Overview

Brief Summary

The spot-tail mantis shrimp (Squilla mantis) is one of about 25 members of the genus Squilla, which despite their name are not closely related to shrimp.  These crustaceans live in warm and temperate shallow waters of the Mediterranean and Eastern Atlantic from the Gulf of Cadiz, Spain, as far south as Angola, including islands off the African coast. Benthic animals, they dig U-shaped burrows into soft sandy mud or fine sand substrates, especially near fresh river outlets, usually at depths less than 150 m (500 feet) but they have been found up to a recorded 367 m (1204 feet).

Like other mantis shrimp, S. mantis is a nocturnal predator of small crustaceans, molluscs, polychaetes and fishes, but stomach content studies also show it to eat algae and foraminifera indicating that it is an opportunistic feeder.  About 40% of S. mantis burrows contain the alpheid shrimp Athanas amazone somehow living in association (presumed to be an obligate association for A. amazone) although their relationship is not clear as the mantis shrimp eats prey items of the same size as A. amazone (Froglia and Atkinson 1998).  

The spot-tail mantis shrimp grows to about 40 cm (15 inches) long, a size thought correlated only with its upper age limit, about 3 years.  More typically they are seen up to 30 mm (10 inches) long.  It has two characteristic brown spots at the base of its tail fan (telson).  An abundant species in the Mediterranean, it is commercially fished on a small scale, especially in the Italian Adriatic Sea and is the only of the 10 Mediterranean stomatopods that has any economic importance.  Caught as winter-spring by-catch in bottom trawls where night trawling is allowed, it is a successful fishery around large river mouths because it occurs in high densities, but is to date unregulated.  Squilla mantis is commercialized fresh; in Italy where it is most commonly found in fish markets it is called sea-grasshopper, or cicale di mare (Maynou et al. 2004; My Italian Cuisine, 2012)

  • Froglia, C and R.J.A. Atkinson 1998. Association between Athanas amazone (Decapoda: Alpheidae) and Squilla mantis (Stomatopoda: Squillidae). Journal of Crustacean Biology 18(3): 529-532.
  • Maynou, F., P. Abelló and P. Sartor (2004). "A review of the fisheries biology of the mantis shrimp, Squilla mantis (L., 1758) (Stomatopoda, Squillidae) in the Mediterranean". Crustaceana 77 (9): 1081–1099. doi:10.1163/1568540042900295.
  • My Italian Cuisine, January 10, 2012. Sea Grasshoppers Gratin (Cicale di mare gratinate). Retrieved November 14 2013 from http://myitaliancuisine.blogspot.com/2012/01/sea-grasshoppers-gratin-cicale-di-mare.html.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Dana Campbell

Supplier: Dana Campbell

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Depth range based on 71 specimens in 1 taxon.
Water temperature and chemistry ranges based on 7 samples.

Environmental ranges
  Depth range (m): 6 - 143
  Temperature range (°C): 14.009 - 24.389
  Nitrate (umol/L): 1.324 - 14.917
  Salinity (PPS): 35.355 - 38.232
  Oxygen (ml/l): 2.288 - 5.426
  Phosphate (umol/l): 0.096 - 1.236
  Silicate (umol/l): 2.621 - 8.943

Graphical representation

Depth range (m): 6 - 143

Temperature range (°C): 14.009 - 24.389

Nitrate (umol/L): 1.324 - 14.917

Salinity (PPS): 35.355 - 38.232

Oxygen (ml/l): 2.288 - 5.426

Phosphate (umol/l): 0.096 - 1.236

Silicate (umol/l): 2.621 - 8.943
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Squilla mantis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CGACGATGATTATTTTCTACAAATCATAAAGATATTGGAACTTTATATTTCATTCTAGGGGCTTGATCAGGAATAGTAGGGACAGCCCTTAGTTTGATTATTCGAGCTGAGCTAGGTCAACCAGGTAGGTTAATTGGAGAT---GACCAAATCTACAATGTTATCGTTACAGCACACGCTTTTGTTATAATTTTTTTTATAGTTATACCTATTATAATTGGGGGGTTTGGAAACTGATTAGTGCCTTTAATATTAGGGGCCCCTGATATAGCATTCCCCCGTATAAATAACATAAGATTTTGATTACTACCTCCCGCACTCACCTTATTATTATCTAGGGGCTTAGTTGAAAGAGGGGTTGGTACTGGATGAACAGTTTATCCCCCTTTATCAGCAGGAATTGCGCATGCCGGGGCTTCTGTAGATATGGGTATTTTCTCTTTACATTTAGCAGGAGCTTCTTCAATTTTAGGAGCTGTAAATTTCATTACTACGGTAATTAATATACGATCAAACGGAATGACTATAGACCGTATACCTTTATTTGTGTGGTCTGTTTTCATTACAGCAATTTTACTACTTTTATCACTACCTGTTTTAGCGGGTGCCATTACCATACTACTAACAGACCGTAATTTAAACACATCGTTTTTTGATCCTGCTGGAGGGGGAGACCCTGTACTATATCAACATTTATTTTGGTTTTTCGGGCACCCTGAGGTTTATATTTTAATTTTACCTGCTTTTGGCCTAATTTCACACATTGTTAGCCAAGAATCAGGAAAGAAGGAGACTTTTGGAACATTAGGAATAATTTATGCTATATTGGCAATTGGGGTATTAGGGTTTGTTGTATGAGCCCACCATATATTCACTGTGGGTATGGATGTAGACACCCGAG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Squilla mantis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 27
Specimens with Barcodes: 28
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Squilla mantis

