Overview
Distribution
Elbe, European waters (ERMS scope), FAO fishing area 67, German Exclusive Economic Zone, Gulf of Maine, Gulf of Mexico, Gulf of Riga, Haringvliet, Hollands Diep, Muuga harbour (Port of Tallinn, Gulf of Finland), North East Pacific, North West Atlantic, Oostende, Parnu Bay, Romanian Exclusive economic Zone, Schelde estuary, Swedish Exclusive Economic Zone, Ukrainian Exclusive Economic Zone, United Kingdom Exclusive Economic Zone, Westerschelde
-
North-West Atlantic Ocean species (NWARMS)
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=2901
-
The Zoological Record: records of zoological literature relating chiefly to the year: Zoological Society of London City: London, UK
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=1153
-
Hostens, K.; Mees, J. (1999). The mysid-feeding guild of demersal fishes in the brackish zone of the Westerschelde estuary. J. Fish Biol. 55: 704-719
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=1145
-
van Breemen, P.J. (1906). Mariene copepoden [Marine copepods]. Fauna van Nederland, 1. E.J. Brill: Leiden, The Netherlands. 31 pp.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=1293
-
Azémar, F.; Fiers, F.; Tackx, M. (2002). Zooplankton taxonomic list - taxa found from Bath to Gent (Schelde) during winter and spring 2002. Unpublished data.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=1112
-
Species composition of meso- and macrozooplankton of the Black Sea
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=43140
-
Polk, Ph. (1976). Inventarisatie plankton: fauna en flora [Plankton inventory : fauna and flora], in: Nihoul, J.C.J.; De Coninck, L. (Ed.) (1976). Project Sea final report: 7. Inventory of fauna and flora. Project Sea final report, 7: pp. 233-311
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=1590
-
De Pauw, N., 1969. Contribution à l'étude du plancton dans le port d'Ostende. Biol. Jb. 37 : 186-262.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=25970
-
Appeltans, W., A. Hannouti, S. van Damme, K. Soetaert, R. Vanthomme & M. Tackx. 2003. Zooplankton in the Schelde estuary (Belgium/The Netherlands). The distribution of Eurytemora affinis: effect of oxygen? Journal of Plankton Research 25(11):1441-1445.
http://www.marinespecies.org/copepoda/aphia.php?p=sourcedetails&id=74036
-
Felder, D.L. and D.K. Camp (eds.), Gulf of Mexico–Origins, Waters, and Biota. Biodiversity. Texas A&M Press, College Station, Texas.
http://www.marinespecies.org/porifera/porifera.php?p=sourcedetails&id=145245
-
Põllumäe, A.; Kotta, I.; Kotta, J. (2006). Port biological sampling as a tool for monitoring invasive species in high-risk areas of bioinvasions, in: Ojaveer, H.; Kotta, J. (Ed.) (2006). Alien invasive species in the north-eastern Baltic Sea: population dynamics and ecological impacts. Estonian Marine Institute Report Series, 14: pp. 35-41
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=9789
-
Boxshall, G. (2001). Copepoda (excl. Harpacticoida), in: Costello, M.J. et al. (Ed.) (2001). European register of marine species: a check-list of the marine species in Europe and a bibliography of guides to their identification. Collection Patrimoines Naturels, 50: pp. 252-268
http://www.marinespecies.org/copepoda/aphia.php?p=sourcedetails&id=1330
-
Simm, M.; Lankov, A.; Põllupüü, M.; Ojaveer, H. (2006). Estimation of consumption rates of the predatory cladoceran Cercopagis pengoi in laboratory conditions, in: Ojaveer, H.; Kotta, J. (Ed.) (2006). Alien invasive species in the north-eastern Baltic Sea: population dynamics and ecological impacts. Estonian Marine Institute Report Series, 14: pp. 42-47.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=9791
-
Lankov, A. (2006). The predatory cladoceran Cercopagis pengoi in fish diet: observations from field, in: Ojaveer, H.; Kotta, J. (Ed.) (2006). Alien invasive species in the north-eastern Baltic Sea: population dynamics and ecological impacts. Estonian Marine Institute Report Series, 14: pp. 52-56.
http://www.marinespecies.org/copepoda/aphia.php?p=sourcedetails&id=9793
-
Johnson CL, Runge JA, Curtis KA, Durbin EG, Hare JA, Incze LS, Link J, Melvin GD, O'Brien TD, Van Guelpen, L (in revision) Biodiversity and ecosystem function in the Gulf of Maine: pattern and role of zooplankton and pelagic nekton. PLoS One.
http://www.vliz.be/vmdcdata/masdea/masdea.php?p=sourcedetails&id=148111
-
MEDIN (2011). UK checklist of marine species derived from the applications Marine Recorder and UNICORN, version 1.0.
http://www.marinespecies.org/asteroidea/aphia.php?p=sourcedetails&id=149081
-
Institute of Ocean Science Zooplankton Database
http://www.marinespecies.org/copepoda/aphia.php?p=sourcedetails&id=150286
-
Dyntaxa (2013) Swedish Taxonomic Database. Accessed at www.dyntaxa.se [15-01-2013].
