Overview

Distribution

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Monoporeia affinis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

GAGTTAAGCGCCCCAGGTAACTTAATCGGAGAC---GACCAAGTATACAACGTCATAGTGACGGCCCATGCTTTTGTAATAATTTTCTTTATAGTTATACCAATTATAATTGGGGGTTTTGGTAATTGGTTAGTACCTTTAATACTCGGTTCGCCTGACATAGCCTTTCCTCGTATGAACAATATAAGATTCTGGCTCCTTCCACCCTCTTTAACGCTCTTGCTCGTGAGAGGTTTAGTTGAGAGAGGTGTCGGAACAGGTTGGACAGTTTACCCTCCTTTAGCGGCTACAGCCGCTCACGGGGGCGGCTCTGTTGATTTAGCTATCTTTTCACTACACTTAGCCGGCGCTAGATCAATCCTAGGGGCTATTAATTTTATCTCTACTGTGATTAACATGCGGGCCCCGGGAATATCTATAGACCGGGTGCCTTTATTTGTTTGGTCGGTG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Monoporeia affinis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 308
Specimens with Barcodes: 308
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Monoporeia

Monoporeia affinis, formerly referred to as Pontoporeia affinis (Greek: Πόντος, póntos = Pontus / Black Sea; πορεία, poreía = to travel), is a small, yellowish benthic amphipod living in the Baltic Sea, the Arctic Sea and the lakes of the Nordic Countries.

Contents

Description[edit]

Monoporeia affinis measures up to 8 millimetres (0.31 in) long when fully grown, with two pairs of antennae and one pair of black eyes.[2] The legs arising from the first three segments of the abdomen are expanded basally to form broad plates.[2] Monoporeia affinis closely resembles another benthic amphipod, Pontoporeia femorata, which can be distinguished from M. affinis by its light red eyes.[2]

Ecology[edit]

M. affinis is one of the Baltic glacial relicts. Originally a freshwater species, it also exists in lakes. M. affinis lives on soft bottoms, sometimes even as densely as 10,000–20,000 but usually hundreds to thousands of individuals per square metre.[3] The amphipod has an important role in bioturbation (mixing and oxidating the bottom sediment). Monoporeia feeds on phytoplankton and decomposed organic matter sinking onto the bottom. M. affinis is itself the prey of Saduria entomon, Harmothoe sarsi (a polychaete) and fishes such as cod, herring and the fourhorn sculpin, Myoxocephalus quadricornis.[4] The increasing loss of oxygen in the Baltic Sea bottoms – especially in the Gulf of Finland – has lately been affecting the M. affinis population, since its eggs and embryos are very sensitive to lack of oxygen. Thus M. affinis is often used as an indicator species of the state bodies of water.[5]

Life cycle[edit]

After mating in the fall and bearing over the winter, the female M. affinis gives birth to 20–30 offspring, which only happens once during its 2–4 year lifespan.[3]

Taxonomic history[edit]

Monoporeia affinis was originally described in the genus Pontoporeia by Gustaf Lindström in 1855. It was moved to the new genus Monoporeia by Edward L. Bousfield in 1989, alonsgide two other species, "M. microphthalma" and "M. gurjanovae",[6] which are now considered synonyms of M. affinis.[7]

References[edit]

  1. ^ Jim Lowry, Mark Costello & Denise Bellan-Santini (2011). "Monoporeia affinis (Lindström, 1855)". In J. Lowry. World Amphipoda database. World Register of Marine Species. Retrieved June 7, 2011. 
  2. ^ a b c "Amphipod Monoporeia affinis". Aquascope. Tjärnö Marine Biological Laboratory. 2000. Retrieved May 7, 2005. 
  3. ^ a b "Valkokatkat / Itämeri-sanakirja". The Baltic Sea Portal (in Finnish). Finnish Institute of Marine Research. January 13, 2005. Archived from the original on February 5, 2007. Retrieved May 7, 2005. 
  4. ^ Catherine Hill (1991) (PDF). Mechanisms influencing the growth, reproduction and mortality of two co-occurring amphipod species in the Baltic Sea (Ph.D. thesis). Stockholm, Sweden: Stockholm University. ISBN 978-91-87272-27-1. http://www.baltic.vtt.fi/pdfs/C_Hill.pdf.
  5. ^ Eva Koskenniemi (2008). "Use and applicability of zoobenthic communities in lake monitoring". In Pertti Heinonen, Giuliano Ziglio & André Van der Beken. Hydrological and Limnological Aspects of Lake Monitoring. Water Quality Measurements 15. John Wiley & Sons. pp. 105–118. ISBN 978-0-470-51113-8. 
  6. ^ E. L. Bousfield (1989). "Revised morphological relationships within the amphipod genera Pontoporeia and Gammaracanthus and the 'glacial relict' significance of their postglacial distributions". Canadian Journal of Fisheries and Aquatic Sciences 46 (10): 1714–1725. doi:10.1139/f89-217. 
  7. ^ Jim Lowry, Mark Costello & Denise Bellan-Santini (2012). "Pontoporeia Krøyer, 1842". In J. Lowry. World Amphipoda database. World Register of Marine Species. Retrieved September 23, 2012. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!