Overview

Comprehensive Description

Etymology

The specific epithet “anchietae” refers to the Portuguese naturalist José Alberto de Oliveira Anchieta, who sent several specimens of this species to Bocage who first described it.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Dietterich, Lee

Source: African Amphibians Lifedesk

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Summary

Ptychadena anchietae is a medium-sized frog (snout-vent length approximately 5 cm) with a pointed nose and a characteristic color pattern with black mask-like stripes present on the face, dark spots on the flanks and a brown and yellow marbled pattern on the backs of the thighs. The back is grayish olive brown, and the underside is white or yellowish white. It is found in a variety of habitats, including forest, savanna, shrubland, wetland, desert, and pond ecosystems.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Dietterich, Lee

Source: African Amphibians Lifedesk

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

This species ranges from Eritrea, Ethiopia, Djibouti and Somalia, south through East Africa to South Africa and Botswana, and west to Angola and southern Congo. It occurs up to 1,800m asl in Ethiopia. There do not appear to be confirmed records from Burundi and Rwanda, though it is likely to occur in these countries and they are included in the species' distribution on the map.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

This species ranges from Eritrea, Ethiopia, Djibouti and Somalia, south through East Africa to South Africa and Botswana, and west to Angola and southern Republic of the Congo. There do not appear to be confirmed records from Burundi and Rwanda, though it is likely to occur in these countries (Poynton et al., 2004).

P. anchietae occurs in savanna habitat in all sub-Saharan countries from Angola to Ethiopia in the north, southward to eastern Namibia (Caprivi), eastern Botswana, Zimbabwe and Mozambique (Poynton and Broadley 1985b). This species is found in South Africa, Lesotho, and Swaziland (Text from Minter et al., 2004, © SI/MAB Biodiversity Program).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Dietterich, Lee; Minter, L.R. ; Passmore, N.I.

Source: African Amphibians Lifedesk

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

The following is the original description by Bocage (1868).

The head is wide, with a long pointed snout. The nostrils are slightly closer to the tip of the snout than to the eye. The tympanum has almost 2/3 the diameter of the eye. There are two small series of vomerine teeth, situated precisely in front of the hind openings of the nostrils and separated by a substantial interval. On the forelimbs, the second and fourth digits are equal in length, with the third the largest. The toes are webbed up to the base of the last phalange, except on the fourth toe where the last two phalanges are free. The metatarsal bears a single tubercle on its internal edge. Four narrow and distinctly granular longitudinal folds of skin are present on each side of the back. The top of the head and the space between the dorsal folds are dotted with small tubercles; larger confluent tubercles cover the flanks, the cloacal area, and the posterior half of the underside of the thigh. The skin is smooth ventrally with no trace of granulations or pores.

The dorsal regions are grayish or olive in color, marbled or spotted more or less distinctly with brown. Darker brown transversal bands mark the external sides of the limbs. A small blackish line extends from the tip of the snout to the eye via the nostril; an elongated spot of the same color extends from the eye to the shoulder via the dorsal side of the tympanum. The posterior side of the thighs is reddish brown to chocolate brown, with small, round yellow spots or narrow, wavy yellow stripes. Ventral parts are white or yellowish-white. On some individuals, the undersides of the thighs are bright yellow.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Dietterich, Lee

Source: African Amphibians Lifedesk

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Males are up to 51 mm in snout-vent length, and females are up to 62 mm (Harper et al., 2010). A male from the type series had a snout-vent length of 48 mm, with the forelimb 28 mm long and the hindlimb 86 mm (Bocage, 1868).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Dietterich, Lee

Source: African Amphibians Lifedesk

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

This is a medium-sized frog with long legs. The dorsum is uniform brown with around 7 rows of parallel
ridges. Some individuals have darker blotches scattered over the dorsum. Middorsal and tibial stripes are never present. A distinct pale triangle covers the area of the snout in front of the eyes. The tympanum is clearly visible and edged in white. The toes are nearly fully webbed, with only the tip of the fourth toe free of webbing (Text from Harper et al., 2010).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Dietterich, Lee; Bergmann, Travis

Source: African Amphibians Lifedesk

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Look Alikes

Comparisons

P. anchiete can be distinguished from other members of the genus by the pale triangle on the snout, horizontal stripes on the backs of the thighs, and extensive toe webbing with only the last joint of the longest toe free of webbing (Text from Harper et al., 2010).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Dietterich, Lee

