Overview

Distribution

Geographic Range

The brine shrimp is found in inland salt water bodies such as the Great Salt Lake in northern Utah, on the rocky coast south of San Francisco, and in the Caspian Sea. They also occur in many other bodies of water with any salt content, including the intermountain desert region of the western United States, salt swamps near any coast, and many man-made saltpans around the world.

Biogeographic Regions: nearctic (Native ); palearctic (Native )

  • Grzimek, B. 1972. Grzimek's Animal Life Encyclopedia, Vol. 1 "Lower Animals". New York: Van Nostrand Reinhold Co..
  • Pennak, R. 1989. Fresh-Water Invertebrates of the United States. Canada: John Wiley and Sons, Inc..
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

An adult Artemia salina is usually about 8-10 mm but can reach up to 15 mm depending on its environment. It has an elongated body divided into at least 20 segments and attached to its trunk are approximately 10 sets of flat, leaf-like appendages called phyllopodia that beat in a regular rhythm. The adults can be pale white, pink, green, or transparent and usually live for a few months. They have compound eyes set on stalks and reduced mouthparts.

Artemia salina is in the order Anostroca, literally meaning "no shell," which classifies the shrimp with other species that have no carapace (a hard, bony outer covering). Its subclass Brachiopoda literally means "gill foot," referring to the fact that the gills are on the outer side of the limb bases.

Range length: 8 to 15 mm.

Average length: 8-10 mm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

  • Najarian, H. 1976. Sex Lives of Animals Without Backbones. New York: Charles Scribner's Sons.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Artemia salina have a remarkable resistance to change and are able to live in a wide variety of water salinity. All contain some salt content ranging from seawater (2.9-3.5%) to the Great Salt Lake (25-35%), and they can tolerate up to a 50% salt concentration, which is almost saturated. Some are found in salt swamps just inland of the dunes at the seashore, but never in the ocean itself, because there are too many predators. They also inhabit man-made evaporation ponds, used to obtain salt from the ocean. Their gills help them to deal with the high salt content by absorbing and excreting ions as necessary and producing a concentrated urine from the maxillary glands. The temperature of the water also varies greatly from around six to 37 deg C, with the optimal reproduction temperature at about 25 deg C or room temperature. One advantage of their salty location means that they have very few predators, but the disadvantage is their diet is limited.

Habitat Regions: saltwater or marine

Aquatic Biomes: lakes and ponds; temporary pools; brackish water

  • Banister, K. 1985. Encyclopedia of Aquatic Life. New York: Facts on File, Inc..
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Artemia salina live on photosynthetic green algae, one type is Dunaliella. They obtain food by either filtering small particles with fine slender spines on the legs as they swim or by grazing on bottom mud and scraping algae off rocks with quick movements of their appendages. After the algae is captured, a feeding current moves it anteriorly to the mouth via a central median food groove, utilizing the regular rhythm of the phyllopodia, or leaf-like appendages.

Plant Foods: algae; phytoplankton

Foraging Behavior: filter-feeding

Primary Diet: planktivore

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Reproduction

In the Great Salt Lake studies have shown that many males are present and reproduction occurs when a male clasps a female with his large second antennae and fertilizes her eggs, producing diploid zygotes. Then she lays the eggs in a brood sac in the water. Parthenogenesis, or reproduction without fertilization, is also common among A. salina, particularly in Europe. Parthenogenesis is common when males are not present. During parthenogenesis, a female lays unfertilized eggs that will develop into female offspring. These eggs can be either diploid, tetraploid, or octoploid. Artemia salina eggs will only hatch if environmental conditions are right. The temperature must be around 30 deg C, the water supply plentiful, and the salt concentration not too high. If these conditions are not met, fertilized eggs are deposited as cysts and remain dried and surrounded by a thick shell until they are ready to develop, possibly up to 50 years. The cyst may be immersed in water several times before it will hatch and some require sustained hydration for at least 36 hours to ensure that the population is not wiped out when insufficient rain falls. A brine shrimp takes about one week to mature from a nauplii larva to an adult and then lives for several months and can reproduce up to 300 new nauplii every four days.

