Overview

Comprehensive Description

Biology/Natural History: Does not live in burrows, as Hemigrapsus oregonensis often does. The chela of males, as of H. oregonensis and P. crassipes, have a prominent tuft of hairlike setae on the palm. This species is an osmoregulator and can tolerate both hypo- and hyperosmotic conditions. In Puget Sound feeds on diatoms, desmids, and small Ulva and Enteromorpha green algae scraped from rocks with the tips of the chelae. May also feed on a few animal products, such as amphipods and the eggs of Nucella emarginata and other whelks. In Puget Sound, females carrying eggs are found from January to mid-July; especially in April. Female may carry from 400 to 36,000 eggs. This species sometimes has the pasasitic isopod Portunion conformis in the perivisceral cavity, and the eggs may be attacked by the tiny Nemertean worm Carcinonemertes epialti. Predators include gulls white-winged scoters, Anthopleura anemones, and staghorn and tidepool sculpins. Nucella lamellosa seems to be attracted to the scent of this crab but is not known to be a predator.
Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

This shore crab has no transverse lines on the carapace and 3 teeth at the anterolateral margin. Its chelipeds have prominent purple spots and white tips. Its legs are not covered with abundant setae. It is usually purple but may be olive green or redish-brown. Males up to 5.6 cm carapace width, females up to 3.4 cm.
  • Wicksten,Mary K., 2009. ; Decapod Crustacea of the Californian and OregonianZoogeographic Provinces. ; UC San Diego Scripps Institution of OceanographyLibrary, Scripps Institution of Oceanography. ; http://escholarship.org/uc/item/7sk92dz ;418 pages. ; Published online only. ; This excellent key coversdecapods (crustaceans such as crabs, shrimp, spiny lobsters, hermit crabs,and crayfish) from shallow and deep water from Puget Sound south to thePacific coast of Baja California. ; Includes many subkeys, drawings,and photos. ; No glossary, table of contents, or index. ; Thisis the place to go for the most up-to-date key for decapods. ; MaryWicksten plans to publish an updated version of this key soon.   http://www.wallawalla.edu/academics/departments/biology/rosario/inverts/Annotated_Bibliography.html#Wicksten+2009 External link.
  • Jensen, Gregory C., 1995. ;Pacific Coast Crabs and Shrimps. ; Sea Challengers, Monterey, CA. ;87 pp. ; ISBN 0-930118-20-0. ; This paperback contains excellentpictures and brief descriptions of many crabs and shrimp from along thePacific coast. ; Sections are arranged by animal group. ; Includesa short glossary.   http://www.wallawalla.edu/academics/departments/biology/rosario/inverts/Annotated_Bibliography.html#Jensen+1995 External link.
  • Hart, Josephine F.L., 1982. ;Crabs and their relatives of British Columbia. ; British Columbia ProvincialMuseum Handbook 40. ; Paperback. ; 267 pages. ; This smallpaperback contains keys and individual descriptions and drawings of 95species of true crabs, hermit crabs, other anomurans, mud and ghost shrimp(but not shrimp or prawns) found off British Columbia. ; An introductiongives an extensive discussion of the general biology and anatomy of crabsand other similar crustaceans, including topics such as sexual dimorphism,larvae, and parasites. ; A variety of drawings and tables are included. ;The general characteristics of each of the families included in the bookare discussed. ; Keys to the families of each section (Thalassinidea,Anomura, Brachyrua) are included but one needs to know beforehand whichsection the animal is in. ; Keys are also included for the membersof each family. ; A useful key for the serious student wanting to identifycrabs.   http://www.wallawalla.edu/academics/departments/biology/rosario/inverts/Annotated_Bibliography.html#Hart+1982 External link.
Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Geographical Range: Yakobi Island, Alaska to Bahia de Tortuga, Mexico. Uncommon below central CA.

Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Look Alikes

How to Distinguish from Similar Species: Hemigrapsus oregonensis also has 3 anterolateral teeth but no purple spots on the chelipeds and the legs have abundant setae. Pachygrapsus crassipes (Oregon and south) has transverse lines and 2 anterolateral teeth on the carapace.
Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Depth range based on 79 specimens in 1 taxon.
Water temperature and chemistry ranges based on 63 samples.

