Articles on this page are available in 2 other languages: Dutch (2), Spanish (6) (learn more)

Overview

Brief Summary

Introduction

The Chinese mitten crab, Eriocheir sinensis, has been widely introduced into many regions outside of its native range in China. As a result, it has been placed on the International Union for Conservation of Nature's (IUCN) list of the world's worst 100 invasive alien species.It has conspicuous setal mats on its claws and both its British common name, Chinese mitten crab, and its scientific name, Eriocheir sinensis, which means ‘wool hand, the Chinese’, originate from this distinguishing feature. It is the only crab in Britain that has this.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Partner Web Site: Natural History Museum

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

The Chinese mitten crab arrived in the German Weser River in 1912. Larvae hitched a ride with ships trading with China. A notable feature of this crab is the brown 'hair' on its claws. Adult animals live in fresh water. They migrate to sea to mate and lay their eggs. During their migration journey, they don't let much stand in their way. Sometimes, they cross over a dike or a road in massive numbers or decide to take a shortcut through a neighborhood. People are totally perplexed when they suddenly see a group of crabs walking through their garden. They are readily seen as giant spiders or aliens from out-of-space!
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Taxonomy

Eriocheir sinensis was first described in 1853 by the French naturalist Henri Milne Edwards in Annales des Sciences Naturelles, série 3, volume 20. A more detailed description appeared a year later in volume 7 of the Archives du Muséum d'Histoire Naturelle. This is often, incorrectly, cited as the authority for E. sinensis and it appears that H. Milne Edwards himself may have intended this description to appear first, as he cites figure 1 from it in the earlier publication.However, according to the rules laid out in the International Code of Zoological Nomenclature, 1999, the correct authority of the species is Eriocheir sinensis H. Milne Edwards, 1853.

Related species
3 other species have also been assigned to the genus Eriocheir:Mitten crab relatives

Diagnostic characters of Eriocheir sinensis
  • Setal mats on the chelae
  • Quadrate (squarish) carapace
  • Frontal margin with deep central cleft and 4 spines
  • 4 teeth on the carapace anterolateral margin
Identification of mitten crabs
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Partner Web Site: Natural History Museum

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

 Eriocheir sinensis is a large crab with a maximum carapace length of 56 mm. The carapace is quite square in outline, narrowing towards the front and has four lateral teeth on each side. The carapace is olive green in colour, the legs paler. The most obvious distinguishing feature of Eriocheir sinensis is the dense mat of hair on the claws. The leading edges of the legs are also very hairy.A native of China introduced into Germany in 1912 now dispersed widely in NE Europe (see Clarke, 2005). This crab may be found in isolated bodies of freshwater as it will cross dry land to colonize new areas. Scientific name Eriocheir sinensis is derived from the Greek and means wool hand of the Chinese, hence the vernacular or common name the Chinese mitten crab (Clarke, 2005). For further information see Marine Aliens pages.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Geographic Range

Chinese mitten crabs are found on coasts from Japan to the mainland of China, Korean Peninsula, and along the Yellow Sea; they are also found on the coasts of northern and eastern Europe and the United States.

Biogeographic Regions: nearctic (Introduced ); palearctic (Introduced , Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Atlantic Europe, Baltic sea, Bay of Biscay, Belgian Exclusive Economic Zone, Belt Sea, Black Sea, Blankenberge, British Isles, California, China, Dutch Exclusive Economic Zone, Elbe, English Channel, European waters (ERMS scope), French Exclusive Economic Zone [Atlantic part], German Bight, German Exclusive Economic Zone, Gulf of Mexico, Knokke, Knokke-Heist, Korea Island, Lake Erie, Mediterranean Sea, Mississippi, Netherlands, Nieuwpoort, North East Baltic Sea, North Sea, North West Atlantic, Oostende, Polish Exclusive Economic Zone, Scandinavia, Schelde estuary, Stroombank, Swedish Exclusive Economic Zone, United Kingdom Exclusive Economic Zone, Westerschelde, Wimereux, Zeebrugge, Zeeschelde
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The species spends most of its time in freshwater, but has to return to the sea for reproduction.
  • Adema, J.P.H.M. (1991). De krabben van Nederland en Belgie (Crustacea, Decapoda, Brachyura) [The crabs of the Netherlands and Belgium (Crustacea, Decapoda, Brachyura)]. Nationaal Natuurhistorisch Museum: Leiden, The Netherlands. ISBN 90-73239-02-8. 244 pp.   http://www.marinespecies.org/aphia.php?p=sourcedetails&id=51 External link.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Introduced to Europe in 1912 by shipping trade with China. A pest species, causing damage to river banks and fishing nets.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Exotic

