Overview

Comprehensive Description

Biology/Natural History: Since red light does not penetrate to the daytime depths of this prawn, the red parts of its body are effectively black. This species has organs of Pesta, which are bioluminescent, ventral to the red visceral mass. The organs of pesta have a shiny reflector to make the bioluminescence directional. As the animal moves through the water it turns the organs of pesta so that the bioluminescence is directed downward, thus effectively erasing its shadow. In situ studies in Monterey Bay showed that this species swims an average of 7.4 cm/s, or about 1.5 body lengths per second. Propulsion is exclusively by the pleopods, which beat at 4 Hz. The animal swims continuously, and remains above the oxygen minimum layer. It ascends near the surface at night and descends to deeper water during the day. The antennae respond to tactile stimuli and probably to vibrations in the water. This species matures in 1 or 2 years. Peak spawning is during the summer. May die after spawning. Feeds on large copepods and euphausiids. Predators include albacore, rockfish, sei and fin whales, and snipe eels.

Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

This mesopelagic, mostly oceanic, vertically-migrating shrimplike prawn is not a true (Caridean) shrimp because the epimera of abdominal segment 2 do not overlap those of abdominal segments 1 and 3 (photo). The species is "half-red", like many mesopelagic vertical migrators, meaning that part of its body is clear while other parts, especially the area around the gut and internal organs, is bright red. As with most sergestids the rostrum is short, less than 1/10 the length of the carapace. The tiny rostrum points obliquely upward and forward and has an acute tip (photo). The flagellum of the antennule is very long, much longer than the entire body. The antennules are held extending forward and outward at an angle from the body for a distance of more than 1 body length, then the long flagellae trail backward from an inflection point. Males to 18.4 mm carapace length and 6.1 mm total length, females to 17.8 mm carapace length and 57 mm total length.
Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Geographical Range: North Pacific Ocean, Japan through Alaska and the southwest Bering Sea south along the Amereican coast to the Gulf of California; off Chile, and in the eastern South Atlantic.

Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Look Alikes

How to Distinguish from Similar Species: The only other sergestid common in this area, Sergia tenuiremis, has no supraorbital or hepatic spine, no Organ of Pesta, is not bioluminescent, and has a tubercle on the inner margin of the eyestalk.
Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Depth range based on 3769 specimens in 1 taxon.
Water temperature and chemistry ranges based on 3497 samples.

Environmental ranges
  Depth range (m): 8.5 - 3016.4
  Temperature range (°C): 1.621 - 12.263
  Nitrate (umol/L): 7.162 - 45.171
  Salinity (PPS): 33.279 - 34.666
  Oxygen (ml/l): 0.303 - 5.636
  Phosphate (umol/l): 0.966 - 3.500
  Silicate (umol/l): 9.297 - 181.171

Graphical representation

Depth range (m): 8.5 - 3016.4

Temperature range (°C): 1.621 - 12.263

Nitrate (umol/L): 7.162 - 45.171

Salinity (PPS): 33.279 - 34.666

Oxygen (ml/l): 0.303 - 5.636

Phosphate (umol/l): 0.966 - 3.500

Silicate (umol/l): 9.297 - 181.171
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth Range: Surface (at night) to 1200 m; most common 150-500 m during the day (vertical migrator)

Habitat: Mesopelagic, Oceanic (offshore). Also found nearer shore in deeper areas of the continental shelf.

Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Sergestes similis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GGGACATTATATTTTATCTTTGGAGCTTGAGCTGGGATAGTAGGAACTGCTTTAAGCTTGATAATTCGAGCTGAACTTGGCCAACCTGGTAGTCTTATTGGAGATGATCAGATTTATAACGTGGTTGTGACAGCCCACGCATTTGTTATAATTTTTTTTATAGTTATACCTATTATAATCGGAGGATTTGGAAATTGATTAGTACCTTTAATATTAGGAGCTCCTGATATAGCTTTCCCTCGTATAAATAATATAAGATTTTGACTCTTACCACCTTCTCTAACACTTCTTTTGTCTAGAGGAATAGTGGAAAGTGGAGTAGGAACTGGTTGAACAGTTTACCCTCCTCTCTCAGCAGGTATCGCTCACGCAGGAGCTTCTGTTGACTTAGGTATTTTTTCATTACATCTTGCAGGGGTGTCGTCAATCCTAGGAGCCGTAAATTTTATAACAACGGTTATTAATATACGAAGAACAGGAATAACAATAGACCGACTACCTTTATTTGTTTGATCAGTATTTATTACTGCTCTTTTACTTCTTCTCTCTTTACCAGTATTAGCAGGGGCAATCACAATACTATTAACCGACCGAAATTTAAATACATCATTTTTCGACCCAGCTGGAGGAGGAGACCCTGTACTTTACCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Sergestes similis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 7
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!