Key Reproductive Features: parthenogenic ; sexual ; fertilization (Internal ); oviparous

Parental Investment: no parental involvement

  • Banister, K. 1985. Encyclopedia of Aquatic Life. New York: Facts on File, Inc..
  • Najarian, H. 1976. Sex Lives of Animals Without Backbones. New York: Charles Scribner's Sons.
  • Captain's Universe, 1996. "Artemia salina, Saltwater Brine Shrimp" (On-line). Accessed (Date Unknown) at http://www.captain.at/artemia/index.php?p=1.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Artemia salina

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 74 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACCTTGTATTTTATTTTTGGAGCTTGAGCAGGGATAGTCGGGACTTCTCTAAGTATGCTTATTCGTGCCGAGTTGGGGCAACCCGGCTCTTTAATTGGTGAC---GAACAGGTATATAATGTTATTGTAACAGCTCATGCGTTTGTCATGATTTTTTTCATAGTTATACCTATCTTGATTGGGGGATTCGGTAATTGACTAGTACCCATTATACTAGGGGCCCCCGACATGGCTTTCCCTCGGTTGAATAACTTGAGATTCTGAATGCTCCCGCCTTCTCTCACTCTCCTCCTGGCCAGCTCTATGGTTGAAAGAGGGGCGGGTACCGGGTGAACGGTTTACCCTCCTCTCTCCTCTGCTATTGCCCATGCCGGGCCTTCTGTAGATCTAGCTATTTTTTCTCTTCATTTGGCCGGTATTTCTTCCATTTTAGGAGCCGTAAATTTTATTACCACTATTGTTAACATGCGCCCTCAATCGATGTCCGTTGACCGGGTACCCTTGTTAGTCTGGGCAGTCGGAATTACAGCCGTCCTTCTGCTTTTATCCCTCCCAGTCCTAGCAGGGGCTATTACTATGTTATTGACTGATCGTAACCTGAACACTTCTTTTTTTGATCCTGCAGGCGGAGGGGACCCGATTCTCTATCAGCACCTCTTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Artemia salina

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 74
Specimens with Barcodes: 74
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

There is no threat for the brine shrimp, because it reproduces quickly. It is easy to find, and the cost to catch and culture them is low.

US Federal List: no special status

CITES: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

The brine shrimp does not adversely affect humans, because it is not bothersome or poisonous.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Brine shrimp are useful in toxicity tests and for education purposes because they reproduce quickly and their environment is easy to replicate. They are used to teach students the proper technique to observe live specimens and how to design experiments to determine behavior, means of obtaining food, and most optimal environment for reproduction and development.

Both the eggs and adults are used as feed for coral, larval fish and other crustacea, because of their low cost and ease of use. They cost about $7 per pound and their prime selling time is May to July, but they can be produced at any time of year in a laboratory.

Positive Impacts: pet trade ; research and education

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Artemia salina

Artemia salina is a species of brine shrimp – aquatic crustaceans that are more closely related to Triops and cladocerans than to true shrimp. It is a very old species that does not appear to have changed in 100 million years.

Description[edit]

Adults have three eyes and 11 pairs of legs and can grow to about 15 millimetres (0.6 in) in size. Their blood contains the pigment haemoglobin, which is also found in vertebrates. Males differ from females by having the second antennae markedly enlarged, and modified into clasping organs used in mating.[2]

Life cycle[edit]

Males have two reproductive organs. Prior to copulation the male clasps the female with his clasping organ, assuming a dorsal position. The claspers hold the female just anterior to the ovisac. Male and female may swim clasped together for a number of days. In this state, the movements of the swimming appendages of the pair beat in a co-ordinated fashion.[2] The females can produce eggs either as a result of mating or via parthenogenesis. There are two types of eggs: thin-shelled eggs that hatch immediately and thick-shelled eggs, which can remain in a dormant state. These cysts can last for a number of years, and will hatch when they are placed in water. Thick-shelled eggs are produced when the body of water is drying out, raising the salt concentration. If the female dies, the eggs develop further. Eggs hatch into nauplii that are about 0.5 mm in length. They have one single simple eye that only senses the presence and direction of light. Nauplii swim towards the light but adult individuals swim away from it. Later, the two more capable eyes develop but the initial eye also stays, resulting in three-eyed creatures.[3]