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Exotic

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Native distribution
The Chinese mitten crab originates from east Asia, with a distribution from the Province of Fukien, China (approximately 26º N), northwards to the Korean Peninsula (approximately 40º N). It has since been introduced to many other locations around the world via ships' ballast tanks, its natural ability to migrate extraordinary distances aiding its spread.

When did it reach Europe and Britain?
The crab was introduced into Germany in 1912 and has since spread throughout northern Europe. It has been reported as far south as Languedoc-Roussillon in southern France.The first British record of Eriocheir sinensis was in 1935 from the River Thames. A large population is now well established in the Thames catchment, with an autumn migration pattern, ovigerous crabs, juveniles and burrowing behaviour. This population continues to expand westwards with a new record (13 October 2007) from Boveney Lock, just upstream of Windsor.Current records indicate the crab is also now common in the following rivers:
  • Medway
  • Ouse
  • Humber
  • Tyne
Isolated captures have been made from:
  • the River Teign near Exmouth
  • Dungeness in Kent
  • the Duddon Estuary near Morcambe Bay
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Partner Web Site: Natural History Museum

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Chinese mitten crabs are light brown and have hairy claws that are typically white-tipped, giving the appearance of mittens. They have a notch between the eyes and 4 lateral carapace spines. Their legs are generally twice as long as the width of the carapace, which has an average maximum width of 80 mm. Males and females are dimorphic: males have a V-shaped abdomen whereas the females have a U-shaped abdomen.

Other Physical Features: ectothermic ; bilateral symmetry

Sexual Dimorphism: sexes shaped differently

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Chinese mitten crabs spend most of their lives in brackish water and freshwater rivers and estuaries. Eriocheir sinensis migrates downstream to saltwater environments to reproduce. During migration they are known to cross terrestrial boundaries, but they do not spend much time on land.

Habitat Regions: temperate ; saltwater or marine ; freshwater

Aquatic Biomes: rivers and streams; coastal ; brackish water

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 10 specimens in 1 taxon.

Environmental ranges
  Depth range (m): 2 - 14.7

Graphical representation

Depth range (m): 2 - 14.7
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

 In rivers and lakes, burrowing into sediment banks. Adults migrate to estuary mouths to breed and the females may over-winter in deep, fully saline water.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Alien species

The Chinese mitten crab already appears in Belgium from 1933. The crab originates from the Far East and was presumably brought to Europe as a larva in the ballast water of ships. From Germany, the species spread through Northern- and Western-Europe. The Chinese mitten crab Eriocheir sinensis predominantly lives in rivers, but migrates seaward in the late summer to breed in the brackish part of the estuaries. The egg-carrying females spend the winter at sea, and return to the brackish part of the estuary in spring to release the larvae in the water which then develop to juvenile crabs. These juveniles migrate back up the rivers, streams and canals to complete the life cycle.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Mitten Crabs are omnivores, which means that they eat both plants and animals as its primary food source. As juveniles they mostly eat vegetation but also prey on small invertebrates

Animal Foods: other marine invertebrates

Plant Foods: algae

Other Foods: detritus

Primary Diet: omnivore

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Mitten crabs are prey for many animals. They are also a secondary intermediate host of the Oriental lung fluke -- Paragonimus ringeri. Mammals including humans are the final host of this parasite. Mitten crabs can tolerate a wide range of environmental conditions. This is evident as this species has been spread via shipping to North America as well as Europe. When they are introduced to a new environment, their population becomes very large very fast and they change the structure of the local environment. For instance during migration, mitten crabs burrow into sediment and this increases erosion that can lead to collapse of river banks. They may also have a profound effect on biological communities through predation and competition.

