Articles on this page are available in 1 other language: Dutch (1) (learn more)

Overview

Brief Summary

The edible crab is the 'muscle (wo)man' among the crabs. It is very wide, has large claws, a thick carapace and trusts its sturdy body to protect it from enemies. Edible crabs eat everything, however they are specialized in cracking shellfish. Their pincers are slow but strong. They can easily crack a pencil. The edible crab is the only crab species of commercial interest in the Netherlands. The meat in the claws is considered a true delicacy in some countries.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biology

Adult edible crabs take a very wide range of prey species, and are important predators of molluscs (2). When on sediments, these crabs dig large pits in order to find food (4). Females reach maturity at carapace widths of 12.7 cm, whereas in males the figure is closer to 11 cm (2). Breeding takes place in winter. For a period before mating, the male holds onto a female until she moults. After moulting she is receptive to mating and copulation takes place. The female digs a pit in the sediment which she retreats into to lays the eggs. She then carries the fertilised eggs for seven to eight months before they hatch in spring or summer. Large female can carry a staggering 20 million eggs at any one time. After hatching, the larvae are planktonic for up to 30 days. Edible crabs are known to live up to 20 years of age (2). The edible crab is the most commercially important species of crab in western Europe (6). It is fished offshore using baited pots (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

The common and familiar edible crab is easily identified by its large black-tipped toothed pincers and characteristic 'pie-crust' edging (3). It is the largest crab in Britain, and the heavy oval-shaped body is reddish-brown in colour (4). Although most individuals measure around 15 cm in width (3), a specimen in the Natural History Museum in Paris has a width of 28.5 cm (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

 Crab with a heavy, oval shaped body, easily distinguished from other species by its 'piecrust' edge and massive black tipped pincers. It is reddish-brown in colour with very large individuals having a carapace width of up to 25 cm although individuals are typically up to 15 cm.Also known as the brown crab.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Adriatic Sea, Atlantic, Azores Exclusive Economic Zone, Belgian Exclusive Economic Zone, Birkenfels (shipwreck), Blankenberge, British Isles, Canada, De Haan, De Panne, Dutch Exclusive Economic Zone, European waters (ERMS scope), FAO fishing area 34, FAO fishing area 47, Greek Exclusive Economic Zone, Irish Exclusive economic Zone, Knokke, Knokke-Heist, Mediterranean Sea, Moroccan Exclusive Economic Zone, Nieuwpoort, North Coast of Norway, North East Atlantic, North Sea, Norwegian Exclusive Economic Zone, Oostduinkerke, Oostende, Oosterschelde, Pacific Ocean, Portuguese Exclusive Economic Zone, Schelde estuary, Swedish Exclusive Economic Zone, United Kingdom, United Kingdom Exclusive Economic Zone, USA, Voordelta, Wadden Sea, West Africa, West Coast of Norway , Westerschelde, Wimereux, Zeebrugge, Zeeland
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

This crab has a wide distribution in north-west Europe (2). It is common around the coastline of Britain (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Known from rocky shores.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 7284 specimens in 1 taxon.
Water temperature and chemistry ranges based on 1860 samples.

Environmental ranges
  Depth range (m): -9 - 435
  Temperature range (°C): 6.506 - 12.348
  Nitrate (umol/L): 2.055 - 12.900
  Salinity (PPS): 31.839 - 35.519
  Oxygen (ml/l): 5.262 - 6.665
  Phosphate (umol/l): 0.239 - 0.836
  Silicate (umol/l): 1.816 - 10.823

Graphical representation

Depth range (m): -9 - 435

Temperature range (°C): 6.506 - 12.348

Nitrate (umol/L): 2.055 - 12.900

Salinity (PPS): 31.839 - 35.519

Oxygen (ml/l): 5.262 - 6.665

Phosphate (umol/l): 0.239 - 0.836

Silicate (umol/l): 1.816 - 10.823
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

