Overview

Distribution

This species of water flea can be found in rocky pools along the Atlantic coastline of the northeastern United States. It is not considered to be widespread in this area, but is regularly found in certain pools in Maine. This species is also found in Western Europe, including England, Belgium, the Netherlands, Finland, areas of the Black Sea bordering Ukraine, and some Baltic Islands.

Biogeographic Regions: nearctic (Native ); palearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

These water fleas are very small, usually 2-5 mm long, with an overall shape similar to a kidney bean. The body is enclosed by a transparent shell-like structure, called a carapace, that is mostly made of chitin. Due to its transparent carapace, this species tends to be the color of what it is currently eating. The carapace extends into the head shields, an important diagnostic characteristic for this species. They have two sets of long, doubly branched antennae and six thoracic appendages that are held inside of the carapace and help to produce a current of water, carrying food and oxygen to their mouths and gills. They also have two large claws, used mainly for cleaning the carapace. They have one compound eye, which appears as an anterior dark spot, and one simple eye (ocellus). Males are smaller than females (typically only 2 mm long while females are 3-5 mm long) but have longer antennules and modified, hook-like first appendages used for clasping females during mating.

Range length: 2 to 5 mm.

Other Physical Features: ectothermic ; bilateral symmetry

Sexual Dimorphism: female larger; sexes shaped differently

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

This species is found in freshwater and brackish (up to 8 ppt salinity) habitats including lakes, rivers, and temporary pools. Although they prefer temperatures between 18-22°C, they can tolerate a much broader range.

Habitat Regions: temperate ; freshwater

Aquatic Biomes: lakes and ponds; rivers and streams; temporary pools; brackish water

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 1 specimen in 1 taxon.
Water temperature and chemistry ranges based on 1 sample.

Environmental ranges
  Depth range (m): 21.5 - 21.5
  Temperature range (°C): 10.817 - 10.817
  Nitrate (umol/L): 4.487 - 4.487
  Salinity (PPS): 34.186 - 34.186
  Oxygen (ml/l): 6.158 - 6.158
  Phosphate (umol/l): 0.389 - 0.389
  Silicate (umol/l): 2.147 - 2.147
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

These water fleas are filter feeders; filtration rates depend on temperature, body size, food density and quality, oxygen concentration, and water pH. These animals use leaf-like appendages called phylopods, located under their carapaces, to help produce a water current. Setae on their thoracic legs filter food particulates (generally smaller than 50 micrometers in diameter), which are then moved along a body groove to their mouths. Their primary diet consists of zooplankton and phytoplankton; they are also known to consume bacteria, detritus, and fungal spores.

Animal Foods: zooplankton

Plant Foods: algae; phytoplankton

Other Foods: fungus; detritus ; microbes

Foraging Behavior: filter-feeding

Primary Diet: herbivore (Algivore); planktivore ; mycophage ; detritivore

  • Buck, J., L. Truong, A. Blaustein. 2011. Predation by zooplankton on Batrachochytrium dendrobatidis: biological control of the deadly amphibian chytrid fungus?. Biodiversity and Conservation, 20/14: 3549-3553. Accessed February 08, 2013 at http://link.springer.com/article/10.1007%2Fs10531-011-0147-4.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

These water fleas consume algae, bacteria and detritus in the water. They play a key part in aquatic food webs as prey to fishes and invertebrates.

This species is host to a number of bacteria (including one causing White Fat Cell Disease) and fungi, as well as some species of nematodes, amoebas and tapeworms.

Commensal/Parasitic Species:

  • Hooper, H., R. Connon, A. Callaghan, G. Fryer, S. Yarwood-Buchanan, J. Biggs, S. Maund, T. Hutchinson, R. Sibly. 2008. The ecological niche of Daphnia magna characterized using population growth rate. Ecology, 89/4: 1015-1022.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predators of this species include many species of fishes, insects and other invertebrates. They are larger than many other zooplankton species, which protects them from some invertebrate predators, and they migrate to upper water levels at night to avoid predators that feed during the day. Individuals can also alter their size and age at maturity, egg production levels, and perform swarming behavior and escape reactions to avoid predation.

