Molecular Biology and Genetics

Molecular Biology

Barcode data: Thermobia domestica

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CAACGATGATTATTTTCTACAAACCATAAAGATATTGGTACAATATACTTAATTTTTGGGGCTTGAGCAGGAATAGTAGGAACATCACTAAGTCTTCTTATTCGAGCAGAGCTTGGTCGGCCAGGTAGTCTAATTGGTGAT---GATCAAATTTATAATGTAATTGTTACTGCTCATGCTTTTATTATAATTTTCTTCATAGTTATGCCAATTATAATTGGGGGCTTCGGTAATTGATTAGTACCCTTAATACTAGGGGCGCCCGATATAGCATTCCCCCGTCTAAACAACATAAGATTCTGATTACTACCGCCCTCACTAACCCTACTATTAACAGGAAGAATTGTAGAGAGTGGTGCGGGAACAGGGTGAACTGTATATCCCCCTCTTTCTAGAGCTATTGCTCACGCCGGAGCCTCTGTCGATCTTTCTATTTTCTCTCTCCATCTAGCCGGTGTATCCTCAATTCTTGGTGCAGTAAATTTTATTACAACTGTAATTAACATGCGAACTCCTGGAATAACCTTAGAACGAATACCATTATTTGTTTGATCTGTAGTAATTACTGCTGTATTGCTTCTTTTATCCCTTCCCGTGCTAGCAGGGGCTATTACAATGCTCTTAACTGATCGAAATCTTAATACCTCCTTCTTTGATCCTTCAGGAGGAGGAGATCCAATTTTATATCAACACCTATTCTGGTTCTTCGGTCATCCTGAAGTTTACATTTTAATTCTTCCAGGATTCGGTATAATTTCACATATTGTAACCCAAGAAAGTGGTAAAAAGGAAACTTTCGGTGTTTTAGGAATAATTTATGCAATACTAGCAATTGGATTCTTAGGATTTATTGTATGGGCTCACCATATGTTCACTGTTGGTATAGACGTTGACACTCGCG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Thermobia domestica

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Firebrat

The Firebrat (Thermobia domestica, sometimes listed as Thermophila furnorum) is a small insect (typically 1–1.5 cm) similar to the Silverfish, both in the order Thysanura.

Firebrats prefer higher temperatures and require some humidity, and can be found in bakeries and near boilers or furnaces. They feed on a wide variety of carbohydrates and starches that are also protein sources such as dog food, flour and book bindings. They are distributed throughout most parts of the world and are normally found outdoors under rocks, leaf litter, and in similar environments, but are also often found indoors where they are considered pests. They do not cause major damage, but they can contaminate food, damage paper goods, and stain clothing. Otherwise they are mostly harmless.

At 1 12 to 4 12 months of age the female firebrat begins laying eggs if the temperature is right (32–41 °C or 90–106 °F). It may lay up to 10,000,000 eggs in a lifetime of about 3–5 years. After incubation (12–13 days), the nymphs hatch. They may reach maturity in as little as 2–4 months, resulting in several generations each year.

References[edit]

External references[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!