Overview

Brief Summary

Biology

The common prawn is omnivorous. The sexes are separate, and breeding occurs between November and June. Fertilisation is external, and occurs as the eggs leave the female's body. The female then carries the eggs around attached to hairs on her pleopods, up to 4000 eggs are carried for around 4 months. The planktonic larvae settle in July or August and begin to breed in February of the next year (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

The common prawn is a well-known swimming crustacean, which is pinkish-brown in colour and features reddish spots and lines (2). The head and thorax are protected by a relatively thin carapace which, as in many species of prawns and shrimps, is drawn out into a projection between the eyes known as a 'rostrum' (2). The distinctive rostrum can be used to distinguish the common prawn from other species. In this species, the rostrum curves upwards, is divided in two at the tip with 6 or 7 teeth along its upper surface and 4 or 5 teeth on the underside (3). The first five segments of the abdomen bear fringed appendages known as pleopods or 'swimmerets' that are used to propel this prawn through the water. The first three appendages on the thorax are modified for use in feeding, and the remaining five pairs are known as the 'pereopods'. In this species, the first and second pairs of pereopods are tipped with pincers (2). This prawn may become infected with an isopod parasite which causes large swellings, a condition known as 'face-ache' (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Description

 Palaemon serratus is a typical prawn with a cylindrical body composed of a carapace at the front and six abdominal segments. It has a large upturned rostrum in front of the eyes with distinctive dorsal and ventral teeth. Just below the large compound eye on each side is the antennule, which is divided into three parts. Below the antennule is the antenna, which is divided into two parts; the short flat segment (scaphocerite) and the long whip-like flagellum. Palaemon serratus is translucent with red/brown lines on the carapace and abdomen. The first two pairs of walking legs bear claws (chela) and have yellow and red banding.Palaemon serratus could be mistaken for the similar species Palaemon elegans, Palaemon longirostris and Palaemon adspersus but can be separated by the shape of the rostrum and the number of dorsal and ventral rostral teeth.

British Isles Distribution
Recorded from Shetland and Orkney. Scarcely recorded on the northeast coast of Britain. Frequent on the west, south and south west coast of England and Wales and west coast of Scotland. Recorded from the west, south west, south and southeast coast of Ireland.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Scarce on north-east coast north of Thames
  • Hayward, P.J.; Ryland, J.S. (Ed.) (1990). The marine fauna of the British Isles and North-West Europe: 1. Introduction and protozoans to arthropods. Clarendon Press: Oxford, UK. ISBN 0-19-857356-1. 627 pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Found mainly around the south south-west and western coasts of Britain. Elsewhere it is found from Denmark to Mauritania, and is found in the Mediterranean and Black Seas (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Depth range based on 78 specimens in 1 taxon.
Water temperature and chemistry ranges based on 27 samples.

Environmental ranges
  Depth range (m): 0 - 125
  Temperature range (°C): 9.785 - 11.851
  Nitrate (umol/L): 4.573 - 8.645
  Salinity (PPS): 34.271 - 35.358
  Oxygen (ml/l): 5.806 - 6.346
  Phosphate (umol/l): 0.333 - 0.722
  Silicate (umol/l): 2.442 - 5.963

Graphical representation

Depth range (m): 0 - 125

Temperature range (°C): 9.785 - 11.851

Nitrate (umol/L): 4.573 - 8.645

Salinity (PPS): 34.271 - 35.358

Oxygen (ml/l): 5.806 - 6.346

Phosphate (umol/l): 0.333 - 0.722

Silicate (umol/l): 2.442 - 5.963
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

 Present usually in groups, in crevices and under stones from intertidal pools to the shallow subtidal. Also found in estuaries and seagrass beds. Found from the intertidal to depths of 40 m.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

This species occurs offshore to depths of around 40 m (2). It may also be found on the lower levels of the shore in rock-pools amongst seaweeds (2). It may also occur in the lower parts of estuaries (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Palaemon serratus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACTTTATATTTTATTTTTGGAGCTTGAGCAGGTATAGTAGGAACCTCTCTAAGACTCTTAATTCGAGCTGAATTAGGACAACCTGGGACATTAATTGGGAATGATCAAATTTATAATGTAGTTGTCACCGCCCATGCTTTTGTAATAATCTTCTTTATAGTTATGCCTATCATAATTGGGGGATTTGGAAATTGATTAGTGCCCCTTATATTAGGAGCCCCTGATATGGCTTTTCCTCGGATAAATAACATAAGATTCTGATTATTACCCCCCTCTTTAACTCTACTTCTTTCTAGAGGAATAGTAGAAAGTGGGGTAGGTACTGGATGAACTGTTTATCCACCCTTAGCAAGAGGTCTAGGACATGCAGGTGCTTCTGTAGATTTAGGCATCTTCTCCTTACACTTGGCAGGTGTGTCTTCTATCTTAGGAGCCGTTAATTTTATTACTACTGTAGTTAACATACGAGCTCCCGGTATAACTATAGACCGTACCCCGCTCTTTGTATGAGCAGTTTTCTTAACTGCAATCCTGCTTCTACTTTCGTTACCAGTTCTAGCTGGGGCTATTACTATACTTCTTACGGATCGTAACTTGAATACTTCATTCTTCGACCCAGCAGGGGGGGGTGACCCTATTCTTTATCAGCACTTATTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Palaemon serratus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