Ecosystem Impact: creates habitat; soil aeration

Species Used as Host:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Mitten Crabs are subject to predation by many carnivorous organisms in the water and on land, including fish, frogs, and birds.

Known Predators:

  • sunfish
  • river otter
  • raccoon

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paragonimus westermani (Oriental lung fluke)
In east Asia, Eriocheir sinensis is a host of the lung fluke Paragonimus westermani. If an infected crab is eaten uncooked the parasite can infect humans, causing the disease paragonimiasis. This can be fatal if left untreated.P. westermani is most often encountered in China, Korea, Thailand, the Philippines and Laos, but it can also be found in people that have travelled to susceptible regions. Cases have been reported from many parts of the world, including South America and Africa, but the disease is rarely seen in North America or Europe. A 2005 report put the number of people infected globally at around 22 million. When Eriocheir sinensis was first reported from the River Thames in the UK in the 1930s, newspapers expressed concern that paragonimiasis could be introduced into Britain. However, this is unlikely as part of the life cycle of P. westermani requires an aquatic snail family that isn't found in Britain.A recent analysis of mitten crabs sampled from the River Thames over 17 months failed to detect the lung fluke parasite (Stentiford, 2005).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Partner Web Site: Natural History Museum

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Ecology

Habitat
Mitten crabs spend most of their lives in freshwater. Although they burrow in mud, mitten crabs seem to occur over many different types of river bottom. Mitten crabs certainly burrow into intertidal mud banks.Unprotected mud banks collapse when crab burrows are numerous.

Feeding
Mitten crabs are opportunistic, indiscriminate omnivores. They appear to be able to consume a wide range of aquatic plants, invertebrates and fish.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Partner Web Site: Natural History Museum

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

A study on mating communication shows that mate recognition occurs only after physical contact. The study indicates that once physical contact is established, a contact pheromone is involved.

Communication Channels: tactile ; chemical

Other Communication Modes: pheromones

Perception Channels: visual ; tactile ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

Development

After the fertilized eggs hatch, they are called zoea and do not look like adults. Zoea have a long dorsal spine, a rostral spine, and 2 lateral spines. They develop appendages on their side that will eventually be involved in feeding. In this stage, they spend 1 to 2 months in brackish water before migrating upstream for further development. After 5 zoeal stages, the crab undergoes metamorphosis from the zoeal stage to a megalopal stage. At this stage, the larvae begin to look like adults but are still distinguishable from them because of the presence of a protruding abdomen. After about 7 days in this stage, molting occurs and juvenile crabs emerge; they then migrate upstream and go on to develop into adults, where sexual maturity is reached between their fourth and fifth years of life.

Development - Life Cycle: metamorphosis

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life history

Mitten crabs are catadromous. That is, they spend most of their life in freshwater, but must return to the sea to breed.

Growth phase
  • Juveniles and subadults
  • Lasts between 1 to 5 years
  • Spent in freshwater (<0.5% salinity)


Reproductive phase
  • Mating, spawning and hatching of larvae
  • Occurs in higher salinities (2.6% or above)
  • Crabs spend 8-10 months as sexually mature adults


Larval development
  • Normally involves a prezoea stage, 5 zoeal stages and a megalopa stage
  • Mitten crabs sometimes pass through an additional zoeal stage, possibly related to unfavourable environmental conditions
  • Salinities between 1 and over 3% tolerated, although extremes cause increases in mortality