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=165516
-
Soetaert, K. & P. Van Rijswijk. 1993. Spatial and temporal patterns of the zooplankton in the Westerschelde Estuary. Marine Ecology Progress Series 97:47-59.
http://www.marinespecies.org/copepoda/aphia.php?p=sourcedetails&id=1115
Trusted
Gulf of St. Lawrence (unspecified region), Saguenay Fjord, upstream and downstream part of Middle St. Lawrence Estuary, lower St. Lawrence estuary, Prince Edward Island (from the northern tip of Miscou Island, N.B. to Cape Breton Island south of Cheticamp, including the Northumberland Strait and Georges Bay to the Canso Strait causeway), upper Laurentian Channel (bathyal zone off Sept- Isles); middle North Shore (from Sept- Iles to Cape Whittle, including the Mingan Islands)
-
North-West Atlantic Ocean species (NWARMS)
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=2901
Trusted
Ecology
Habitat
upper epipelagic of the Gulf and estuary
-
North-West Atlantic Ocean species (NWARMS)
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=2901
Trusted
Depth range based on 212 specimens in 1 taxon.
Water temperature and chemistry ranges based on 62 samples.
Environmental ranges
Depth range (m): 0 - 100
Temperature range (°C): -0.711 - 9.408
Nitrate (umol/L): 1.335 - 5.207
Salinity (PPS): 6.043 - 31.698
Oxygen (ml/l): 7.967 - 8.895
Phosphate (umol/l): 0.273 - 0.831
Silicate (umol/l): 6.763 - 16.711
Graphical representation
Depth range (m): 0 - 100
Temperature range (°C): -0.711 - 9.408
Nitrate (umol/L): 1.335 - 5.207
Salinity (PPS): 6.043 - 31.698
Oxygen (ml/l): 7.967 - 8.895
Phosphate (umol/l): 0.273 - 0.831
Silicate (umol/l): 6.763 - 16.711
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Water temperature and chemistry ranges based on 62 samples.
Environmental ranges
Depth range (m): 0 - 100
Temperature range (°C): -0.711 - 9.408
Nitrate (umol/L): 1.335 - 5.207
Salinity (PPS): 6.043 - 31.698
Oxygen (ml/l): 7.967 - 8.895
Phosphate (umol/l): 0.273 - 0.831
Silicate (umol/l): 6.763 - 16.711
Graphical representation
Depth range (m): 0 - 100
Temperature range (°C): -0.711 - 9.408
Nitrate (umol/L): 1.335 - 5.207
Salinity (PPS): 6.043 - 31.698
Oxygen (ml/l): 7.967 - 8.895
Phosphate (umol/l): 0.273 - 0.831
Silicate (umol/l): 6.763 - 16.711
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Eurytemora affinis
The following is a representative barcode sequence, the centroid of all available sequences for this species.

There are 68 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
Download FASTA File
There are 68 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
AACTTTGTATTTAATAGCGGGGGCTTGAGCAGGTATGGTTGGAACAGGCTTAAGAATAATTATTCGTATGGAGTTGGGACAAGCTGGCAGGCTTATCGGCGATGATCAAATCTATAATGTCGTAGTTACAGCTCACGCTTTTATTATAATTTTTTTTATGGTTATACCTATTCTTATTGGAGGGTTTGGTAATTGATTAGTTCCTTTAATACTCGGAGCAGCTGATATAGCTTTCCCTCGAATAAATAATATAAGGTTTTGATTTTTACTCCCGGCCTTAGTTATGCTTCTCTCTAGTTCTTTAGTAGAAAGAGGAGCTGGTACAGGATGAACAGTCTACCCACCTCTGTCAAGAAATATTGCTCACGCGGGGAGGTCTGTGGATTTTGCTATTTTTTCATTGCATCTGGCCGGTGTCAGTTCTATTTTAGGGGCTGTAAATTTTATTAGAACTTTAGGAAACTTGCGTACATTTGGTATAATTTTAGACCGAATACCTCTTTTTGCTTGATCTGTCCTGATCACTGCTGTTCTCTTGCTTTTATCTCTCCCCGTGTTAGCTGGGGCTATTACTATATTATTAACAGACCGTAATTTAAATTCAAGATTTTATGATGCAAGCGGTGGGGGGGATCCTATTTTATACCAACACTTATTT
-- end --
-- end --
Download FASTA File
Trusted
Statistics of barcoding coverage: Eurytemora affinis
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 70
Specimens with Barcodes: 77
Species With Barcodes: 1
Public Records: 70
Specimens with Barcodes: 77
Species With Barcodes: 1
Trusted
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!