 Found on bedrock including under boulders, mixed coarse grounds, and offshore in muddy sand. Lower shore, shallow sublittoral and offshore to about 100 m.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Found in pools and gullies on course, rocky substrata and on muddy sand offshore to depths of 100 m (3). The largest specimens tend to occur offshore (2), whereas small individuals tend to occur beneath boulders (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Cancer pagurus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GGAGGATTTGGAAATTGATTAGTTCCTCTTATGCTGGGAGCGCCTGACATAGCCTTTCCTCGAATAAATAACATAAGTTTCTGATTATTACCCCCTTCACTAACACTACTTCTTATAAGAGGAATAGTAGAAAGAGGAGTTGGAACAGGGTGGACTGTTTATCCCCCTTTAGCAGGTGCTATTGCCCACGCTGGAGCCTCAGTAGATATAGGGATTTTTTCTCTCCATTTAGCAGGAGTTTCTTCTATTTTAGGAGCTGTAAATTTTATAACAACTGTAATCAACATACGATCATTTGGAATAACTCTAGACCAAATGCCACTTTTTGTCTGAGCTGTCTTTATTACTGCTATCCTTTTACTTCTATCACTCCCTGTCTTAGCTGGAGCCATCACTATTCTTTTAACAGACCGAAACCTCAATACTTCCTTCTTTGACCCCGCTGAGGNAGGTGACCCTGTTCTTTATCAACACCTCTTCTGATTTTTCGGGCACCTCGAAGTTTATATTCTTATTTTACCCGCTTTTGGTATAATCTCTCATATTGTAAGTCAAGAATCTGGAAAAAAAGAATCTTTTGGTACCTTAGGAATAATTTATGCTATACTAGCCATTGGTATTCTAGGATTTGTTGTTTGAGCTCATCATATATTTACAGTTGGAATAGATGTAGATACTCGCG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Cancer pagurus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 13
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

Status

Not threatened (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

This species is not threatened.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation

Conservation action is not required for this species. It is illegal to land females that are carrying eggs (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Cancer pagurus

Cancer pagurus, commonly known as the edible crab or brown crab, is a species of crab found in the North Sea, North Atlantic Ocean and perhaps in the Mediterranean Sea. It is a robust crab of a reddish-brown colour, having an oval carapace with a characteristic "pie crust" edge and black tips to the claws. A mature adult may have a carapace width of up to 25 cm (10 in) and weigh up to 3 kg (6.6 lb). C. pagurus is a nocturnal predator, targeting a range of molluscs and crustaceans. It is the subject of the largest crab fishery in Western Europe, centred around the coasts of the British Isles, with more than 60,000 tonnes caught annually.

Contents

Description [edit]

Mouthparts and chelae of a female
Ventral view of an egg-bearing female

The carapace of C. pagurus adults is a reddish-brown colour, while in young specimens it is purple-brown. It occasionally bears white patches, and is shaped along the front edge into nine rounded lobes,[1] resembling a pie crust.[2] Males typically have a carapace 60 millimetres (2.4 in) long, and females 98 mm (4 in) long, although they may reach up to 150 mm (6 in) long in exceptional cases.[1] Carapace width is typically 150 mm (6 in), or exceptionally up to 250 mm (10 in).[3] A fold of the carapace extends ventrally to constitute a branchial chamber where the gills lie.[4]

The first pereiopod is modified into a strong cheliped (claw-bearing leg): the claw's fingers, the dactylus and propodus, are black at the tips.[1] The other pereiopods are covered with rows of short stiff setae; the dactylus of each is black towards the tip, and ends in a sharp point.[1]

From the front, the antennae and antennules are visible. Beside these there are the orbits in which the eyes are situated.[4] The mouthparts comprise three pairs of maxillipeds, behind which there are a pair of maxillae, a pair of maxillules, and finally the mandibles.[4]

In common with most crabs, the abdomen is folded under the thorax and shows clear sexual dimorphism: in males it is comparatively narrow, whereas in the female it is wider.[4]

Life cycle [edit]

Reproduction occurs in winter; the male captures the female and holds her under himself until she moults.[2] Internal fertilisation takes place before the hardening of the new carapace, with the aid of two abdominal appendages (gonopods). After mating, the female retreats to a pit on the sea floor to lay her eggs.[2] Between 250,000 and 3,000,000 fertilised eggs[5] are held under the female's abdomen for up to eight months until they hatch.[2]

The first developmental stage after hatching is a planktonic larva (1 mm) called the zoea that develops into a postlarva (megalopa), and finally a juvenile.[6] The first juvenile stage is characterised by a well-developed abdomen, which will, in time, become reduced in size and folded under the sternum. Juveniles settle to the sea floor in the intertidal zone, where they stay until they reach a carapace width of 60–70 mm (2.4–2.8 in) and then migrate to deeper water.[5] The growth rate in males slows from an increase in carapace width of 10 mm per year before it is eight years old, to 2 mm per year thereafter.[5] Females grow at about half the rate of males,[5] probably due to the energetic demands of egg laying. Sexual maturity is reached at a carapace width of 12.7 cm (5.0 in) in females, and 11 cm (4.3 in) in males.[2] Longevity is typically 25–30 years, although exceptional individuals may live for up to 100 years.[7]

Distribution and ecology [edit]

The blue mussel, Mytilus edulis, is a favourite food of Cancer pagurus.

