Overview

Comprehensive Description

Description

Acanthcphyra sica, n. sp. (PI. CXXV. fig. 1).

 

Dorsal surface of the pleon slightly arched, the four posterior somites terminating in small dorsal teeth, of which the anterior is occasionally slightly the largest.

 

Carapace smooth, slightly carinated dorsally, and produced anteriorly to a rostrum that is equal in length to the carapace, and armed on the upper surface with nine or ten widely separated small teeth, the posterior being closer to one another than the others, and with five on the lower corresponding with the anterior five on the dorsal surface.

 

Ophthalniopoda pear-shaped and not very large.

 

First pair of antennæ having the first joint deeply excavated for the reception of the ophthalniopoda, and having a thick stylocerite that is sharply pointed, and about as long as the ophthalmopod; the two following joints are short, cylindrical, and carry two flagella that are a little longer than the rostrum.

 

Second pair carrying a slender flagellum that is as long as the animal, and a rigid scaphocerite that gradually narrows to the extremity, where it terminates in a sharp point; at its base, standing on the margin of the second joint, are two short but strong and sharp teeth, one above the scaphocerite, and the other below it.

 

Mandible broad, and having the teeth on the incisive margin regularly serrate, the central one being the most prominent. The molar process is triangulate, and the synaphipod has the terminal joint short, broad, and tipped with hairs.

 

There is nothing very remarkable in the form of the gnathopoda or pereiopoda besides their generic features.

 

Posterior pair of pleopoda having the branches narrow, pointed, and scarcely as long as the telson; outer branch longer than the inner, and having a well-defined broad ridge, the outer side terminating in a small tooth corresponding with the diaeresis.

 

Telson long and narrow, longitudinally channelled on the dorsal surface, and armed at the lateral margins with nine or ten short articulating spines.

 

 

                                           
 

 
 

Female.

 
 

Male.

 
 

Length, entire

 
 

85mm (3.4in)

 
 

63 mm (2.5in)

 
 

Length of carapace

 
 

21 mm

 
 

16 mm

 
 

Length of rostrum

 
 

21 mm

 
 

17 mm

 
 

Length of pleon

 
 

64 mm

 
 

47 mm

 
 

Length of third somite of pleon

 
 

12 mm

 
 

8 mm

 
 

Length of sixth somite of pleon

 
 

14 mm

 
 

10 mm

 
 

Length of teleson

 
 

18 mm

 
 

12 mm

 
  

Habitat— Station 168, July 8, 1874; lat. 40° 28' S., long. 177° 43' E.; off New Zealand; depth, 1100 fathoms; bottom, blue mud; bottom temperature, 37°.2. Four specimens; one male, three females. Trawled.

 

Station 40, April 28, 1873; lat. 34° 51' N., long. 68° 30' W.; north-west of Bermuda; depth, 2675 fathoms; bottom, blue mud. One specimen. Dredged. ||

 

Station 159, March 10, 1874; lat. 47° 25' S., long. 130° 22' E.; south of Australia; depth, 2150 fathoms; bottom, Globigerina ooze; bottom temperature, 34°.5. Two specimens; males. Trawled.

 

Station 169, July 10, 1874; lat. 37° 34' S., long. 179° 22' E.; near New Zealand; depth, 700 fathoms; bottom, blue mud; bottom temperature, 40°. Three specimens; one male (damaged), two females. Trawled.

 

Station 170, July 14, 1874; lat. 29° 55' S., long. 178° 14' W.; off the Kermadec Islands; depth, 520 fathoms; bottom, volcanic mud; bottom temperature, 43°. One specimen; male. Trawled.

 

Station 170a, July 14, 1874 ; lat. 29° 45' S., long. 178° 11' W.; near the Kermadec Islands; depth, 630 fathoms; bottom, volcanic mud; bottom temperature, 39°.5. Trawled.

 

Station 181, August 25, 1875 ; lat. 13° 50' S., long. 151° 49' E.; between Australia and the Solomon Islands; depth, 2440 fathoms; bottom, red clay; bottom temperature, 35°.8. One specimen; male. Trawled.