Migration
Males and females move downstream in large numbers during late summer and autumn, attaining sexual maturity when they reach the brackish water of tidal estuaries. Males arrive in the tidal estuaries first and mating occurs as soon as the females arrive. After mating the females continue to migrate towards the sea and spawn in salinities of 2.6% or above. The adults of both sexes overwinter at sea, and return to the brackish estuary with egg hatching commencing in early spring. By late July this adult population has died off. Larval development probably occurs in the lower estuary. Megalopas (the final larval stage) start settling out and moulting into the first crab stage and start the migration back upstream to freshwater. Mitten crabs are able to migrate long distances: juveniles can travel around 1000km while growing to adult size.The species has been found 1300km inland in China and 700-780km upstream in the Elbe River, as far as Prague in the Czech Republic.Schematic representation of the catadromous life cycle of the Chinese mitten crab PDF (21.0 KB)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Partner Web Site: Natural History Museum

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

There are varied reports as to the lifespan of this species. Factors influencing the lifespan include temperature of the water, salinity, and others. Reports vary from lifespan as little as 1-2 years to as much as 3-5 years, depending on the region in which the crabs are located.

Range lifespan

Status: wild:
1 to 5 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

During the summer months mature Chinese mitten crabs begin their migration to the sea, with males arriving first and females arriving afterwards. Soon after reproduction, however, both sexes die and the progeny are left to fend for themselves.

Mating System: monogamous

Males and females come in contact and after initially fighting, mating behavior begins. During physical contact, males are able to recognize reproductively active females because the females release contact pheromones; they are only released after physical contact has been made.

Breeding season: Summer

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (Internal ); oviparous

Females aerate their eggs after they are fertilized so that nutrients can be passed from mother to baby. Females can produce anywhere between 250,000 to 1 million eggs, depending on the size of the female. After eggs have been fertilized, they are released about 1 day after mating and females then produce a substance that allow her eggs to adhere to part of her abdomen. Over the winter season, the females stay under deep water while the eggs develop.

Parental Investment: pre-hatching/birth (Provisioning: Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Eriocheir sinensis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 32 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGCAACGATGACTTTTTTCTACAAATCATAAAGATATTGGAACATTATATTTTATTTTCGGTGCTTGGGCCGGAATAGTAGGAACATCATTAAGATTAATTATTCGAGCTGAATTAAGACAACCAGGCAGACTAATTGGTAACGATCAAATTTATAATGTAGTTGTAACAGCTCACGCTTTTGTAATAATTTTTTTTATAGTAATGCCCATTATAATTGGTGGATTTGGCAACTGACTTGTCCCTCTTATACTAGGGGCCCCAGATATAGCTTTCCCACGAATAAACAATATAAGATTCTGACTTTTACCCCCTTCTCTCTCTCTTTTACTTACAAGAAGAATAGTAGAAAGAGGAGTTGGTACTGGATGGACTGTCTACCCACCTTTAGCAGCAGCCATCGCTCATGCTGGAGCATCAGTTGATCTTGGTATCTTCTCTCTACATCTTGCCGGAGTTTCCTCAATTTTAGGAGCTGTTAATTTCATAACAACAGTTATTAACATACGATCATATGGAATAACAATGGATCAAATACCTCTTTTTGTTTGAGCTGTATTTATTACTGCTATTTTACTTCTCTTATCCCTTCCAGTTTTAGCTGGAGCTATTACCATACTGCTTACAGATCGTAACCTAAATACGTCATTTTTCGACCCAGCAGGGGGAGGTGACCCAGTTCTATACCAGCACTTATTCTGATTTTTCGGTCACCCAGAAGTTTATATTCTAATTTTGCCTGCCTTCGGTATAATCTCTCATATTGTAAGTCAAGAATCAGGTAAAAAGGAATCTTTTGGAACTTTAGGTATAATTTACGCTATACTAGCTATTGGAATTTTGGGCTTTGTAGTATGAGCTCATCATATATTTCCAGTAGGTATAGACGTAGATACCCGAGCTTACTTTACCTCAGCCACTATAATTATTGCTATCCCCACCGGAATTAAAATCTTTAGATGACTAAGGACCTTACATGGAACTCAAATAAATTATTCACCATCTCTTCTATGAGCTTTAGGGTTTATCTTTTTATTTACTATTGGAGGTCTGACAGGAGTAGTTTTAGCTAATTCCTCAATTGATATTATTCTCCATGATACTTATTATGTTGTTGCCCACTTTCATTATGTACTCTCTATAGGAGCAGTTTTCGGAATCTTTGCTGGAGTTGCTCACTGGTTTTCTCTAATAACAGGTTTATCTTTCAACCCTAAATGACTAAAAATTCACTTTTTAGTAACTTTCGTCGGAGTCAATTTAACATTTTTTCCCCAACACTTTTTAGGATTAAACGGTATACCACGACGATACTCTGATTATCCTGACGCCTATGCAACTTGAAATATTGTATCATCTATAGGTTCTATAATTTCTTTTGTAGCCGCATTAGGATTCTTATTAATCGTTTGAGAAGCATTTGTTTCTAATCGCCCAGTAATCTTTTCTCCTTTTTTGCCCTCTTCTATTGAATGGAAACATGCTTATCCTCCAGCCGACCATTCATATATGGAAATCCCACTAATTACTAACT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Eriocheir sinensis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 40
Specimens with Barcodes: 41
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

