Overview

Distribution

Fresh and brackish waters
  • Hayward, P.J.; Ryland, J.S. (Ed.) (1990). The marine fauna of the British Isles and North-West Europe: 1. Introduction and protozoans to arthropods. Clarendon Press: Oxford, UK. ISBN 0-19-857356-1. 627 pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

southern Labrador to Chesapeake Bay; sporadic south to Florida; introduced into the British North Sea region
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

infralittoral of the Gulf and estuary
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 59 specimens in 1 taxon.
Water temperature and chemistry ranges based on 2 samples.

Environmental ranges
  Depth range (m): 0.2 - 17
  Temperature range (°C): 21.498 - 21.498
  Nitrate (umol/L): 0.748 - 0.748
  Salinity (PPS): 34.083 - 34.083
  Oxygen (ml/l): 5.180 - 5.180
  Phosphate (umol/l): 0.241 - 0.241
  Silicate (umol/l): 2.493 - 2.493

Graphical representation

Depth range (m): 0.2 - 17
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Alien species

De tijgervlokreeftje Gammarus tigrinus is een soort die oorspronkelijk enkel voorkwam in Noord-Amerika. De soort zou in Europa terechtgekomen zijn via het ballastwater van transportschepen zoals bijvoorbeeld in Engeland in 1931 het geval was, maar hij werd ook opzettelijk ingevoerd als visvoedsel zoals in Duitsland in 1957. In 1991 werd de tijgervlokreeft voor het eerst in België waargenomen. Mogelijk gebeurde de introductie in België door natuurlijke verspreiding langs de Maas, of onopzettelijk tijdens het uitzetten van vissen afkomstig uit Nederland in Belgische waterlopen. Het is een soort die voorkomt in zoete tot brakke milieus, waar hij zich snel kan verspreiden.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Alien species

Gammarus tigrinus is a species which naturally occurs in North America. It is thought the species was mainly introduced in Europe via transportation in the ballast water of ships, as was the case in England in 1931. This species was also imported intentionally as fish food, for instance in Germany 1957. In 1991 the species was first reported in Belgium. It is possible that the introduction in Belgium occurred through natural expansion via the river Meuse or by accident by replacing fish stocks from The Netherlands into Belgium waters. It is a species that is found in fresh to brackish waters.
  • VLIZ Alien Species Consortium
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Gammarus tigrinus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 81 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNGACCCTTTATTTTATCTTAGGTGCTTGAGCAAGTGCCTTAGGCACTTCTTTAAGAGTTATTATCCGTACAGAGCTAAGGGCCCCAGGTAACTTAATTGGAGATGACCAATTATACAACGTTATAGTTACAGCCCACGCTTTTGTTATAATTTTCTTTATAGTTATACCTATTATAATCGGAGGATTTGGCAATTGATTGGTCCCTTTAATACTAGGTAGACCAGATATAGCTTTTCCGCGAATGAATAATATAAGATTTTGACTTCTGCCTCCTTCTCTTACTCTTTTATTAATAAGAGGAATAGTTGAAAGAGGAGTGGGGACTGGTTGAACTGTCTATCCTCCCCTAGCAGCCACAGTAGCTCATAGGGGCGGAGCAGTAGATCTAGCCATCTTTTCCCTTCATTTAGCCGGAGCATCTTCTATTCTGGGGGCTATTAATTTTATGTCTACTGTTATCAATATGCGAAGACCGCGAATATCATTTGACCAAATGCCTCTTTTTGTTTGGTCTGTATTTATTACAGCTATTCTACTACTTCTTTCTCTGCCCGTTTTAGCTGGGGCTATTACTATACTTTTAACAGATCGAAACCTTAATACTTCCTTCTTTGACCCTAGAGGTGGGGGAGACCCTATCTTGTACCAGCACCTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Gammarus tigrinus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 81
Specimens with Barcodes: 86
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!