 

Station 194, September 29, 1874; lat. 4° 34' 0" S., long. 129° 57' 30" E.; off Banda Island; depth, 200 fathoms; bottom, volcanic mud. Four specimens; damaged. Dredged.

 

Station 230, April 5, 1875; lat. 26° 29' N., long. 137° 57' E.; south of Japan; depth, 2425 fathoms; bottom, red clay; bottom temperature, 35°.5. Two specimens; males. Trawled.

 

Station 235, June 4, 1875; lat. 34° 7' N., long. 138° 0' E.; south of Japan; depth, 565 fathoms; bottom, green mud; bottom temperature, 38°.1. Two specimens; one male, one female. Trawled.

 

Station 318, February 11, 1876; lat. 42° 32' S., long. 56° 29' W.; north of the Falkland Islands; depth, 2040 fathoms; bottom, blue mud; bottom temperature, 33°.7. One fine specimen; male. Trawled. Length, 84 mm.

 

When the animal is fully extended the carapace is about one-fourth the length of the animal, measured from the orbital margin to the extremity of the telson. The postero-lateral margins of the carapace pass under the coxal plates of the first somite of the pleon. A small carina traverses the dorsal surface from the cardiac region forwards, and is lost in the serrature of the rostrum. The rostrum projects forwards to a length that is subequal with the carapace, and is armed on the upper surface with ten small teeth that are closer together near the frontal region and more distant anteriorly; the under surface is armed with five teeth that coincide with the same number, tooth for tooth, on the upper surface, except the most anterior on the upper surface, which has no corresponding tooth on the lower. The outer canthus of the orbit is clearly defined by a rounded angle, and the first antennal tooth is small, and lies closely impacted between the bases || of the first and second pairs of antennæ. The second antennal tooth is also small, and continued as an angular ridge posteriorly to the hepatic fissure.

 

The pleon is carinated, the first somite is smooth, and separated into two portions, the anterior portion is equal in length to the posterior, and passes under the dorsal surface of the carapace, so as to be entirely hidden when the animal is extended, and the coxal plate overrides the lateral walls of the carapace, and has the anterior margin, which is as deep as the carapace, excavate to correspond with the curve of the latter. The second somite is also dorsally divided into two portions, of which the anterior passes beneath the first when the animal is extended; it is dorsally carinated on the posterior division, the carina commencing and terminating abruptly, the posterior extremity in the median line being emarginate to admit the anterior edge of the carina of the following somite. The third somite is also divided into two portions, of which the anterior,
that passes under the preceding somite, is much smaller than the posterior, which is strongly carinated, the carina commencing abruptly with the posterior division, and continuing posteriorly to a small, laterally compressed tooth. The fourth and fifth somites resemble the third, but have no anterior division, and the dorsal carina and dental elevation are less conspicuous. The sixth somite is nearly as long as the preceding two, and like them is dorsally carinated and posteriorly produced to a tooth, and the coxal plates are either wanting or reduced to a minimum condition, as the lateral walls of the somite are continuous with the ventral surface.

 

The telson (fig. 1z) is narrow, tapering, and considerably longer than the sixth somite, and not much shorter than the carapace; it is dorsally grooved from just beyond the base to just within the apex, the sides are longitudinally depressed suddenly, and armed on the distal half with nine separate small spinules, and terminally with four.

 

The ophthalmopoda (fig. 1a) are somewhat pyriform and supported upon a small pedicle, from which they suddenly enlarge; they are slightly compressed laterally, and increase in size as they approach the ophthalmus, which is orbicular, and separated by a constriction from the base on which it stands, and which projects to a small tubercle on the inner side, and carries a small and somewhat imperfect ocellus on the posterior part, connected by a thin line of pigment with the ophthalmus.

 

The first pair of antennæ (fig. 1b) has the peduncle short or about a fourth of the length of the rostrum. The first joint is deeply hollowed on the upper surface to receive the ophthalmopod, and carries a stylocerite that is shorter than the first joint, and has the outer wall perpendicular, the apex of which is suddenly narrowed to a small sharp tooth, and the base strengthened by two small tubercles that project upon the dorsal surface between the outer canthus of the orbit and the first antennal tooth, against which the outer surface of the stylocerite presses and receives support when the antennæ are directed outwards. The second and third joints are short and cylindrical, and support two flagella, of which the outer is much larger in both sexes than the inner; the latter is || slender, cylindrical, and a little longer than the carapace, the former is broad at the base, and then suddenly tapers to a slender termination which is subequal with the inner in length; the lower surface is thickly matted with closely packed membranous cilia that stand on the rounded surface, and not in a hollow as in some genera.

