Ecology

Habitat

Depth range based on 11 specimens in 1 taxon.
Water temperature and chemistry ranges based on 4 samples.

Environmental ranges
  Depth range (m): 18.288 - 548.64
  Temperature range (°C): 18.507 - 24.820
  Nitrate (umol/L): 0.149 - 6.303
  Salinity (PPS): 34.324 - 35.354
  Oxygen (ml/l): 4.622 - 4.843
  Phosphate (umol/l): 0.104 - 0.627
  Silicate (umol/l): 1.236 - 7.495

Graphical representation

Depth range (m): 18.288 - 548.64

Temperature range (°C): 18.507 - 24.820

Nitrate (umol/L): 0.149 - 6.303

Salinity (PPS): 34.324 - 35.354

Oxygen (ml/l): 4.622 - 4.843

Phosphate (umol/l): 0.104 - 0.627

Silicate (umol/l): 1.236 - 7.495
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Marsupenaeus japonicus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 80
Specimens with Barcodes: 80
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Marsupenaeus japonicus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACGCAACGATGATTATTCTCTACAAACCATAAAGACATTGGAACGCTATATTTTATTTTCGGGGCCTGAGCAGGAATAGTAGGTACTGCTCTTAGTTTAATTATTCGTGCTGAGTTAGGTCAACCAGGAAGACTTATTGGAGATGACCAAATCTATAATGTAGTAGTTACAGCTCATGCATTTGTTATAATTTTCTTTATAGTTATGCCTATTATAATTGGAGGATTTGGAAACTGATTAGTTCCTTTAATATTAGGAGCACCTGATATGGCATTCCCACGAATGAATAATATAAGCTTTTGGCTGCTGCCTCCTTCTCTTACTCTTCTCTTATCCAGAGGAATAGTTGAAAGAGGAGTTGGAACAGGATGAACTGTGTACCCTCCTTTATCAGCTAGAATCGCACATGCAGGGGCCTCTGTAGATTTAGGAATTTTTTCATTACATTTAGCAGGGGTTTCATCAATTTTAGGGGCCGTAAATTTTATAACAACTGTAATTAATATACGATCTACAGGTATGACTATAGACCGAATACCGTTATTCGTCTGAGCAGTCTTTATTACTGCACTTTTACTCCTATTATCTTTACCTGTTCTAGCAGGAGCTATTACAATACTTCTTACCGATCGTAATCTTAATACTTCATTTTTTGACCCAGCGGGTGGAGGAGACCCAGTCCTTTATCAACATTTATTCTGATTCTTCGGGCACCCAGAGGTCTATATTCTAATTCTTCCCGCCTTTGGAATAATCTCACACATCATCAGTCAAGAGTCGGGTAAAAAAGAAGCTTTTGGTACTTTAGGGATAATTTATGCTATATTGGCCATTGGAGTTTTAGGATTTGTAGTGTGAGCTCACCATATATTTACAGTAGGAATGGATGTTGATACACGAGCTTACTTTACATCAGCAACAATAATTATTGCTGTTCCTACAGGAATTAAAATCTTTAGTTGACTTGGGACCCTCCATGGAACCCAACTAAACTATAGCCCATCATTAATTTGAGCGTTAGGATTCGTTTTCTTATTTACTGTGGGGGGATTAACAGGAGTTGTTCTAGCGAATTCTTCGATTGACATTATTCTCCACGACACTTATTATGTAGTGGCCCATTTCCACTACGTTCTCTCGATAGGAGCTGTATTTGGAATTTTTGCAGGAATTGCTCATTGATTTCCTCTTTTTACTGGTCTCACATTAAATCCTAAATGACTAAAAATCCACTTTTTAGTTATATTTGTTGGAGTAAACATTACATTTTTCCCCCAACATTTCTTAGGACTTAATGGAATACCTCGACGATACTCTGATTATCCTGATGCCTACACAGCTTGAAATGTTGTTTCATCTATTGGGTCTACAATTTCATTAATTGCTGTCCTCGGATTTATTATCATTGTATGAGAAGCTCTAACTGCTGCACGGCCTGTATTATTCTCTCTATTCTTACCAACATCTATTGAATGACAGCATAATCTTCCGCCAGCTGATCATAGTTATATAGAAATTCCGTTAATCACTAACT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Marsupenaeus

Marsupenaeus japonicus, known as the kuruma shrimp, kuruma prawn, or Japanese tiger prawn, is a species of prawn. It occurs naturally in bays and seas of the Indo-West Pacific, but has also reached the Mediterranean Sea as a Lessepsian migrant. It is one of the largest species of prawns, and is accordingly one of the most economically important species in the family.