Eriocheir sinensis is not vulnerable, threatened, or endangered on any part of its native or introduced range.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNA - Not Applicable

United States

Rounded National Status Rank: NNA - Not Applicable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Mitten crabs are a contentious invasive species. They have high reproductive rates and few natural predators capable of reducing their numbers dramatically. If alien populations are not controlled, they will continue to threaten native ecosystems, damage unprotected river banks and spread even further. Increased larval densities in estuaries will increase the risk of dispersal into new watersheds via the ballast water of shipping vessels. Therefore it is important to manage existing populations.

How could crab numbers be reduced?
Since mitten crabs are eaten in southeast Asia, commercial exploitation could potentially be used as a method of reducing crab numbers. Zoologists at the Natural History Museum have been involved in assessing whether this would be viable for the mitten crab population in the River Thames. The results of the recent study, published in 2009, concluded that the crabs are fit for human consumption and the population is large enough to be exploited.

What's the next step?
The decision of whether to start a Thames mitten crab fishery now rests with governmental organisations such as DEFRA, the Environment Agency and the London Port Health Authority. A joint meeting of the Natural History Museum and the Linnean Society of London, supported by the London Port Health Authority, is being held on 11 March 2010 to discuss the pros and cons of such a fishery.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Partner Web Site: Natural History Museum

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

When the mitten crabs invade, they can damage the riverbanks because of their burrowing behavior as mentioned in the Ecosystem Roles section. This could be a financial problem if development along the riverbank is threatened. Mitten crabs cause damages to commercial fishing nets. They could also eat the trapped fish in commercial ponds. Crabs damage crops in China by consuming rice shoots. Humans can become infected with Paragonimus ringeri by eating poorly cooked or raw mitten crabs.

Negative Impacts: injures humans (causes disease in humans ); crop pest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Mitten crabs are a delicacy in Asia and other places. They can be used as bait for eel fishing, in the production of cosmetic products, and as fertilizer in agriculture.