Source: African Amphibians Lifedesk

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Southern Africa Bushveld

Garman's toad (Amietophrynus garmani) is found in the Southern African bushveld, among other ecoregions. The Southern Africa bushveld is an element of the vast savannas that cover much of southern Africa. There is low endemism in this ecoregion for both flora or fauna, but the charismatic large mammals and rich birdlife characteristic of African savannas are in evidence. The rugged Waterberg Mountains contain the highest levels of species richness and endemism in the region, and are noted for their reptilian endemism. The ecoregion occurs on an extensive, undulating interior plateau, which lies at an elevation between 700 metres (m) to 1100 m. The soils of this plateau are chiefly coarse, sandy and shallow, overlying granite, quartzite, sandstone or shale. The most distinctive topographical feature of the ecoregion is the rugged and rocky Waterberg Mountains, which rise up from the plateau to an elevation of between 1200 m to 1500 m.http://www.eoearth.org/view/article/51cbeeed7896bb431f69b38d/554565bb0cf24df5070a17ee/?topic=51cbfc79f702fc2ba8129ee0

The ecoregion amphibian associates of the Southern African bushveld are: Savanna ridged frog (Ptychadena anchietae); Angola frog (Rana angolensis); African gray treefrog (Chiromantis xerampelina); Senegal running frog (Kassina senegalensis); Striped stream frog (Strongylopus fasciatus); African clawed frog (Xenopus laevis); African split-skin toad (Schismaderma carens); Uzungwe grassland frog (Ptychadena uzungwensis); African ornate frog (Hildebrandtia ornata); Mababe river frog (Phrynobatrachus mababiensis); Marbled sand frog (Tomopterna marmorata); Marbled snout burrower (Hemisus marmoratus); Knocking sand frog (Tomopterna krugerensis), which is found broadly in southern Africa; and the Transvaal short-headed frog (Breviceps adspersus); Mozambique ridged frog (Ptychadena mossambica); Lukula grassland frog (Ptychadena taenioscelis); Horseshoe forest treefrog (Leptopelis bocagii); South African snake-necked frog (Phrynomantis bifasciatus); Boettger's dainty frog (Cacosternum boettgeri); Natal ghost frog (Heleophryne natalensis); Cryptic sandfrog (Tomopterna cryptotis); Mozambique rain frog (Breviceps mossambicus); Long reed frog (Hyperolius nasutus); Muller's clawed frog (Xenopus muelleri); Common reed frog (Hyperolius viridiflavus); Gray's stream frog (Strongylopus grayii); Natal puddle frog (Phrynobatrachus natalensis); Painted  reed frog (Hyperolius marmoratus); Garman's toad (Amietophrynus garmani); Gutteral toad (Amietophrynus gutturalis); Transvaal dwarf toad (Poyntonophrynus fenoulheti);  and the Flat-back toad (Amietophrynus maculatus).

Example reptilian associates within this ecoregion are: Bibron's worm snake (Typhlops bibronii); Vine snake (Thelotornis capensis); Black mamba (Dendroaspis polylepis); Angola garter snake (Elapsoidea semiannulata); Annobon lidless skink (Panaspis annobonensis); Bark snake (Hemirhagerrhis nototaenia); Bell's hingeback tortoise (Kinixys belliana); Blue throated agama (Acanthocercus atricollis); Blunt-tailed worm lizard (Dalophia pistillum); Bradfield's dwarf gecko (Lygodactylus bradfieldi); the endemic gecko Broadley's rock gecko (Afroedura broadleyi); and the endemic lizards Platysaurus minor and Platysaurus monotropis.

Some of the many mammalian taxa found within the Southern African bushveld are: Burchell's zebra (Equus quagga burchelli); Hippopotamus (Hippopotamus amphibius), a herbivore classified as Vulnerable; Cheetah (Acinonyx jubatus), a carnivore classified as Vulnerable; the Near Threatened White Rhinoceros (Ceratotherium simum); Commerson's roundleaf bat (Tomopterna cryptotis), classified as Near Threatened; Spotted hyena (Crocuta crocuta); and the Mauritian tomb bat (Taphozous mauritianus).

There are numerous avian species found in this ecoregion, a few examples being: the Near Threatened Red footed falcon (Falco vespertinus); Kori bustard (Ardeotis kori); Long-crested eagle (Lophaetus occipitalis); Olive bee eater (Merops superciliosus); Marabou stork (Leptoptilos crumeniferus); Martial eagle (Polemaetus bellicosus); and the Pink-backed pelican (Pelecanus rufescens).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© C.Michael Hogan & World Wildlife Fund

Supplier: C. Michael Hogan

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Habitat and Ecology

Habitat and Ecology
It is a species of open country in woodland, savannah, grassland, and agricultural and suburban areas, but also found in forest clearings. It is usually (but not always) found in close proximity to permanent water. It breeds in shallow temporary ponds.

