Ecology

Habitat

Depth range based on 10 specimens in 1 taxon.
Water temperature and chemistry ranges based on 10 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 18.557 - 22.334
  Nitrate (umol/L): 0.079 - 0.976
  Salinity (PPS): 36.333 - 37.070
  Oxygen (ml/l): 5.094 - 5.452
  Phosphate (umol/l): 0.052 - 0.095
  Silicate (umol/l): 0.803 - 1.143

Graphical representation

Temperature range (°C): 18.557 - 22.334

Nitrate (umol/L): 0.079 - 0.976

Salinity (PPS): 36.333 - 37.070

Oxygen (ml/l): 5.094 - 5.452

Phosphate (umol/l): 0.052 - 0.095

Silicate (umol/l): 0.803 - 1.143
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Ebalia nux

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 7 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TACATTATATTTTATTTTTGGAGCCTGAGCAGGTATAGTAGGCACCTCTTTAAGACTTATTATCCGAGCCGAATTAGGCCAACCAGGAACATTAATTGGTAATGACCAAATTTATAATGTAGTAGTTACCGCTCACGCATTTGTAATAATTTTCTTCATAGTTATACCTATTATAATTGGTGGCTTTGGTAATTGATTAATTCCTCTTATATTAGGAGCTCCTGATATAGCCTTCCCTCGAATAAATAATATAAGATTTTGACTCCTACCTCCTTCTCTAACCCTTTTATTGATAAGAGGAATAGTAGAAAGGGGAGTTGGAACTGGATGAACTGTTTACCCACCTTTGGCTAGAGCCATCGCGCACTCCGGCGCTTCGGTTGATATAGGGATCTTTTCTTTACATTTAGCTGGTGTTTCTTCAATTTTAGGAGCTATTAACTTTATAACAACAGTTATTAATATACGATCTTTTGGTATATCTTTGGACCAAATACCTTTATTCGTTTGAGCTGTTTTTATTACAGCTATTTTATTACTTTTATCCTTACCTGTCCTAGCCGGCGCCATTACTATACTCCTTACCGATCGAAATTTAAATACTTCCTTTTTTGACCCAGCAGGAGGGGGAGATCCTATTTTATACCAGCATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Ebalia nux

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 7
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!