Overview

Distribution

Cobscook Bay, Gulf of Maine, Gulf of Mexico, Gulf of St. Lawrence, Manicouagan, North West Atlantic, Saint Lawrence River, St. Lawrence Estuary
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Cancer irroratus inhabit the Atlantic ocean, and are extensively distributed along North America's east coast. Their range stretches as far north as Labrador, Canada and reaches southward to South Carolina, U.S. (Gendron,2001).

Biogeographic Regions: atlantic ocean (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Labrador to Florida (incl. Gulf of St. Lawrence)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

The rock crab's size varies considerably between males and females. A fully mature male can reach a cephalothorax width (CW) between 50mm-140mm (Gendron,2001), and range in weight from 49-202g (Miller & Addison, 1994). CW is measured as the distance between the two most lateral notches on the carapace (Miller & Addison, 1995). It is uncommon for females to surpass 100mm CW (Gendron,2001). The shape of a rock crab's shell is wide and oval. It is a yellowish color and frequently shades of red and purplish brown are visible. The different array of colors gives this creature a unique and colorful carapace. Another interesting characteristic of the rock crab is its denitition, or teeth. The rock crab has either nine broad and smooth or rough jagged teeth, depending on its diet (Gosner,1978).

Range mass: 49 to 202 g.

Average mass: 108.50 g.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Cancer irroratus live in the benthic zone of the ocean (Ristvey & Rebach 1999). They are able to adapt to extreme variations in depth. The depths that they exist at range from deep waters at 2,600ft. to very shallow waters and occasionly well inland from the low tide line (NJ Scuba, 1994-96). They live on a variety of substrate types including rocky and loose material. Smaller crabs with the cephalorthorax width of about 50 mm tend to inhabit muddy or sandy bottoms, while other crabs seem to prefer the rocky bottoms (Gendron, 2001).

Aquatic Biomes: benthic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

intertidal, infralittoral and circalittoral of the Gulf and estuary
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 7168 specimens in 1 taxon.
Water temperature and chemistry ranges based on 3797 samples.

Environmental ranges
  Depth range (m): -3 - 400
  Temperature range (°C): 1.894 - 23.797
  Nitrate (umol/L): 0.289 - 23.955
  Salinity (PPS): 31.035 - 36.527
  Oxygen (ml/l): 3.415 - 7.523
  Phosphate (umol/l): 0.100 - 1.647
  Silicate (umol/l): 0.756 - 16.914

Graphical representation

Depth range (m): -3 - 400

Temperature range (°C): 1.894 - 23.797

Nitrate (umol/L): 0.289 - 23.955

Salinity (PPS): 31.035 - 36.527

Oxygen (ml/l): 3.415 - 7.523

Phosphate (umol/l): 0.100 - 1.647

Silicate (umol/l): 0.756 - 16.914
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Rock crabs are opportunistic feeders. Since they inhabit the benthic zone of the ocean from shallow waters to depths extending to 2,600 ft., their food source is limited to species that can survive in this zone as well. They eat an assortment of items including algae, polychaetes, mussels, gastropods, and various crustaceans including hermit crabs. An interesting thing regarding Cancer irroratus food habits, is their responsiveness and affinity to food types they were already accustomed to rather than to ones with which they were unfamiliar. After being continuously fed one of two species they had the capability of noticing the difference in odors exhibited by both species, and expressed a preference for the most familiar one. This showed that rock crabs are able to detect and respond to prey odors (Ristvey & Rebach, 1999).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Reproduction

Cancer irroratus reproduction occurs in the autumn. Sexual maturity in females is attained once they reach the CW size of 60 mm. Males have a slightly larger size of CW 70 mm at sexual maturity. Before mating commences, both male and female rock crabs moult their shell. This event for males happens during the winter months to ensure that their shells are completely firm before the fall. Females moult their shells during the fall so that they remain soft during mating. It takes rock crab shells between 2-3 months to fully harden. After fertilization females lay their eggs and store them under their stomach for almost a year. Depending upon the female's size the number of eggs produced can range from 125,000 to 500,000. After this period of time the eggs hatch and between the months of June to September the larva stay in the water column. By the time autumn returns the larva that were hatched metamorphose into extremely small crabs called megalops. For the first part of their life these young crabs are extremely vulnerable to predators and water turbulance. To increase their chance for survival they remain in shallow water and at the bottom of the ocean floor for protection (Gendron,2001).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Cancer irroratus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 8 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CACATTATATTTTATTTTTGGNGCGTGAGCGGGAATAGTTGGAACCTCTCTTAGATTAATTATCCGTGCTGAACTAGGCCAACCAGGNGCCCTAATTGGAAACGATCAAATCTATAACGTAGTTGTTACTGCCCATGCTTTTGTTATAATTTTTTTCATAGTAATACCCATTATAATTGGAGGGTTTGGCAATTGATTAGTCCCTCTTATATTAGGAGCACCTGATATGGCCTTCCCTCGTATAAATAACATAAGTTTCTGACTTTTACCTCCCTCCTTAACACTCCTCCTTATAAGAGGGATAGTAGAAAGGGGAGTTGGAACAGGTTGGACAGTTTACCCNCCTTTAGCAAGGGCAATTGCCCATGCAGGAGCCTCAGTCGATATAGGTATTTTCTCTTTACATTTAGCAGGAGTCTCCTCTATCTTAGGGGCCGTTAATTTTATGACGACTGTAATTAACATACGTTCCTTTGGGATAACTTTAGACCAAATACCACTTTTTGTCTGAGCTGTGTTCATCACTGCNATTCTTTTACTCTTGTCTCTCCCTGTTTTAGCCGGAGCTATCACTATACTTCTTACTGACCGGAATTTAAACACCTCTTTCTTTGACCCTGCAGGAGGAGGGGACCCTGTTCTTTACCAACACCTCTTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Cancer irroratus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 8
Specimens with Barcodes: 19
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