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Ptychadena anchietae is a species of open country in woodland, savannah, grassland, and agricultural and suburban areas, but also found in forest clearings. It is usually (but not always) found in close proximity to permanent water. This species occurs up to 1,800 m asl in Ethiopia (Poynton et al., 2004).

P. anchietae is a widespread inhabitant of the savanna biome in the northeastern part of the atlas region, between 20 and 1450 m a.s.l. It occurs in relatively moist, coastal bushveld vegetation types with a minimum annual rainfall in excess of 600 mm, as well as in more arid habitats such as Mixed Bushveld, which experiences a minimum annual rainfall of 350 mm (Text from Minter et al., 2004, © SI/MAB Biodiversity Program).

This ridged frog is found in much the same kinds of places as the Mascarene ridged frog. However, this frog appears to prefer the lowland areas, whereas the Mascarene ridged frog occurs in greater numbers within the mountains (Text from Measey et al. 2009, © SANBI).

This frog inhabits open areas in lowland savannas, grasslands and woodlands and is typically found near water. It tolerates some habitat modification and may be found in former forest, agricultural and suburban areas (Harper et al., 2010).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Dietterich, Lee; Bergmann, Travis; Minter, L.R. ; Passmore, N.I.

Source: African Amphibians Lifedesk

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Ptychadena anchietae tested positive for Batrachochytrium dendrobatidis in Nairobi, Kenya in 2000 (Berger & Speare 2000). Also tested tested positive for B. dendrobatidis in Kihansi Gorge, Tanzania in 2003 (Weldon & Du Preez 2004).

Chytrid fungus was detected in this species in Kenya (Poynton et al., 2004).

Barbour and Loveridge (1928) record the diet to include grasshoppers, crickets, beetles and other insects (Text from Minter et al., 2004, © SI/MAB Biodiversity Program).

This species is also a friend to Taita farmers as during the day it eats small invertebrates which may damage crops (Text from Measey et al. 2009, © SANBI).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Dietterich, Lee; Bergmann, Travis; Minter, L.R. ; Passmore, N.I.

Source: African Amphibians Lifedesk

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

This species is abundant in many parts of its range (Poynton et al., 2004).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Dietterich, Lee

Source: African Amphibians Lifedesk

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Modes and Mechanisms of Locomotion

This frog is a keen jumper that will catapolt as soon as it is disturbed. If it reach the water on the first jump, it will either jump again, or disappear into the bottom of the grass (Measey et al. 2009, © SANBI).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Bergmann, Travis

Source: African Amphibians Lifedesk

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

Metamorphosis

The tadpoles break out of the jelly capsule after 24 hours and develop rapidly (Stewart 1967), undergoing metamorphosis and leaving the water three weeks later (Text from Minter et al., 2004, © SI/MAB Biodiversity Program).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Minter, L.R. ; Passmore, N.I.

Source: African Amphibians Lifedesk

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Advertisement Call

In late winter to early spring, adults begin to congregate around permanent water bodies. At this time, vocalization is restricted to infrequent, quiet, low trills, which differ from the advertisement call. Passmore (1978) found that males call from bare or sparsely vegetated areas of the shoreline, usually within 20 cm of the water’s edge. The average distance between calling males is about 80 cm; a distance of less than 20 cm usually elicits a territorial call that results in one of the males moving away from the other (Text from Minter et al., 2004, © SI/MAB Biodiversity Program).

The calls that the males produce come from the same kinds of lateral vocal sacs either side of the head. The call they produce sounds very different and can help you identify them as it sounds like a ‘wah wah wah’ (Text from Measey et al. 2009, © SANBI).

Males call near the edge of temporary pools and flooded grasslands. The call is a rapid high-pitched trill repeated three times every two seconds (Harper et al., 2010).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Dietterich, Lee; Bergmann, Travis; Minter, L.R. ; Passmore, N.I.

Source: African Amphibians Lifedesk

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Breeding choruses develop after the first spring rains, through to late summer or autumn (Text from Minter et al., 2004, © SI/MAB Biodiversity Program).

This ridged frog breeds during all but the driest months (June to September) and in the same places as the Mascarene ridged frog; in ponds, pools and puddles at the side of the road (Text from Measey et al. 2009, © SANBI).

