Overview

Distribution

Elbe, European waters (ERMS scope), FAO fishing area 67, German Exclusive Economic Zone, Gulf of Maine, Gulf of Mexico, Gulf of Riga, Haringvliet, Hollands Diep, Muuga harbour (Port of Tallinn, Gulf of Finland), North East Pacific, North West Atlantic, Oostende, Parnu Bay, Romanian Exclusive economic Zone, Schelde estuary, Swedish Exclusive Economic Zone, Ukrainian Exclusive Economic Zone, United Kingdom Exclusive Economic Zone, Westerschelde
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Gulf of St. Lawrence (unspecified region), Saguenay Fjord, upstream and downstream part of Middle St. Lawrence Estuary, lower St. Lawrence estuary, Prince Edward Island (from the northern tip of Miscou Island, N.B. to Cape Breton Island south of Cheticamp, including the Northumberland Strait and Georges Bay to the Canso Strait causeway), upper Laurentian Channel (bathyal zone off Sept- Isles); middle North Shore (from Sept- Iles to Cape Whittle, including the Mingan Islands)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

upper epipelagic of the Gulf and estuary
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 212 specimens in 1 taxon.
Water temperature and chemistry ranges based on 62 samples.

Environmental ranges
  Depth range (m): 0 - 100
  Temperature range (°C): -0.711 - 9.408
  Nitrate (umol/L): 1.335 - 5.207
  Salinity (PPS): 6.043 - 31.698
  Oxygen (ml/l): 7.967 - 8.895
  Phosphate (umol/l): 0.273 - 0.831
  Silicate (umol/l): 6.763 - 16.711

Graphical representation

Depth range (m): 0 - 100

Temperature range (°C): -0.711 - 9.408

Nitrate (umol/L): 1.335 - 5.207

Salinity (PPS): 6.043 - 31.698

Oxygen (ml/l): 7.967 - 8.895

Phosphate (umol/l): 0.273 - 0.831

Silicate (umol/l): 6.763 - 16.711
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Eurytemora affinis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 68 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACTTTGTATTTAATAGCGGGGGCTTGAGCAGGTATGGTTGGAACAGGCTTAAGAATAATTATTCGTATGGAGTTGGGACAAGCTGGCAGGCTTATCGGCGATGATCAAATCTATAATGTCGTAGTTACAGCTCACGCTTTTATTATAATTTTTTTTATGGTTATACCTATTCTTATTGGAGGGTTTGGTAATTGATTAGTTCCTTTAATACTCGGAGCAGCTGATATAGCTTTCCCTCGAATAAATAATATAAGGTTTTGATTTTTACTCCCGGCCTTAGTTATGCTTCTCTCTAGTTCTTTAGTAGAAAGAGGAGCTGGTACAGGATGAACAGTCTACCCACCTCTGTCAAGAAATATTGCTCACGCGGGGAGGTCTGTGGATTTTGCTATTTTTTCATTGCATCTGGCCGGTGTCAGTTCTATTTTAGGGGCTGTAAATTTTATTAGAACTTTAGGAAACTTGCGTACATTTGGTATAATTTTAGACCGAATACCTCTTTTTGCTTGATCTGTCCTGATCACTGCTGTTCTCTTGCTTTTATCTCTCCCCGTGTTAGCTGGGGCTATTACTATATTATTAACAGACCGTAATTTAAATTCAAGATTTTATGATGCAAGCGGTGGGGGGGATCCTATTTTATACCAACACTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Eurytemora affinis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 70
Specimens with Barcodes: 77
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!