Articles on this page are available in 1 other language: Dutch (1) (learn more)

Overview

Comprehensive Description

General Description

Caprellid, "Ghost" or "Skeleton" shrimps, so called for their skeletal appearance. Amphipod crustaceans, easily distinguished by the elongate stick-like body form and reduction of the abdominal appendages. Head is generally fused with pereonite 1. Pereopods on first 2 segments (pereonites) are most flexible and called gnathopods; gnathopods 2 being the largest, used in defense, feeding and substrate attachment. In many species pereopods 3 and 4 may also be reduced or absent. Gills on pereonites 3 + 4, rarely on pereonite 2. Pereopods 5 - 7 much smaller than 1 + 2, used for clinging to the substratum. In females, brood plates (öostegites) develop on pereonites 3 + 4. Much remains to be learnt about their biology, ecology and in many cases changing distributions.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ashton, Gail

Source: Caprellids LifeDesk

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

 Skeleton shrimps or caprellids have very slender bodies and a cylindrical shape. The head is bulbous with antenna 1 generally longer than 2. The appendages are reduced in number. The animal can be divided into a head, thorax or pereon and an abdomen. They tend to be slow-moving. Caprella mutica is a large caprellid amphipod. Males can be up to 5 cm long and females 1.5 cm. They are orange to red in colour and the brood pouch of the female is covered with dark red spots.The first record of Caprella mutica for the UK was in July 2000, from a fish farm in Scotland (Willis et al., 2004). The species' natural distribution is the coastal waters of the sub-boreal areas of north-east Asia (Willis et al., 2004). Little is known about the biology or ecology of this species. Each female can produce up to 150 hatchlings every 45-50 days. It was introduced to North America (Pacific coast) accidentally through shipments of Japanese oysters. The method of introduction to the UK is unknown, but likely to be via shipping and aquaculture. Caprella mutica has been found in high concentrations in marine Special Areas of Conservation (SACs) designated for their biogenic reefs. The impacts on these habitats, if any, is not known. Found in high densities especially during May to September. On the west coast of Scotland their abundance can reach 300,000 individuals per m² (Cook et al., 2007).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Ardrossan, Belgian Exclusive Economic Zone, Craobh Haven, Dunstaffnage, German Bight, Lossiemouth, North Sea, Peterhead, Port Edgar, Troon, United Kingdom Exclusive Economic Zone
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Native to Sea of Japan (Russia and Japan); introduced widely in northern hemisphere and New Zealand in the southern hemisphere.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ashton, Gail

Source: Caprellids LifeDesk

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Diagnostic Description

Specimens

National Museum of Natural History, Washington DC: (NMNH); University of Alaska, Fairbanks

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ashton, Gail

Source: Caprellids LifeDesk

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Notes

Introduced throughout the northern hemisphere and to New Zealand in the southern hemisphere. Very abundant during summer months. Distinguished from C. acanthogaster: pereonite 2+3 covered in fine setae in mature male, gnathopod 2 poison spine less developed, gills are shorter.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ashton, Gail

Source: Caprellids LifeDesk

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Length: 6-49mm. Head rounded. Most extreme body projections described here (fully developed adult male): Cephalon and pereonite 1 smooth (although with dense long setae, which also extend over gnathopod 2); pereonite 2 with 1-3 pairs dorsal spines and 2 pairs lateral spines (base of gnathopods 2 and posterior); pereonite 3 with 7 pairs dorsal spines and 3-7 spines near attachment of gills; pereonite 4 with 8 pairs dorsal spines and 3-7 spines near attachment of gills, 1 pair lateral spines at both anterior and posterior margin; pereonite 5 with 5 pairs dorsal spines, 1 pair antero-lateral spines; pereonites 6 and 7 with 2 pairs of spines dorsally (median and posterior). Antenna 1 longer than ½ body length. Antenna 2 less than ½ length of antenna 1; peduncle with two ventral rows of setae. Gnathopod 1 short, with setation on posterior margin; propodus with 2 grasping spines, grasping margin of dactylus and propodus serrate. Gnathopod 2 long, densely covered in setae; propodus palm with large projection proximo-medial and a distal triangular projection ; dactylus heavy and scimitar-shaped; basis having an antero-lateral projection distally. Gills oval to elliptical. Pereopods 5 - 7 propodus with 2 grasping spines. Females differ in presence of 1 pair spines on cephalon and posterior of pereonite 1 (not always present)

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ashton, Gail

Source: Caprellids LifeDesk

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Depth range based on 1 specimen in 1 taxon.
Water temperature and chemistry ranges based on 1 sample.

Environmental ranges
  Depth range (m): 25.8 - 25.8
  Temperature range (°C): 10.596 - 10.596
  Nitrate (umol/L): 3.550 - 3.550
  Salinity (PPS): 34.409 - 34.409
  Oxygen (ml/l): 6.153 - 6.153
  Phosphate (umol/l): 0.413 - 0.413
  Silicate (umol/l): 2.707 - 2.707
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

In fouling communities on floats and pilings, on many substrates (hydroids, bryozoans, ascidians etc.)

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ashton, Gail

Source: Caprellids LifeDesk

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

 Caprella mutica is found on a range of natural substrata such as hydroids and algae and artificial substrata including buoys, mooring ropes, boat hulls and floating pontoons. It is often found in association with Sargassum muticum.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Alien species

The origin of the Japanese skeleton shrimp Caprella mutica is East Asia, near Japan. The species was brought to Europe trough transport in ballast water of cargo ships or together with oysters imported by the farming industry. The first specimens of the Japanese skeleton shrimp in Belgium were found in 1998 on buoys in front of the coast of Zeebrugge. During the following years the species spread to the other ports along the Belgian coast. The species tolerates a wide gradient in temperature and salinity and might have a ecological influence by competing with indigenous species.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Caprella mutica

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACTTTATACTTTATACTCGGTGTATGAGCCGCTTTTTTTGGGACATCGTTGAGTATAATTATCCGGACTGAATTAATAACCCCAGGGAATGTTATCGGAGATGACCAAATCTATAACGTTGTAGTAACAGCTCACGCTTTTATTATAATTTTTTTTATAGTTATGCCAGTTATAATCGGAGGTTTTGGTAATTGACTTGTACCTTTGATGTTAGGTAGTCCTGATATGGCTTTTCCTCGTATAAATAACATAAGATTTTGGCTACTACCTCCCTCTTTAACTTTACTCATTGTGAGAGGACTAGTAGAAAGAGGTGTAGGGACGGGGTGAACAGTATACCCTCCTTTAAGTTCAAGAACAGGGCACCCCGGGGGTGCCGTGGATCTAGCAATTTTTTCTTTACACCTTGCCGGTGCAAGATCTATTTTAGGTGCTATCAATTTTATTTCCACAATTATTAATATACGAGCAGAAGCAATATACTTAGACCGAATGCCTTTGTTCGTTTGATCAGTTTTTATCACCGCTATTCTACTACTTTTGTCTCTACCAGTTTTAGCCGGAGCTATTACAATATTGCTGACTGACCGAAATTTAAACACTTCTTTTTTTGACCCTTTAGGGGGAGGTGACCCTATCCTTTACCAACACTTATTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Caprella mutica

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 305
Specimens with Barcodes: 308
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!