Ecology[edit]

In nature, they live in salt lakes. They are almost never found in an open sea, most likely because of the lack of food and relative defenselessness. However, Artemia have been observed in Elkhorn Slough, California, which is connected to the sea.[4] Unlike most aquatic species, Artemia swims upside down.[3]

Artemia can live in water having much more or much less salt content than normal seawater. They tolerate salt amounts as high as 50%,[3] which is nearly a saturated solution, and can live for several days in solutions very different from the sea water, such as potassium permanganate or silver nitrate,[4] while iodine—a frequent addition to edible salt—is harmful to them. The animal's colour depends on the salt concentration, with high concentrations giving them a slightly red appearance. In fresh water, Artemia salina dies after about an hour. It feeds mainly on green algae.[5]

Uses[edit]

The resilience of these creatures make them ideal test samples in experiments. Artemia is one of the standard organisms for testing the toxicity of chemicals.[6] In addition, the eggs survive for years. Hence it is possible to buy eggs and also "Artemia growing kits" for children, containing eggs, salt, food and most necessary tools. These have been most popularly marketed under the name Sea-Monkeys. Children have the possibility to observe the life cycle of this interesting organism. Shops catering for Aquarists also sell frozen Artemia as fish food. Artemia occurs in vast numbers in the Great Salt Lake where it is commercially important.[5] However, nowadays it is believed that this lake is inhabited by a second brine shrimp species, Artemia franciscana.[7]

Taxonomy[edit]

Artemia salina was first described (as Cancer salinus) by Carl Linnaeus in his Systema Naturae in 1758. This was based on a report by a German called Schlosser, who had found Artemia at Lymington, England.[8] That population is now extinct, although specimens collected there are retained in zoological museums.[9]

References[edit]

  1. ^ WoRMS (2012). "Artemia salina (Linnaeus, 1758)". World Register of Marine Species. Retrieved December 7, 2012. 
  2. ^ a b Greta E. Tyson & Michael L. Sullivan (1980). "Scanning electron microscopy of the frontal knobs of the male brine shrimp". Transactions of the American Microscopical Society 99 (2): 167–172. JSTOR 3225702. 
  3. ^ a b c Sara Emslie. "Artemia salina". Animal Diversity Web. University of Michigan. 
  4. ^ a b Eleanor Boone & L. G. M. Baas-Becking (1931). "Salt effects on eggs and nauplii of Artemia salina L" (PDF). Journal of General Physiology 14 (6): 753–763. doi:10.1085/jgp.14.6.753. 
  5. ^ a b Science & Technology : brine shrimp on Encyclopædia Britannica
  6. ^ D. R. Ruebhart, I. E. Cock & G. R. Shaw (August 2008). "Brine shrimp bioassay: importance of correct taxonomic identification of Artemia (Anostraca) species". Environmental Toxicology 23 (4): 555–560. doi:10.1002/tox.20358. PMID 18214884. 
  7. ^ Rafael Campos-Ramos, Alejandro M. Maeda-Martínez, Hortencia Obregón-Barboza, Gopal Murugan, Danitzia A. Guerrero-Tortolero & Pablo Monsalvo-Spencer (2003). "Mixture of parthenogenetic and zygogenetic brine shrimp Artemia (Branchiopoda: Anostraca) in commercial cyst lots from Great Salt Lake, UT, USA". Journal of Experimental Marine Biology and Ecology 296 (2): 243–251. doi:10.1016/S0022-0981(03)00339-3. 
  8. ^ L. G. M. Baas-Becking (1931). "Historical notes on salt and salt-manufacture". The Scientific Monthly 32 (5): 434–446. 
  9. ^ Graziella Mura (1990). "Artemia salina (Linnaeus, 1758) from Lymington, England: frontal knob morphology by scanning electron microscopy". Journal of Crustacean Biology 10 (2): 364–368. doi:10.2307/1548493. JSTOR 1548493. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!