 

The second pair of antennæ (fig. 1c) carries a long and pointed scaphocerite that is but little shorter than the rostrum; the inner or foliaceous portion tapers to the apex, where it gradually merges into the strong distal tooth; the outer margin is strengthened by a ridge which falls between two rigid and strong teeth standing on the outer and distal margin of the second joint of the peduncle. On the outer side of the ridge the upper tooth checks the backward action of the outwardly extended scaphocerite by falling into a longitudinal groove (fig. 1c"), and pressing against the elevated ridge on that side, and so making this organ an efficient weapon of offence.

 

The mandibles (fig. 1d) are deeply embedded in the oral cavity between the cheiloglossa in front (ch.a), which extends into and fills the cavity between the mandibles (d) and the metastomata (m.a.), which falls against them posteriorly. The psalistoma is broad, thin, concavo-convex, and serrate at the margin; it is continuous with the molar process, and carries a two-jointed synaphipod, of which the first joint is long, and the second short and disc-shaped.

 

The first pair of siagnopoda (fig. 1e) does not differ much from that of other allied genera; it is small, of considerable tenuity, and three-branched, the two inner branches being tipped with short, stiff spinules, and the outer smooth, membranous, and obtusely pointed.

 

The second pair (fig. 1f) consists of three broad plates of extreme tenuity, and one short and narrow; one of the inner plates is divided into two, and fringed on the inner margin with numerous closely packed short spinules, the inner basal one with long and slender hairs; the central is short, narrow, and obtusely pointed, and the outer is developed into a large mastigobranchial plate of extreme tenuity, and fringed with cilia, all directed anteriorly in a centrifugal manner.

 

The third pair of siagnopoda (fig. 1g) has three plates; the outer plate is broad, curved, and of great tenuity, and fringed with hairs; the concave inner margin is reflexed at nearly right angles longitudinally; at the base is a bifid mastigobranchial plate, free from hairs or cilia.

 

The first pair of gnathopoda is subpediform and seven-jointed; the terminal joints are reflexed, the basis carrying a long ecphysis, and the coxa a small mastigobranchial plate and podobranchial plume.

 

The second pair (fig. 1i) is pediform and five-jointed; the coxa carries a lunate disc-like plate, of which the upper horn is bifid, while to the lower horn is attached a short and rudimentary membranous mastigobranchial plate, and near the centre of the crescent a small podobranchial plume. The basis carries a slender ecphysis that is two-thirds of || the length of the next succeeding joint, which consists most probably of the ischium and meros united, and is curved to leave space for the oral appendages. The next joint is long and narrow, and probably represents the carpos, and the terminal joint is long, slender, and straight, obliquely truncate, and laterally fringed with a soft fur of short hair.

 

The first and second pairs of pereiopoda are chelate, the anterior pair is slightly shorter than the succeeding, and a little more robust; the carpos is long, nearly as long as the propodos, which is not larger in diameter, and terminates in two closely impinging fingers, of which the movable dactylos is more curved than the fixed pollex. The third, fourth, and fifth pairs of pereiopoda are simple and rather short, being scarcely longer than the first two pairs; the ischium and meros are rather stout, and the carpos is long; the third and fourth pairs terminate in a long and slender dactylos, while in the fifth pair it is short and supported by a brush of hair. All the pereiopoda, including the chelate pairs, and also the gnathopoda, carry a slender basecphysis that lessens in length on each posteriorly, but is never rudimentary, and all excepting the posterior pair carry a mastigobranchial appendage, which, though small, is sufficiently long to penetrate to about half their length between the branchial plumes, and fulfil, we may assume, some efficient duty connected with respiration.

