Overview

Comprehensive Description

Description

 Palaemon elegans is a typical prawn with a cylindrical body composed of a carapace at the front and six abdominal segments. It has a short straight rostrum in front of the eyes with distinctive dorsal and ventral teeth. Palaemon elegans is translucent with red/brown lines on the carapace and abdomen. Just below the large compound eye on each side is the antennule, which is divided into to three parts. Below the antennule is the antenna, which is divided into two parts; the short flat segment (the scaphocerite) and the long whip-like flagellum. The first two pairs of walking legs bear claws (chela) and have yellow and red banding.Palaemon elegans is very similar to Palaemon serratus, Palaemon longirostris and Palaemon adspersus but can be separated from these species by the number of rostral teeth and the mandibular palp, which is composed of two segments.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Depth range based on 48 specimens in 1 taxon.
Water temperature and chemistry ranges based on 4 samples.

Environmental ranges
  Depth range (m): 0 - 40
  Temperature range (°C): 6.832 - 11.845
  Nitrate (umol/L): 0.459 - 5.063
  Salinity (PPS): 10.036 - 35.203
  Oxygen (ml/l): 6.138 - 7.360
  Phosphate (umol/l): 0.336 - 0.546
  Silicate (umol/l): 2.448 - 28.168

Graphical representation

Depth range (m): 0 - 40

Temperature range (°C): 6.832 - 11.845

Nitrate (umol/L): 0.459 - 5.063

Salinity (PPS): 10.036 - 35.203

Oxygen (ml/l): 6.138 - 7.360

Phosphate (umol/l): 0.336 - 0.546

Silicate (umol/l): 2.448 - 28.168
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

 Intertidal on rocky shores in rock pools around mid-tide level but sometimes higher. Moves offshore in winter in northern latitudes.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Palaemon elegans

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 14
Specimens with Barcodes: 21
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Palaemon elegans

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 9 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNAACTCTATATTTTATTTTCGGAGCTTGAGCAGGAATAGTAGGGACTTCTCTAAGACTTTTAATTCGAGCTGAATTAGGTCAACCTGGTAGGTTAATCGGAAATGACCAAATTTATAATGTTATTGTTACCGCCCACGCTTTCGTTATAATCTTTTTTATGGTTATGCCAATTATAATTGGCGGGTTTGGAAATTGACTGGTACCATTAATGCTAGGAGCCCCTGATATGGCTTTTCCACGAATAAATAATATAAGGTTTTGACTTTTACCCCCTTCCTTAACTCTCCTTCTTTCTAGAGGGATGGTTGAAAGGGGAGTGGGAACAGGATGAACTGTTTACCCTCCTCTAGCGAGAGGATTAGGACATGCTGGCGCTTCTGTAGATCTTGGTATTTTCTCCCTTCATTTAGCAGGAATCTCTTCCATCCTAGGAGCAGTTAACTTTATTACTACTGTAATCAATATACGAGCTCCAGGTATAACTATAGATCGAACTCCTCTTTTCGTGTGGGCTGTTTTTCTAACAGCTATTCTTCTTTTACTATCCTTACCAGTTTTAGCAGGAGCTATCACCATGCTCCTTACTGACCGTAATTTAAATACTTCATTCTTTGATCCTGCTGGAGGGGGTGACCCAATTCTTTATCAACACTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!