Cancer pagurus is abundant throughout the northeast Atlantic as far as Norway in the north and northern Africa in the south, on mixed coarse grounds, mud and sand from the shallow sublittoral to depths of about 100 metres (330 ft).[3] It is frequently found inhabiting cracks and holes in rocks but occasionally also in open areas. Smaller specimens may be found under rocks in the littoral zone.[2] Unconfirmed reports suggest that C. pagurus may also occur in the Mediterranean Sea and Black Sea.[5]

Adult C. pagurus are nocturnal, hiding buried in the substrate during the day, but foraging at night up to 50 metres (160 ft) from their hideouts.[8] Their diet includes a variety of crustaceans (including the crabs Carcinus maenas and Pilumnus hirtellus, the porcelain crabs Porcellana platycheles and Pisidia longicornis, and the squat lobster Galathea squamifera) and molluscs (including the gastropods Nucella lapillus and Littorina littorea, and the bivalves Ensis, Mytilus edulis, Cerastoderma edule, Ostrea edulis and Lutraria lutraria). It may stalk or ambush motile prey, and may dig large pits to reach buried molluscs.[5] The main predator of Cancer pagurus is the octopus, which will even attack them inside the crab pots that fishermen use to trap them.[9]

Compared to other commercially important crab species, relatively little is known about diseases of Cancer pagurus.[10] Its parasites include viruses, such as the white spot syndrome virus, various bacteria that cause dark lesions on the exoskeleton, and Hematodinium-like dinoflagellates that cause "pink crab disease".[10] Other microscopic pathogens include fungi, microsporidians, paramyxeans and ciliates. Cancer pagurus is also targeted by metazoan parasites, including trematodes and parasitic barnacles.[10] A number of sessile animals occasionally settle as epibionts on the exoskeleton of C. pagurus, including barnacles, sea anemones, serpulid polychaetes such as Janua pagenstecheri, bryozoans and saddle oysters.[10]

Fishery [edit]

Cancer pagurus is heavily exploited commercially throughout its range, being the most commercially important crab species in Western Europe.[2] The crabs are caught using crab pots (similar to lobster pots) which are placed offshore and baited.[2] The catch of C. pagurus has increased steadily, rising from 26,000 tonnes in 1978 to 60,000 t in 2007, of which more than 70% was caught around the British Isles.[11] The fishery is widely dispersed around the British and Irish coasts, and C. pagurus is thought to be overfished across much of this area.[11] Most of the edible crabs caught by the British fleet are exported live for sale in France and Spain.[12]

A number of legal restrictions apply to the catching of Cancer pagurus. It is illegal to catch "berried" crabs (females carrying eggs),[2] but since ovigerous females remain in pits dug in the sediment and do not feed, fishing pressure does not affect the supply of larvae.[5] Minimum landing sizes (MLS) for C. pagurus are set by both the European Union technical regulations and by the UK government.[11] Different minimum sizes are employed in different geographical areas, to reflect differences in the crab's growth rate across its range.[11] In particular, the "Cromer crab" fishery along the coasts of Suffolk, Norfolk and Lincolnshire is subject to a MLS of 115 mm (4.5 in), rather than the 140 mm (5.5 in) MLS in most of the species' range. An intermediate value of 130 mm (5.1 in) is used in the rest of the North Sea between the 56th parallel north and the EssexKent border, and in the Irish Sea south of 55° N. Around Devon, Cornwall and the Isles of Scilly, there is a separate MLS for males (160 mm or 6.3 in) and females (140 mm or 5.5 in).[11] The Norwegian catch is 8,500 tons annually, compared to 20,000 tons in the United Kingdom, 13,000 tons in Ireland, 8,500 tons in France, and a total 45,000 tons globally.[13]

Cookery [edit]

Around one third of the weight of an adult edible crab is meat, of which one third is white meat from the claws (cf. declawing of crabs), and two thirds is brown meat from the body.[14] As food, male edible crabs are referred to as cocks and females as hens. Cocks have more sweet white meat; hens have more rich brown meat.[15] Dishes include dressed crab (crab meat arranged in the cleaned shell with other foodstuffs), soups such as bisque or bouillabaisse, pâtés, mousses and hot soufflés.[16]

Taxonomy and systematics [edit]

According to the rules of the International Code of Zoological Nomenclature, Cancer pagurus was first described by Carl Linnaeus in 1758, in the tenth edition of his Systema Naturae, which marks the starting point of zoological nomenclature. It was chosen to be the type species of the genus Cancer by Pierre André Latreille in 1810.[17] The specific epithet pagurus is a Latin word, deriving from the Ancient Greek πάγουρος (pagouros), which, alongside "κάρκινος" (karkinos), was used to refer to edible marine crabs; neither classical term can be confidently assigned to a particular species.[18]

Although the genus Cancer formerly included most crabs,[19] it has since been restricted to eight species.[17] Within that set of closely related species, the closest relative of C. pagurus is the Jonah crab, Cancer borealis, from the east coast of North America.[20]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!