Description[edit]

Males of M. japonicus can reach a total length of 17 centimetres (6.7 in), while females may reach 27 cm (11 in)[2] and a mass of 130 grams (4.6 oz), making it one of the largest species in the family Penaeidae.[3] The body is pale, with brown bands across the back, while the pereiopods and pleopods (walking and swimming legs, respectively) are pale yellow near their bases, and blue near the tips.[3] The rostrum bears 8–10 spines on the top, and 1–2 below.[3]

Ecology and behaviour[edit]

M. japonicus lives in bays and inland seas, particularly where there are warm currents.[3] It is nocturnal, remaining buried in the substrate during the day.[2] Their predators include bony fishes and cartilaginous fishes.[2]

When the sea temperature exceeds 20 °C (68 °F), spawning can begin.[3] During copulation, the male transfers a spermatophore to the female, which she stores in a seminal receptacle. She travels to deep water, where she then releases around 700,000 eggs.[3] These hatch as nauplii, and pass through a further 5 nauplius stages, 3 zoeae and 3 mysis stages by moulting before reaching the post-larval stage.[3]

Distribution and invasiveness[edit]

The natural distribution of M. japonicus extends from the coast of East Africa and the Red Sea as far east as Fiji and Japan.[2]

M. japonicus has entered the Mediterranean Sea as a Lessepsian migrant, through the Suez Canal. It was first observed in Egypt in 1924, and has since spread through the Levant and around the coast of Turkey.[2] Further populations have been established after the species was released at various sites around France, Italy and Greece.

Taxonomy[edit]

The species was first described by Charles Spence Bate in 1888 as "Penaeus canaliculatus var. japonicus". In 1971, N. M. Tirmizi established a new subgenus of Penaeus for P. japonicus,[4] and raised to the rank of genus by Isabel Pérez Farfante and Brian Kensley in 1997.[5] M. japonicus remains the only species in the genus.[6]

Common names for the species include "kuruma shrimp",[3] "kuruma prawn"[2] and "Japanese tiger prawn".[7]

Importance[edit]

M. japonicus is considered "one of the most economically important members of the family Penaeidae".[3] In its introduced range, it is the subject of fishing by trawling in the eastern Mediterranean, especially around the Gulf of İskenderun.[2] It is also fished in various parts of its natural range, but its greatest importance is in aquaculture; since 2003, more than 38,000 tonnes (84,000,000 lb) has been produced in shrimp farms annually, and the value of the annual catch exceeds $200 million.[8]

References[edit]

  1. ^ a b Charles Fransen & Michael Türkay (2012). "Marsupenaeus japonicus (Spence Bate, 1888)". World Register of Marine Species. Retrieved February 7, 2012. 
  2. ^ a b c d e f g B. S. Galil (November 6, 2006). "Marsupenaeus japonicus" (PDF). Delivering Alien Invasive Species Inventories for Europe. Retrieved February 7, 2012. 
  3. ^ a b c d e f g h i "Marsupenaeus japonicus (kuruma shrimp)". Invasive Species Compendium. CAB International. Retrieved February 7, 2012. 
  4. ^ N. M. Tirmizi (1971). "Marsupenaeus, a new subgenus of Penaeus Fabricius, 1798 (Decapoda, Natantia)". Pakistan Journal of Zoology 3: 193–194. 
  5. ^ Patsy A. McLaughlin, Rafael Lemaitre, Frank D. Ferrari, Darryl L. Felder & R. T. Bauer (2008). "A reply to T. W. Flegel" (PDF). Aquaculture 275: 370–373. doi:10.1016/j.aquaculture.2007.12.020. 
  6. ^ S. De Grave & C. H. J. M. Fransen (2011). "Carideorum Catalogus: the Recent species of the dendrobranchiate, stenopodidean, procarididean and caridean shrimps (Crustacea: Decapoda)". Zoologische Mededelingen 85 (9): 195–589, figs. 1–59. ISBN 978-90-6519-200-4. 
  7. ^ Donald V. Lightner (2001). "The penaeid shrimp viruses TSV, IHHNV, WSSV, and YHV: current status in the Americas, available diagnostic methods, and management strategies". In Chhorn Lim & Carl D. Webster. Nutrition and Fish Health. Routledge. pp. 79–102. ISBN 978-1-56022-887-5. 
  8. ^ "Species Fact Sheets: Penaeus japonicus (Bate, 1888)". FAO Fisheries and Aquaculture. Food and Agriculture Organization. Retrieved February 7, 2012. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!