It breeds in shallow temporary ponds (Poynton et al., 2004). Small eggs, gray on top and white below, are laid in a single layer that floats on the surface of the water (Harper et al., 2010).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Dietterich, Lee; Bergmann, Travis; Minter, L.R. ; Passmore, N.I.

Source: African Amphibians Lifedesk

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Growth

Tadpole morphology

Tadpoles are brown above and light below with a clear fin and may reach 45 mm in length (Text from Harper et al., 2010).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Dietterich, Lee

Source: African Amphibians Lifedesk

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Ptychadena anchietae

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

GCCCTTAGCCTCYTYATTCGTGCTGAACTKAGTCARCCCGGGACACTYYTAGGGGAT---GACCAAATTTACAATGTAATTGTAACGGCTCACGCATTCGTAATAATCTTTTTTATGGTAATGCCCATCCTGATCGGAGGCTTTGGAAACTGACTTGTTCCCCTTATGGTAGGGGCCCCTGACATGGCGTTCCCTCGAATAAACAATATAAGCTTTTGACTCCTGCCACCCTCCTTTTTTCTTCTACTTGCCTCCTCTATAGTAGAAGCTGGGGCAGGAACCGGGTGGACTGTATACCCCCCCTTAGCCGGAAACCTAGCTCACGCGGGCCCATCCGTAGACCTAGCTATCTTTTCCCTACACCTCGCAGGGGTATCTTCTATCCTTGGGGCCATTAACTTTATTACTACAATCATGAATATAAAACCAAGCTCTATTACACAATATCAAACACCCTTATTTGTGTGATCCGTCCTAATCACTGCAGTATTACTTCTACTATCGCTCCCAGTGCTTGCTGCAGGCATCACTATATTATTAACTGACCGAAACCTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Ptychadena anchietae

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2013

Assessor/s
IUCN SSC Amphibian Specialist Group

Reviewer/s
Stuart, S.N.

Contributor/s
Channing, A., Poynton, J., Howell, K., Minter, L., Largen, M.J. & Lötters, S.

Justification
Listed as Least Concern in view of its very wide distribution, its tolerance of a broad range of habitats and its presumed large population.

History
  • 2004
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Category and Justification of Conservation Status

The IUCN Red List (2004) categorizes this species as Least Concern in view of its very wide distribution, its tolerance of a broad range of habitats, its presumed large population, and because it is unlikely to be declining fast enough to qualify for listing in a more threatened category (Poynton et al., 2004).

P. anchietae does not appear to be at risk as much of its habitat is used for game and cattle farming and is relatively undisturbed. The species occurs in a number of provincial nature reserves and national parks (Text from Minter et al., 2004, © SI/MAB Biodiversity Program).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Dietterich, Lee; Minter, L.R. ; Passmore, N.I.

Source: African Amphibians Lifedesk

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
It is abundant in many parts of its range.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Populations of this species are stable (Poynton et al., 2004).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Dietterich, Lee

Source: African Amphibians Lifedesk

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
It is an adaptable species that is only likely to be facing localized threats. Chytrid fungus was detected in this species in Kenya.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ptychadena anchietae is an adaptable species that is only likely to be facing localized threats. Chytrid fungus was detected in this species in Kenya (Poynton et al., 2004).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Dietterich, Lee

Source: African Amphibians Lifedesk

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
It occurs in many protected areas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation Actions and Management

This species occurs in many protected areas (Poynton et al., 2004).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Dietterich, Lee

Source: African Amphibians Lifedesk

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Anchieta's Ridged Frog

The Anchieta's ridged frog or plain grass frog (Ptychadena anchietae) is a species of frog in the Ptychadenidae family. It is found in Angola, Botswana, Republic of the Congo, Democratic Republic of the Congo, Djibouti, Eritrea, Ethiopia, Kenya, Malawi, Mozambique, Namibia, Somalia, South Africa, Sudan, Swaziland, Tanzania, Uganda, Zambia, Zimbabwe, possibly Burundi, and possibly Rwanda. Its natural habitats are subtropical or tropical moist lowland forests, subtropical or tropical moist montane forests, dry savanna, moist savanna, subtropical or tropical dry shrubland, subtropical or tropical moist shrubland, subtropical or tropical dry lowland grassland, rivers, intermittent rivers, freshwater lakes, freshwater marshes, intermittent freshwater marshes, hot deserts, arable land, rural gardens, urban areas, and ponds.

References[edit]


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!