Squilla mantis is a species of mantis shrimp found in shallow coastal areas of the Mediterranean Sea and the Eastern Atlantic Ocean. Its abundance has led to it being the only commercially fished mantis shrimp in the Mediterranean.

Description[edit]

Individuals grow up to 200 millimetres (8 in) long,[2] and is of the spearer type.[3] It is generally dull brown in colouration, but has two brown eye spots, circled in white, at the base of the telson.[4] Other species – including smashers – are also sold in the aquarium trade as Squilla mantis.[5]

Distribution and ecology[edit]

Front half of S. mantis, showing the (pale-coloured) spearing raptorial claws

S. mantis digs burrows in muddy and sandy bottoms near the coasts of the Mediterranean Sea and adjacent warm parts of the eastern Atlantic Ocean.[2] It remains in its burrow during the day and comes out at night to hunt, and in the winter to mate.[6]

It is found around the entire coast of the Mediterranean, and in the Atlantic Ocean south from the Gulf of Cádiz to Angola, as well as around the Canary Islands, and Madeira. It has historically been recorded from the Bay of Biscay and the British Isles, but is not known to occur there any more.[6] It is particularly abundant where there is significant run-off from rivers, and where the substrate is suitable for burrowing. In the Mediterranean, the outflows from the Nile, Po, Ebro and Rhône provide these conditions.[6]

The alpheid shrimp Athanas amazone often lives in the burrows of S. mantis, despite being of a similar size to other shrimp which S. mantis feeds on.[7] The relationship between the two species remains unknown, although a second similar case has been reported for the species Athanas squillophilus in the burrows of Oratosquilla oratoria in Japanese waters.[8]

Fishery[edit]

Squilla mantis for sale at a Catalan market

S. mantis is the only native stomatopod to be fished for on a commercial scale in the Mediterranean. Over 7,000 t is caught annually, 85% of which is caught on Italian shores of the Adriatic Sea,[9] with further production in the Ionian Sea, off Sardinia, off the coast of Catalonia and off the Balearic Islands.

References[edit]

  1. ^ WoRMS (2011). "Squilla mantis (Linnaeus, 1758)". World Register of Marine Species. Retrieved November 25, 2011. 
  2. ^ a b Cédric d'Udekem d'Acoz (2003). "Squilla mantis". Crustikon – Crustacean photographic website. Tromsø MuseumUniversity of Tromsø. Archived from the original on October 14, 2008. Retrieved August 26, 2007. 
  3. ^ Roy Caldwell. "External anatomy and explanatory notes". Roy's List of Stomatopods for the Aquarium. University of California Museum of Paleontology. Retrieved August 26, 2007. 
  4. ^ Wolfgang Schneider (1990). "Stomatopods". Field Guide to the Commercial Marine Resources of the Gulf of Guinea. FAO Regional Office for Africa. p. 191. ISBN 92-5-103048-0. 
  5. ^ "Mantis shrimp". togar.de. Retrieved August 26, 2007. 
  6. ^ a b c F. Maynou, P. Abelló & P. Sartor (2004). "A review of the fisheries biology of the mantis shrimp, Squilla mantis (L., 1758) (Stomatopoda, Squillidae) in the Mediterranean". Crustaceana 77 (9): 1081–1099. doi:10.1163/1568540042900295. 
  7. ^ C. Froglia, R. James & A. Atkinson (1998). "Association between Athanas amazone (Decapoda: Alpheidae) and Squilla mantis (Stomatopoda: Squillidae)". Journal of Crustacean Biology 18 (3): 529–532. doi:10.2307/1549417. JSTOR 1549417. 
  8. ^ K.-I. Hayashi (2002). "A new species of the genus Athanas (Decapoda, Caridea, Alpheidae) living in the burrows of a mantis shrimp". Crustaceana 75 (3–4): 395–403. doi:10.1163/156854002760095462. 
  9. ^ "Global Production Statistics 1950-2005". Food and Agriculture Organization. Retrieved August 26, 2007. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!