Known Predators:

  • Boersma, M., P. Spaak, L. De Meester. 1998. Predator-mediated plasticity in morphology, life history, and behavior of Daphnia: the uncoupling of responses. American Naturalist, 152/2: 237-248.
  • Lauridsen, T., D. Lodge. 1996. Avoidance by Daphnia magna of fish and macrophytes: chemical cues and predator-mediated use of macrophyte habitat. Limnology and Oceanography, Vol. 41/ No. 4: 794-798.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

These water fleas have a compound eye that responds to light stimulus, can perceive different color wavelengths, and can also track movements. They also use olfactory and chemical cues in order to help them locate and evaluate potential food sources, conspecifics, and potential predators.

Communication Channels: visual ; chemical

Perception Channels: visual ; tactile ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

The life cycle begins when a female produces a clutch of eggs (usually 6-10) that are released into her brood chamber, located under her carapace. Eggs hatch into juveniles within this brood chamber and are released when their mother molts, typically within 2-3 days. Juveniles, which already resemble adults, go through a series of molts and instars. Females are considered sexually mature after developing brood pouches, usually after 4-6 instars, usually 6-10 days. If conditions are not favorable, or if they have been produced sexually, eggs will be released into an ephippium, a hard, protective casing, where eggs enter diapause before hatching when conditions are more favorable.

Development - Life Cycle: diapause

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan of these water fleas depends heavily on environmental conditions such as oxygen levels, food availability, and temperature. In general, as temperature decreases, lifespan increases, with averages of 40 days at 25°C and 56 days at 20°C. Unstable environmental conditions tend to lead to shorter lifespans. While it has been suggested that males of this species have shorter lifespans than females, recent research shows evidence that this is likely not the case.

Range lifespan

Status: wild:
1 to 56 days.

Average lifespan

Status: captivity:
40-56 days.

  • Grzesiuk, M., B. Pietrzak, A. Bednarska. 2010. Longevity of Daphnia magna males and females. Hydrobiologia, 643: 71-75.
  • Pietrazak, B., A. Bednarska, M. Grzesiuk. 2010. Longevity of Daphnia magna males and females. Hydrobiologia, 643/1: 71-75. Accessed February 08, 2013 at http://rd.springer.com/article/10.1007/s10750-010-0138-6.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

These water fleas reproduce both asexually and sexually and have a cyclic parthenogenetic life cycle, exhibiting heterogonic reproduction. In asexual reproduction, females produce diploid eggs that develop into exact clones; only females are produced during asexual reproduction cycles. However, during adverse conditions (low food availability, temperature extremes, high population density), this species amy reproduce sexually. During sexual reproduction, males grab onto females using their specialized second antennae. Females produce haploid eggs which are fertilized by males and encased in ephippia. These cases are carried on the female's back and fall off during her next molt. Eggs enter diapause and stay in ephippia until conditions are favorable. Sexual reproduction tends to take place in late fall months, with the ephippia-protected eggs providing a population burst when spring comes.

Mating System: polygynandrous (promiscuous)

Peak egg production is during spring months (April and May), but eggs can be produced during summer and fall as well. During spring months, a female can produce eggs every four days; eggs/juveniles remain in brood pouches for 2-3 days. Number of eggs produced at one time can be anywhere from 1-100, with an average of 6-10 eggs per brood. A female can reproduce up to 25 times throughout her lifetime, although the average is only 6 times.

Breeding interval: Females produce eggs as often as every four days during their breeding season.

Breeding season: These water fleas reproduce most frequently during April and May, though they are known to reproduce during summer and fall as well.

Range number of offspring: 1 to 100.

Average number of offspring: 8.