As the rock crab industry continues to grow, it is having an undertermined effect on the conservation of the species. However steps have been taken to help prevent the overfishing of rock crabs. Organizations, such as the DFO, are monitoring and making efforts to maintain a steady population and reproductive potential by placing guidelines and restrictions on fisherman (Gendron, 2001).

US Federal List: no special status

CITES: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Cancer irroratus were considered pests by fisherman catching lobsters because they were known to enter the lobster traps and steal the bait. However, once the rock crab industry began to develop they were considered a profitable item themselves (NJ Scuba, 1994-96). The rock crab fishery can have negative effects on the lobster industry. Lobsters are known to depend upon smaller rock crabs as a food source. As the number of fisherman exploiting rock crabs increases, the number of smaller rock crabs (including megalops) begin to decrease in number. This could cause a negative effect on the lobster industry by disrupting the lobster food supply (Gendron, 2001).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

The rock crab industry provides economic benefits. This fishery in the Atlantic Ocean is generally new. Lobsters have been the most popular fishery in this region over the years. The rock crab fishery first began in the 1970's but took several years to grow into an industry. As more markets developed for the seafood industry interest began to rise about the rock crab. Regulations were created by the Department of Fisheries and Oceans (DFO) to ensure the safety and survival of the species. These restrictions included- mandatory licenses in order to fish for rock crabs, a quota for the number of rock crabs fisherman could catch at one time, a minimum size of rock crabs fisherman were allowed to keep, set at CW 102 mm, and a ban on catching females to help promote a minimal amount of reproductive potential. This industry shows great promise for the future as more areas are being discovered and explored for rock crab exploitation (Gendron, 2001).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Cancer irroratus

Cancer irroratus (common name the Atlantic rock crab or peekytoe crab) is a crab in the genus Cancer. It is found from Labrador to South Carolina at depths up to 2,600 ft (790 m), and reaches 133 mm (5.2 in) across the carapace.

Contents

Distribution

A molted carapace of Cancer irroratus from Long Beach, New York.

This crab species occurs on the eastern coast of North America, from Labrador to South Carolina.[1] Rock crabs live over a large depth range, from well above the low tide line to as deep as 2,600 feet (790 m).[1]

Description

Cancer irroratus has nine marginal teeth on the front edge of the carapace beside each eye,[1] and reaches a carapace width of 5.25 inches (133 mm).[2] These crabs are similar in color to, and overlap in size with, the Jonah crab, Cancer borealis.[2] The two species can be distinguished by the purplish-brown spots on the carapace of C. irroratus (contrasting with the yellow spots of C. borealis), and by the smooth edges to the teeth on the edge of the carapace (denticulate in C. borealis).[2]

Fisheries

The rock crab has recently become a popular culinary item. The coining of the name "peekytoe crab," referring to the fact that the legs are "picked" (a Maine colloquialism meaning "curved inward").[3] Until about 1997, they were considered a nuisance species by the lobster industry because they would eat the bait from lobster traps.[1]

References

  1. ^ a b c d Krista Page (2002). "Cancer irroratus, Atlantic rock crab". Animal Diversity Web. University of Michigan. Retrieved June 12, 2011. 
  2. ^ a b c Alice Jane Lippson & Robert L. Lippson (2006). "Deeper, open waters". Life in the Chesapeake Bay (3rd ed.). Johns Hopkins University Press. pp. 258–289. ISBN 978-0-8018-8338-5. 
  3. ^ Peggy Trowbridge Filippone. "Peekytoe Crab Information". About.com. Retrieved July 13, 2009. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!