTATTTTTACCTACTTCGATTGAATGACAACATAATCTCCCACCCGCAGATCATAGTTATATAGAAATTCCTTTAATTACTAATTTCTAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Penaeus monodon

Penaeus monodon, the giant tiger prawn[1][2] or Asian tiger shrimp[3][4] (and also known by other common names), is a marine crustacean that is widely reared for food.

Distribution[edit]

Its natural distribution is the Indo-Pacific, ranging from the eastern coast of Africa and the Arabian Peninsula, as far as Southeast Asia, the Sea of Japan, and northern Australia.[5]

It is an invasive species in the northern waters of the Gulf of Mexico.[4]

Description[edit]

Females can reach approximately 33 centimetres (13 in) long, but are typically 25–30 cm (10–12 in) long and weight 200–320 grams (7–11 oz); males are slightly smaller at 20–25 cm (8–10 in) long and weighing 100–170 g (3.5–6.0 oz).[1]

Aquaculture[edit]

Penaeus monodon is the second most widely cultured prawn species in the world, after only whiteleg shrimp, Litopenaeus vannamei.[1] In 2009, 770,000 tonnes were produced, with a total value of US$3,650,000,000.[1]

Sustainable consumption[edit]

In 2010, Greenpeace added Penaeus monodon to its seafood red list – "a list of fish that are commonly sold in supermarkets around the world, and which have a very high risk of being sourced from unsustainable fisheries".[6] The reasons given by Greenpeace were "destruction of vast areas of mangroves in several countries, over-fishing of juvenile shrimp from the wild to supply farms, and significant human rights abuses".[6]

Taxonomy[edit]

Penaeus monodon was first described by Johan Christian Fabricius in 1798. That name was overlooked for a long time, however, until 1949, when Lipke Holthuis clarified which species it referred to.[7] Holthuis also showed that P. monodon had to be the type species of the genus Penaeus.[7]

References[edit]

  1. ^ a b c d e "Species Fact Sheets: Penaeus monodon (Fabricius, 1798)". FAO Species Identification and Data Programme (SIDP). FAO. Retrieved January 10, 2010. 
  2. ^ "Giant Tiger Prawn". Sea Grant Extension Project. Louisiana State University. Retrieved 2013-09-24. 
  3. ^ "Penaeus monodon". Nonindigenous Aquatic Species. United States Geological Survey. 2013-06-14. Retrieved 2013-09-24. 
  4. ^ a b Tresaugue, Matthew (2011-12-24). "Giant shrimp raises big concern as it invades the Gulf". Houston Chronicle. Retrieved 2013-09-24. 
  5. ^ L. B. Holthuis (1980). "Penaeus (Penaeus) monodon". Shrimps and Prawns of the World. An Annotated Catalogue of Species of Interest to Fisheries. FAO Species Catalogue 1. Food and Agriculture Organization. p. 50. ISBN 92-5-100896-5. 
  6. ^ a b "Greenpeace International Seafood Red list". Greenpeace. Retrieved February 16, 2010. 
  7. ^ a b L. B. Holthuis (1949). "The identity of Penaeus monodon Fabr." (PDF). Proceedings of the Koninklijke Nederlandse Akadademie van Wetenschappen 52 (9): 1051–1057. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!