Positive Impacts: food

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Risks

Invasive Species Information

Native To: Pacific coast of China and Korea (NAS Database 2011)

Date of U.S. Introduction: 1991 (West Coast); 2005 (East Coast) (NAS Database 2011) Means of Introduction: Ballast water (also possibly through intentional releases) (Cohen and Carlton 1997) Impact: Interference with fish salvage operations, fish passage facilities, water treatment plants, power plants, and other facilities (Cohen and Weinstein 2001) Current U.S. Distribution: West Coast; Great Lakes; Chesapeake Bay (NAS Database map) Federally Regulated: Listed as injurious wildlife under the Federal Lacey Act, which makes it illegal in the U.S. to import, export, or transport between States without a permit (DOI, Fish and Wildlife Service) Source: USDA, National Invasive Species Information Center
  • Source: USDA, National Invasive Species Information Center
No known copyright restrictions

© Source: USDA, National Invasive Species Information Center

Supplier: Tracy Barbaro

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Chinese mitten crab

"Chinese mitten crab"
Traditional Chinese大閘蟹
Simplified Chinese大闸蟹
Alternative Chinese name
Chinese上海毛蟹

The Chinese mitten crab, Eriocheir sinensis (also known as the big sluice crab (Chinese: ; pinyin: zhá xiè) and Shanghai hairy crab, Chinese: ; pinyin: shànghǎi máo xiè) is a medium-sized burrowing crab, named for its furry claws that look like mittens, that is native in the coastal estuaries of eastern Asia from Korea in the north to the Fujian province of China in the south. It has also been introduced to Europe and North America where it is considered an invasive species.[1][2]

Contents

Description and ecology

This species' distinguishing features are the dense patches of dark hair on its claws. The crab's body is the size of a human palm. The carapace width is 30–100 millimetres (1.2–3.9 in) and the legs are about twice as long as the carapace is wide.

Mitten crabs spend most of their life in fresh water, but they must return to the sea to breed. During their fourth or fifth year in late summer, the crustaceans migrate downstream, and attain sexual maturity in the tidal estuaries. After mating, the females continue seaward, overwintering in deeper waters. They return to brackish water in the spring to hatch their eggs. After development as larvae, the juvenile crabs gradually move upstream into fresh water, thus completing the life cycle.[2]

Invasive species

This species has been spread to North America and Europe, raising concerns that it competes with local species, and its burrowing nature damages embankments and clogs drainage systems.[3][4] The crabs can make significant inland migrations. It was reported in the London Evening Standard in 1995 that the residents of Greenwich saw Chinese mitten crabs coming out of the River Thames and moving towards the High Street, and other reports indicate that the crabs have been known to take up residence in swimming pools. In some places the crabs have been found hundreds of miles from the sea. There is concern in areas with a substantial native crab fishery, such as the Chesapeake Bay in Maryland and the Hudson River in New York (both locations where the crabs were first spotted in 2005), as the impact of the invasion by this species on the native population is unknown.[5]

It is generally illegal to import, transport, or possess live Chinese mitten crabs in the United States,[6] as accidental release or escape risks spreading these crabs to uninfested waters. In addition, some states may have their own restrictions on possession of mitten crabs.[7] California allows fishing for mitten crabs with some restrictions.[8]

The Chinese mitten crab has been introduced into the Great Lakes several times, but have not yet been able to establish a permanent population.[9]

The Smithsonian is tracking the spread of the Chinese mitten crab and seeking help to determine the current distribution status of the mitten crab in the Chesapeake Bay region. People are encouraged to report any mitten crab sightings, along with details (date, specific location, size) and a close-up photograph or specimen if possible. The first confirmed record along the East coast of the United States, was in the Chesapeake Bay near Baltimore, Maryland in 2005.[10]

Chinese mitten crabs have also invaded German waters, where they destroy fishing nets, hurt native fish species and damage local dams, causing damage of up to 80 million Euros. These crabs migrated from China to Europe as early as 1900, and were first documented by official German reports in 1922. After investigation by German scientists in 1933, it was thought that the crabs migrated to Europe through ballast water in commercial ships. The crabs are the only freshwater crab species in Germany, and their tendency to dig holes has caused damage to industrial infrastructure and dams.[11]

Culinary

Hairy crab as Shanghai cuisine

The crab is an autumn delicacy in Shanghai cuisine and eastern China. It is prized for the female crab roe, which are ripen in the ninth lunar month and the males in the tenth.[12] The crab meat is believed by the Chinese to have a "cooling" (yin) effect on the body.