Environmental ranges
  Depth range (m): 0 - 5
  Temperature range (°C): 10.119 - 10.345
  Nitrate (umol/L): 5.774 - 6.931
  Salinity (PPS): 31.692 - 32.059
  Oxygen (ml/l): 6.535 - 6.616
  Phosphate (umol/l): 0.883 - 0.974
  Silicate (umol/l): 12.975 - 16.001

Graphical representation

Depth range (m): 0 - 5

Temperature range (°C): 10.119 - 10.345

Nitrate (umol/L): 5.774 - 6.931

Salinity (PPS): 31.692 - 32.059

Oxygen (ml/l): 6.535 - 6.616

Phosphate (umol/l): 0.883 - 0.974

Silicate (umol/l): 12.975 - 16.001
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth Range: Mostly intertidal

Habitat: Under rocks and in cracks. Also high in some estuaries.

Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Hemigrapsus nudus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

GGAGGATTTGGAAATTGATTAGTTCCACTAATACTAGGGGCGCCAGACATAGCATTCCCTCGTATAAACAATATAAGATTTTGGCTTTTACCGCCCTCTTTATCCCTTCTTTTAACAAGAAGAATAGTAGAGAGTGGAGTTGGCACAGGGTGAACTGTTTACCCTCCCCTCTCCGCTGCTATTGCCCACGCTGGCGCCTCTGTCGATCTCGGGATTTTCTCACTACATCTTGCAGGGGTCTCTTCAATTTTAGGAGCAGTAAATTTTATAACTACCGTTATTAATATACGATCTTACGGGAGGACAATGGACCAAATACCTCTTTTTGTGTGAGCTGTATTCATTACTGCTATTCTCTTACTTTTATCTCTTCCAGTTCTAGCAGGTGCTATCACTATGTTGCTTACTGATCGAAATTTAAATACATCTTTCTTTGACCCTGCTGGCGNGGGGGGACCAGTTTTATACCAACATTTATTTTGGTTCTTTGGTCATCCTGAAGTTTATATTTTGATCTTACCTGCCTTCGGAATGATTTCTCATATTGTTAGTCAAGAATCTGGTAAAAAAGAATCTTTTGGTACTTTGGGTATGATTTATGCTATACTAGCCATTGGAATTTTAGGATTTGTAGTATGAGCTCACCATATATTTACATTGGGAATAGACGTAGACACTCGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Hemigrapsus nudus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 18
Specimens with Barcodes: 26
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Purple shore crab

The purple shore crab, Hemigrapsus nudus, is a common crab of the family Varunidae. It can be found sheltering under rocks in inter-tidal areas along the west coast of North America, from Alaska to Baja California in Mexico.[1] This crab primarily eats sea lettuce and other green algae, and occasionally scavenges dead animals.[2]

Description[edit source | edit]

A small crab, H. nudus reaches sizes of approximately 4.0–5.6 centimetres (1.6–2.2 in).[1] Its dorsal shell (carapace) is generally a dark purple in color, although it may be olive green or red, with white or cream markings. The color of the legs matches the color of the carapace but the white-tipped claws (chelipeds) are a lighter color with purple or red spots – these spots allow H. nudus to be distinguished from a similar looking crab, the lined shore crab, Pachygrapsus crassipes, whose chelipeds lack spots.[3] The legs of H. nudus lack setae, a distinguishing feature of the otherwise similar H. oregonensis.

References[edit source | edit]

  1. ^ a b Kwasi Addae. "Hemigrapsus nudus". The Evergreen State College. Retrieved November 4, 2010. 
  2. ^ "Hemigrapsus nudus The Purple Shore Crab". Intertidal Marine Invertebrates of the South Puget Sound. Retrieved November 4, 2010. 
  3. ^ James Watanabe (March 11, 2010). "Phylum Arthropoda, Subph. Crustacea: Rocky Shore Crabs, Shrimp, Isopods, Amphipods". SeaNet: Common Marine Organisms of Monterey Bay, California. Stanford University. Retrieved November 4, 2010. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!