Overview

Comprehensive Description

Description

 A large crab with a well-calcified carapace with a width up to 12 cm. The carapace is almost circular with a well-defined rim of irregular spines. These spines are scattered on the back and legs. The right pincer is larger than the left and the fifth legs are small and hidden.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Locally common, extending not further south than Isle of Man
  • Hayward, P.J.; Ryland, J.S. (Ed.) (1990). The marine fauna of the British Isles and North-West Europe: 1. Introduction and protozoans to arthropods. Clarendon Press: Oxford, UK. ISBN 0-19-857356-1. 627 pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

West Greenland to Sandy Hook, to New Jersey
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

bathyal and circalittoral of the Gulf and estuary
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 1129 specimens in 1 taxon.
Water temperature and chemistry ranges based on 838 samples.

Environmental ranges
  Depth range (m): 0 - 1167
  Temperature range (°C): -0.049 - 11.782
  Nitrate (umol/L): 1.473 - 23.955
  Salinity (PPS): 31.314 - 35.371
  Oxygen (ml/l): 3.675 - 7.704
  Phosphate (umol/l): 0.359 - 1.571
  Silicate (umol/l): 1.720 - 17.288

Graphical representation

Depth range (m): 0 - 1167

Temperature range (°C): -0.049 - 11.782

Nitrate (umol/L): 1.473 - 23.955

Salinity (PPS): 31.314 - 35.371

Oxygen (ml/l): 3.675 - 7.704

Phosphate (umol/l): 0.359 - 1.571

Silicate (umol/l): 1.720 - 17.288
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

 Found on open coasts and offshore from 10-600 m.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Lithodes maja

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 7 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TACATTATATTTTATTTTTGGAGCTTGGGCCGGAATAGTAGGAACTTCTTTGAGTTTAATTATTCGAGCTGAATTAGGACAACCAGGTAGTTTGATTGGAGACGATCAAATTTATAATGTGGTTGTTACAGCACATGCTTTTGTAATAATTTTTTTTATAGTAATACCTATTATAATTGGTGGATTTGGAAATTGACTGGTACCATTAATATTAGGGGCCCCAGACATAGCCTTTCCACGAATAAATAATATAAGTTTTTGACTTTTACCCCCCTCACTAACTCTTTTATTAACTAGGGGAATAGTAGAAAGAGGTGTGGGTACAGGATGAACTGTTTACCCACCATTATCTGCAGCAATCGCACATGCAGGAGCATCAGTGGATTTAGGAATTTTCTCTTTGCATTTGGCTGGAGTATCTTCTATTTTAGGAGCTGTAAATTTTATAACTACAGTTATTAATATACGACCCCAAGGAATAACCCTAGATCGTATACCTTTATTTGTGTGATCAGTATTTATTACTGCAATTCTACTTTTATTATCACTACCAGTTTTAGCAGGGGCTATTACTATATTACTTACAGATCGAAATTTAAATACCTCTTTTTTTGACCCTGCAGGAGGAGGAGATCCAGTTTTATACCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Lithodes maja

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 7
Specimens with Barcodes: 22
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Lithodes maja

Lithodes maja is a species of king crab which occurs in the colder waters of Europe and North America. It is found along entire coast of Norway,[2] the northern half of the British Isles, and around the Faroe Islands, Iceland, Svalbard and off south-eastern Greenland.[1] In Canada, it is found from Newfoundland southwards.[3]

The carapace is almost circular and may reach a width of 13–14 centimetres (5.1–5.5 in).[2] The whole body is brown or orange and is covered with large spikes. It lives on both soft and hard bottoms, from a few metres below the surface to around 800 m depth.[1][2] Like most king crabs, females are asymmetrical, with the left side of the abdomen considerably larger than the right, although specimens with the reverse of this are occasionally found.[4]

The low rate of egg production by this species, in comparison to species fished in the North Pacific, limits its abundance, making it unsuitable for commercial exploitation.[5]

References

  1. ^ a b c d Cédric d'Udekem d'Acoz (2003). "Lithodes maja (Linnaeus, 1758)". Crustikon – crustacean photographic website. Tromsø MuseumUniversity of Tromsø. Archived from the original on February 19, 2008. Retrieved August 16, 2007. 
  2. ^ a b c K. Telnes. "Deepsea king crab". seawater.no. Retrieved August 16, 2007. 
  3. ^ "Stone crab, Lithodes maja". Canada's Species. McGill University. Retrieved August 16, 2007. 
  4. ^ S. D. Zaklan (2000). "A case of reversed asymmetry in Lithodes maja (Linnaeus, 1758) (Decapoda, Anomura, Lithodidae)". Crustaceana 73 (8): 1019–1022. doi:10.1163/156854000504949. 
  5. ^ "Northern stone crab (Lithodes maja) exploratory fishing" (PDF). Government of Newfoundland and Labrador. 2000. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!