Chinese spend hundreds of yuan just to taste a small crab from Yangcheng Lake which are considered a delicacy. The crabs cost 680–700 yuan, or roughly US$105, per kilogram.[13] Most of the Yangcheng crabs are exported to Shanghai and Hong Kong, and high-profit foreign markets. Responding to the spread of the crab to the West, businessmen have started seeing it as a new source of crab for the Chinese market. One proposed scheme involves importing unwanted crabs from Europe, where they are seen as a pest, to replenish local pure-bred stock.

Mitten crabs have exhibited a remarkable ability to survive in highly modified aquatic habitats, including polluted waters.[2] Like some fish, they can also easily tolerate and uptake heavy metals, such as cadmium and mercury. Therefore, the farming and post-harvesting of the species needs proper management if it is used as a food.[14][15] Concerns have been raised that the population and origin of the crab may be affected because of overfishing of the species in the Yangtze River.

Recently, China introduced vending machines to sell this species of crab in the subways.[16] The crabs are stored at 5 °C (41 °F), which induces a sleepy state of hibernation. The prices of the crabs range from around $1.50 to $7.00 (USD).[17] They are guaranteed to be fresh and alive.

References

  1. ^ "Chinese mitten crab". The Washington Sea Grant Program. March 29, 2000. 
  2. ^ a b c Stephen Gollasch (March 3, 2006). "Ecology of Eriocheir sinensis". 
  3. ^ "Exotic crabs in waterway invasion". BBC News. February 8, 2006. 
  4. ^ Elizabeth Williamson & David A. Fahrenthold (August 8, 2006). "Discovery of second invasive mitten crab raises worries". Washington Post. 
  5. ^ Greg Bruno (June 16, 2006). "Fishermen Fear a Mitten Crab Invasion". Times Herald-Record. 
  6. ^ "Title 50 – Wildlife and Fisheries. Part 16: Injurious Wildlife". Code of Federal Regulations. October 1, 2008. 
  7. ^ California Code of Regulations, Title 14, Section 671
  8. ^ "Chinese Mitten Crab: Life and History". California Department of Fish and Game. August 5, 1998. 
  9. ^ P. D. N. Hebert. "Canada's Freshwater Invertebrates: Decapoda". Canada's Aquatic Environments. University of Guelph. 
  10. ^ "Chinese Mitten Crabs have come to the East Coast of the United States: We are seeking reports of mitten crab sightings and collections". Smithsonian Environmental Research Center. May 8, 2011. 
  11. ^ 3 September 2012, 中国大闸蟹入侵德国水域致德损失达8千万欧元 (Chinese mitten crabs invade German waters, cause damage of 80 million Euros), Sina News
  12. ^ Dunlop, Fuchsia (15 December 2012). "The Chinese delicacy of hairy crabs". BBC News Magazine. Retrieved 15 December 2012. 
  13. ^ Keith Fitz-Gerald (November 17, 2010). "Record hairy crab prices point to China's continued strong economic growth next year". Seeking Alpha. Retrieved August 31, 2011. 
  14. ^ Clifford A. Hui, Deborah Rudnick & Erin Williams (2005). "Mercury burdens in Chinese mitten crabs (Eriocheir sinensis) in three tributaries of southern San Francisco Bay, California, USA". Environmental Pollution 133 (3): 481–487. doi:10.1016/j.envpol.2004.06.019. PMID 15519723. 
  15. ^ F. Silvestre, G. Trausch, A. Péqueux & P. Devos (2004). "Uptake of cadmium through isolated perfused gills of the Chinese mitten crab, Eriocheir sinensis". Comparative Biochemistry and Physiology - Part A: Molecular & Integrative Physiology 137 (1): 189–196. doi:10.1016/S1095-6433(03)00290-3. 
  16. ^ Associated Press Video
  17. ^ Gizmodo "Vending Machine Sells Live Crabs"
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!