 

The pleopoda are biramose, having a short basal joint and narrow, subfoliaceous, flexible branches ; the inner in the female carries a long stylamblys tipped with a bundle of cincinnuli, except in the case of the first pair, which has the inner ramus reduced to a rudimentary condition and thickly fringed with plumose hairs, and without a stylamblys such as is present in Acanthephyra armata. The posterior pair of pleopoda, which forms the lateral plates of the rhipidura, is narrow and subequal in length to the telson, and the outer angle of the diseresis is armed with a tooth and small spinule.

 

The eggs are ovate and numerous, and of moderate dimensions.

 

The branchiæ are generic in character.

 

Observations. — This species appears to be both abundant and widely distributed; it was taken by the Challenger at eleven stations, more or less distant from one another, — in the Atlantic and Pacific Oceans, as far north as Japan, and as far south as New Zealand. It is a more perfect representative of the genus than Acanthephyra armata. Its bathymetrical range is also great, since it has been taken at a distance of from less than half a mile to about three miles from the surface of the ocean. It appears to be very prolific also, since some of the females that were captured carry a large number of small eggs.

 

The specimen taken at Station 318 in the South Atlantic Ocean is a variety that approximates somewhat both in size and features to Acanthephyra acanthitelsonis, which was taken in Mid Atlantic near the equator. It differs from the typical form in being larger, in having only three teeth on the lower margin of the rostrum, two of which || are near the apex, while the third stands alone near the centre of the rostrum, and none of them correspond with any on the upper margin, but stand nearly equidistant between them. It was taken associated with four specimens of Acanthephyra brachytelsonis.”

 

(Bate, 1888)

 

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© National Museum of Natural History, Smithsonian Institution

Source: Antarctic Invertebrates Website (NMNH)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Latitude 64° (Davis Strait) to 13°N
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Known from seamounts and knolls
  • Stocks, K. 2009. Seamounts Online: an online information system for seamount biology. Version 2009-1. World Wide Web electronic publication.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 640 specimens in 1 taxon.
Water temperature and chemistry ranges based on 593 samples.

Environmental ranges
  Depth range (m): 48 - 5330
  Temperature range (°C): 0.944 - 20.865
  Nitrate (umol/L): 0.287 - 42.474
  Salinity (PPS): 34.195 - 38.973
  Oxygen (ml/l): 0.764 - 6.623
  Phosphate (umol/l): 0.033 - 3.060
  Silicate (umol/l): 0.755 - 174.839

Graphical representation

Depth range (m): 48 - 5330

Temperature range (°C): 0.944 - 20.865

Nitrate (umol/L): 0.287 - 42.474

Salinity (PPS): 34.195 - 38.973

Oxygen (ml/l): 0.764 - 6.623

Phosphate (umol/l): 0.033 - 3.060

Silicate (umol/l): 0.755 - 174.839
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Acanthephyra pelagica

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACACTATACTTCATTTTTGGTGCATGAGCCGGAATAGTAGGTACTGCCTTAAGACTCCTAATTCGAGCTGAGCTTGGACAGCCAGGAAGCTTGATTGGAAACGATCAAATCTATAATGTCATCGTAACTGCCCACGCCTTTGTAATAATTTTTTTCATAGTTATACCAATTATGATTGGAGGGTTTGGAAATTGATTACTCCCCTTAATATTAGGAGCCCCTGATATGGCTTTCCCCCGAATAAATAATATAAGATTCTGACTCCTACCCCCCTCTTTAACACTTTTATTATCTAGAGGAATAGTAGAAAGAGGAGTGGGAACAGGTTGAACAGTTTATCCACCCTTAGCCGCAGGTATTGCTCACGCAGGAGCTTCTGTTGATATAGGAATTTTCTCACTCCACCTTGCGGGTGTCTCCTCAATTTTAGGATCAGTTAATTTTATAACTACTGTTATTAATATACGAAGAAGAGGAATAACAATAGACCGAATTCCACTTTTTGTTTGGTCAGTATTCCTAACTACAATTCTTCTACTTCTCTCTCTGCCTGTTTTAGCAGGAGCTATCACTATACTCCTTACAGATCGAAATTTAAATACCTCATTTTTTGACCCTGCTGGAGGTGGAGACCCTATTTTATACCAACATTTATT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Acanthephyra pelagica

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 11
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!