Range gestation period: 1 to 4 days.

Average gestation period: 3 days.

Average time to independence: 3 days.

Range age at sexual or reproductive maturity (female): 6 to 10 days.

Range age at sexual or reproductive maturity (male): 6 to 10 days.

Key Reproductive Features: iteroparous ; seasonal breeding ; year-round breeding ; gonochoric/gonochoristic/dioecious (sexes separate); parthenogenic ; sexual ; asexual ; fertilization (Internal ); ovoviviparous ; oviparous

Females keep their eggs and recently hatched young in their brood chambers for several days, providing nutrients during development. Once juveniles are released there is no additional parental care.

Parental Investment: female parental care ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Protecting: Female); pre-independence (Provisioning: Female)

  • 2011. "Daphnia spp., water flea" (On-line). GeoChemBio.com. Accessed February 21, 2012 at http://www.geochembio.com/biology/organisms/daphnia/#refs.
  • Alekseev, V., W. Lampert. 2001. Maternal control of resting-egg production in Daphnia. Nature, 414/6866: 899-901.
  • Clare, J. 2002. "Daphnia: An aquarist's guide" (On-line). Accessed December 05, 2012 at http://www.caudata.org/daphnia/#anatomy.
  • Ebert, D. 2005. Ecology, Epidemiology, and Evolution of Parasitism in Daphnia. Bethesda, Maryland: National Center for Biotechnology Information (US).
  • Enserink, E., M. Kerkhofs, C. Baltus, J. Koeman. 1995. Influence of food quality and lead exposure on maturation in Daphnia magna: evidence for a trade-off mechanism. Functional Ecology, 9/2: 175-185.
  • Ignace, D., S. Dodson, D. Kashian. 2011. Identification of the critical timing of sex determination in Daphnia magna (Crustacea, Branchiopoda) for use in toxicological studies. Hydrobiologia, 668/1: 117-123.
  • Tessier, A., L. Henry, C. Goulden. 1983. Starvation in Daphnia: energy reserves and reproductive allocation. Limnology and Oceanography, 28/4: 667-676.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Daphnia magna

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 64 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACTTTATATTTTGTATTCGGGGTTTGATCAGGTATGGTAGGAACTGCTCTAAGTATACTTATTCGAGCTGAGTTAGGGCAATCAGGTAGTTTAATTGGGGAT---GATCAGATTTATAATGTTATTGTCACTGCCCACGCGTTTGTAATAATTTTTTTTATGGTTATGCCTATTATAATTGGAGGTTTCGGGAACTGGTTAGTACCTTTGATGTTGGGAGCTCCTGACATAGCCTTCCCTCGATTAAATAATTTAAGTTTTTGATTTTTACCCCCTGCTTTAACTCTTTTACTTGTGGGAGGGGCAGTGGAAAGAGGTGCTGGGACTGGTTGAACTGTATACCCCCCTCTCTCTGCGGGGATCGCTCATGCTGGGGCCTCTGTTGACTTAAGTATCTTTTCTCTGCATCTAGCAGGTGTTTCTTCTATTTTAGGGGCAGTAAATTTTATTACAACTATCATTAATATACGATCTTTAGGTATAACTTTAGATCGAATTCCCTTGTTTGTATGAGCGGTCGGAATCACTGCACTCTTACTTTTACTAAGTTTGCCCGTTCTTGCGGGAGCAATTACCATACTCTTAACTGACCGTAATTTGAATACTTCATTCTTTGATCCTGCGGGGGGTGGGGATCCAATTTTATACCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Daphnia magna

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 64
Specimens with Barcodes: 116
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

This species has not been evaluated by the International Union for Conservation of Nature and Natural Resources and is not considered endangered or threatened.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

There are no known adverse effects of this species on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

This species can provide cleaner water in ponds and lakes, by eating algae and other detritus that may build up in the water. It is also an indicator organism for water quality and is used in tests of water toxicity and detecting various pollutants. This species is easily cultivated, and is commonly fed to fish reared in aquaria.

