Overview

Comprehensive Description

Type locality

Mouth of St Lawrence River between Anticosti and south shore (Gulf of St Lawrence), 146–403 m.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Baba, Keiji

Source: Squat Lobsters LIFEDESK

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Data

Type not located.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Baba, Keiji

Source: Squat Lobsters LIFEDESK

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Synonymy

Munidopsis curvirostra Whiteaves, 1874: 212 (mouth of St Lawrence River between Anticosti and south shore (Gulf of St Lawrence), 146–403 m). — Smith, 1879: 54 (list). — Smith, 1882: 21, pl. 8, fig. 2, 3, 3a (off east coast of US, 1183 m). — Hansen, 1908: 36, pl. 3, figs 2a–2e (Davis Straits, SW of Iceland and S of Iceland, 662–1784 m). — Selbie, 1914: 84, pl. 13, figs 1–4 (Ireland, c. 51°N, 1797 m). — Sivertsen & Holthuis, 1956: 47 (SE of Newfoundland, 42°59´W, 51°15´W, 1100 m). — Squires, 1970: 423, figs 226, 227 (compilation). — Khodkina, 1981: 1263 (SW Pacific [Lord Howe Ridge], 30°25.5´S, 161°48´E, 1210 m). — Wenner, 1982: 368 (Middle Atlantic Bight, 636–2200 m). — Williams & Turner, 1986: 619 (Woods Hole, 1830 m). — d'Udekem d'Acoz, 1999: 167 (compilation). — Ingle & Christiansen, 2004: 148, figs 118, 121 (compilation). — Macpherson & Segonzac, 2005: 21 (off Ireland, Bay of Biscay, NE Atlantic, Mauritania, 1010–2114 m). — Baba, 2005: 287 (key, synonymies).
Munidopsis curvirostris. — Türkay, 1976: 30 (between Portugal and Morocco, 1912–1716 m). — de Saint Laurent, 1985: table 2 (Bay of Biscay, 1845–2430 m).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Baba, Keiji

Source: Squat Lobsters LIFEDESK

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

European waters (ERMS scope), Gulf of St. Lawrence, North Atlantic, North West Atlantic, South Coast of Ireland, St. Lawrence Estuary, West Coast of Ireland
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

rare in Ireland
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Latitude 66° (Davis Strait) to North Carolina
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

bathyal and circalittoral of the Gulf and estuary
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 27 specimens in 1 taxon.
Water temperature and chemistry ranges based on 27 samples.

Environmental ranges
  Depth range (m): 77 - 2175
  Temperature range (°C): 3.691 - 10.172
  Nitrate (umol/L): 7.368 - 33.370
  Salinity (PPS): 34.211 - 35.401
  Oxygen (ml/l): 3.864 - 6.059
  Phosphate (umol/l): 0.686 - 2.294
  Silicate (umol/l): 4.869 - 58.280

Graphical representation

Depth range (m): 77 - 2175

Temperature range (°C): 3.691 - 10.172

Nitrate (umol/L): 7.368 - 33.370

Salinity (PPS): 34.211 - 35.401

Oxygen (ml/l): 3.864 - 6.059

Phosphate (umol/l): 0.686 - 2.294

Silicate (umol/l): 4.869 - 58.280
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Munidopsis curvirostra

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACTTTATATTTTATTTTTGGTGCTTGAGCTGGGATAGTAGGAACTTCATTAAGATTAATTATCCGAGCTGAGTTAGGTCAGCCCGGTAGTTTAATTGGGGATGACCAAATTTATAATGTGATTGTCACAGCTCACGCTTTTGTAATAATTTTTTTTATGGTAATGCCTATTATAATTGGGAGTTTTGGAAACTGGATAATTCCCCTTATATTAGGAGCTCCTGATATAGCTTTCCCGCGAATAAATAATATAAGATTTTGACTTTTACCCCCTTCTTTATTATTACTTTTAATAAGAGGGATAGTAGAAAGAGGAATCGGAACTGGTTGAACTGTTTATCCACCCTTAGCTGCCAGAATTGCTCACGCAGGCGCTTCAGTAGACATGGGAATTTTTTCTCTTCATTTAGCTGGGGTATCTTCAATTTTAGGCGCAGTAAATTTTATAACTACTGTTATTAATATACGCACCCAAGGGATAACTTTCGACCGAATTCCTTTATTTATTTGAGCTGTGTTTATTACAGTTGTTTTATTATTATTATCTCTTCCTGTTTTAGCGGGGGCAATTACAATGCTTTTAACAGATCGAAATCTTAGTACCTCTTTTTTTGATCCTGTGGGAGGAGGGGACCCTATTTTGTATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Munidopsis curvirostra

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!