Status

Not threatened (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

This species is not threatened.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation

Conservation action is not needed for this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Palaemon serratus

Palaemon serratus, also called the common prawn, is a species of shrimp found in the Atlantic Ocean from Denmark to Mauritania, and in the Mediterranean Sea and Black Sea.[4]

Contents

Ecology[edit]

Individuals live for 3–5 years[5] in groups in rocky crevices at depths of up to 40 metres (130 ft).[6] Females grow faster than males, and the population is highly seasonal, with a pronounced peak in the autumn.[7] They are preyed upon by a variety of fish, including species of Mullidae, Moronidae, Sparidae and Batrachoididae.[8]

Description[edit]

P. serratus may be distinguished from other species of shrimp by the rostrum, which curves upwards, is bifurcated at the tip and has 6–7 along its upper edge, and 4–5 teeth on the lower edge.[4] Other speciesmay have a slightly curved rostrum, but then the teeth on its dorsal surface continue into the distal third, which is untoothed in P. serratus.[9] P. serratus is pinkish brown, with reddish patterns, and is typically 100 millimetres (3.9 in) long, making it the largest of the native shrimp and prawns around the British Isles.[10]

P. serratus is one of the few invertebrates to have its hearing studied in detail; it is sensitive to frequencies between 100 Hz and 3kHz, with an acuity similar to that of generalist fish.[11] While the hearing range of a P. serrratus individual changes as it grows, all are capable of hearing tones at 500 Hz.[12]

Fisheries[edit]

A small commercial fishery exists for P. serratus on the west coast of Great Britain,[5] chiefly in West Wales (Cemaes Head to the Llŷn Peninsula),[13] but extending increasingly far north to include parts of Scotland.[14] In Ireland, fishing for P. serratus began at Baltimore, County Cork in the 1970s and subsequently expanded. A peak landing of 548 t was recorded in 1999, and four counties account for over 90% of the catch — Galway, Kerry, Cork and Waterford.[15] There is now concern that the current levels of exploitation may represent overfishing, and measures are being considered to limit the catch, such as a minimum landing size.[13]

References[edit]

  1. ^ "Palaemon serratus". Integrated Taxonomic Information System. 
  2. ^ "Palaemon serratus (Pennant, 1777)". 2008 Annual Checklist. Catalogue of Life. 
  3. ^ "Palaemon serratus". Aquaculture Compendium. CAB International. 2006. 
  4. ^ a b "Common prawn (Palaemon serratus)". ARKive. Retrieved January 31, 2009. 
  5. ^ a b Torry Research Station. "Handling and processing shrimp". Torry Advisory Notes — No. 54. Food and Agriculture Organization. 
  6. ^ "Marine Irish Digital Atlas". University College Cork. Retrieved 2009-01-31. 
  7. ^ Guillermo Guerao & Carlos Ribera (2000). "Population characteristics of the prawn Palaemon serratus (Decapoda, Palaemonidae) in a shallow Mediterranean bay". Crustaceana 73 (4): 459–468. doi:10.1163/156854000504543. 
  8. ^ Rita Sá, Constança Bexigaa, Pedro Veigaa, Lina Vieiraa & Karim Erzini (2006). "Feeding ecology and trophic relationships of fish species in the lower Guadiana River Estuary and Castro Marim e Vila Real de Santo António salt marsh". Estuarine, Coastal and Shelf Science 70 (1–2): 19–26. doi:10.1016/j.ecss.2006.05.038. 
  9. ^ Christopher W. Ashelby, Tim M. Worsfold & Charles H. J. M. Fransen (2004). "First records of the oriental prawn Palaemon macrodactylus (Decapoda: Caridea), an alien species in European waters, with a revised key to British Palaemonidae". Journal of the Marine Biological Association of the United Kingdom 84 (5): 1041–1050. doi:10.1017/S0025315404010392h. 
  10. ^ M. R. Reeve (1968). "The suitability of the English prawn Palaemon serratus (Pennant) for cultivation — a preliminary assessment". FAO Fisheries Report (Food and Agriculture Organization) R57 (3): 582 pp. 
  11. ^ J. M. Lovella, M. M. Findlaya, R. M. Moateb & H. Y. Yan (2005). "The hearing abilities of the prawn Palaemon serratus". Comparative Biochemistry and Physiology, Part A 140 (1): 89–100. doi:10.1016/j.cbpb.2004.11.003. PMID 15664317. 
  12. ^ J. M. Lovell, R. M. Moate, L. Christiansen & M. M. Findlay (2006). "The relationship between body size and evoked potentials from the statocysts of the prawn Palaemon serratus". Journal of Experimental Biology 209 (Pt 13): 2480–2485. doi:10.1242/jeb.02211. PMID 16788031. 
  13. ^ a b Jeremy Percy (2006). "The Welsh coastal Palaemon prawn fisheries — a consideration of future possible actions". North Western & North Wales Sea Fisheries Committee. 
  14. ^ "Palaemon serratus: sustainable development". Seafish. Retrieved January 31, 2009. 
  15. ^ Edward Fahy, Niamh Forrest, Ruth Mortimer & Jim Carroll (2006). "Indicators of performance in the fishery for shrimp Palaemon serratus (Pennant) in Irish Coastal Waters". Journal of Shellfish Research 25 (3): 1021–1026. doi:10.2983/0730-8000(2006)25[1021:IOPITF]2.0.CO;2. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!