Positive Impacts: pet trade ; research and education

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Daphnia magna

Daphnia magna is a species of Daphnia (a cladoceran freshwater water flea) which is native to northern and western North America, Eurasia and some regions of Africa.

Laboratory animal[edit]

Domesticated, it is widely used as a laboratory animal for testing ecotoxicity starting with Einar Naumann in 1934.[2] As Anderson stated in 1944:[3]

The use of Daphnia magna as an experimental animal for such purposes is advantageous in many respects. Daphnids are small, reaching a size of five mm, so that a great many can be reared in a small space. They have a relatively short life span, which reaches a maximum of about two months when they are reared at 25°C. Daphnids are easy to culture, requiring only water containing bacteria or their equivalent for food. They can be grown individually in small bottles or in mass culture in large aquaria. They mature early, giving birth to young within their first week of life. After their first brood, they give rise to new broods every two or three days throughout the remainder of their lives. An average of twenty or more young may be produced in each brood. Each female who lives to a ripe old age can bear four hundred or more offspring. Again, all the young from one female are genetically like the mother if produced parthenogenically, and reproduction can be limited to parthenogenesis if the proper conditions are maintained. Further, daphnids are representatives of a class of animals that serve as food for many fish, especially while the fish are young. Fish do not remain in water where their food supply has been depleted. Daphnids would be affected if there was something toxic added to the water, therefore fish would leave and the Daphnia would die. For these reasons Daphnia prove satisfactory for testing on.

D. magna is specified to be used in the OECD Guidelines for the Testing of Chemicals, Tests No. 202 "Daphnia sp., Acute Immobilisation Test",[4] and Test No. 211 "Daphnia magna Reproduction Test".[5] Test No. 202 is a 48 hour acute toxicity study, where young Daphnia are exposed to varying concentrations of the substance under test and the EC50 determined. Other Daphnia species than D. magna may occasionally be used, but labs mostly use D. magna as standard.

Test No. 211 is a 21-day chronic toxicity test, at the end of which, the total number of living offspring produced per parent animal alive at the end of the test is assessed, to determine the lowest observed effect concentration of the test substance.

Other uses[edit]

Daphnia magna01.jpg

As it is easy to culture, D. magna is widely grown as fish food.

A recent study has postulated that Daphnia magna eats the spores of the devastating chytrid fungus Batrachochytrium dendrobatidis.[6]

References[edit]

  1. ^ "Daphnia magna". Integrated Taxonomic Information System. 
  2. ^ Naumann, Einar (1934). "Über die Anwendung von Daphnia magna Straus als Versuchstier zur experimentellen Klarlegung der Lebensverhältnisse im Wasser". Internationale Revue der gesamten Hydrobiologie und Hydrographie 31 (1): 421–431. doi:10.1002/iroh.19340310126. 
  3. ^ Bertil G. Anderson (1944). "The Toxicity Thresholds of Various Substances Found in Industrial Wastes as Determined by the Use of Daphnia magna". Sewage Works Journal 16 (6): 1156–1165. JSTOR 25029937. 
  4. ^ "Test No. 202: Daphnia sp. Acute Immobilisation Test". OECD Guidelines for the Testing of Chemicals. Organisation for Economic Co-operation and Development. Retrieved July 4, 2013. 
  5. ^ "Test No. 211: Daphnia magna Reproduction Test". OECD Guidelines for the Testing of Chemicals. Organisation for Economic Co-operation and Development. Retrieved July 4, 2013. 
  6. ^ Buck, Julia; Truong, Lisa; Blaustein, Andrew (2011). "Predation by zooplankton on Batrachochytrium dendrobatidis: biological control of the deadly amphibian chytrid fungus?". Biodiversity and Conservation 20 (14): 3549–3553. doi:10.1007/s10531-011-0147-4. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!