Articles on this page are available in 1 other language: Spanish (8) (learn more)

Overview

Brief Summary

Passerina caerulea

A large (6-7 ½ inches) bunting, the male Blue Grosbeak is most easily identified by its dark blue body, chestnut and tan wing stripes, and large conical bill. The female Blue Grosbeak is brown overall with dark wings and orange wing bars. This species is most easily distinguished from the related Indigo Bunting (Passerina cyanea) by the latter species’ smaller size and paler plumage in both sexes. The Blue Grosbeak breeds across the southern half of the United States and northern Mexico. In winter, these populations migrate south to southern Mexico and the east coast of Central America. Blue Grosbeaks are present all year in the highlands of central Mexico and the west coast of Central America. Blue Grosbeaks breed in and around shrubby edges of deciduous and evergreen woodland. During the winter, this species may be found in overgrown fields and clearings in humid tropical forests. Blue Grosbeaks primarily eat insects and seeds. In appropriate habitat, Blue Grosbeaks may be seen foraging for food in shrubs and low tree branches. Birdwatchers may also listen for this species’ song, a series of warbled notes recalling that of a finch. Blue Grosbeaks are primarily active during the day.

Threat Status: Least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Unknown

Supplier: DC Birds

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Transient

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Breeding

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: BREEDS: central California, southern Nevada, Utah, southern Colorado, Dakotas, central Illinois, southern Ohio, western Pennsylvania, and New Jersey south to northern Baja California, southern Arizona, Costa Rica, Gulf Coast, and central Florida. WINTERS: southern Baja and northern Mexico to Panama, rarely northern Colombia and northeastern Ecuador; rare in West Indies east to St. John.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Size

Length: 17 cm

Weight: 29 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

See Kaufman (1989) for information on identification.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Partly open situations with scattered trees, riparian woodland, scrub, thickets, cultivated lands, woodland edges, overgrown fields, hedgerows. Nests in low tree or bush, tangle of vegetation, usually about 1-3 m above ground, often at edge of open area (Harrison 1979).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Breeding populations in U.S. are long-distance migrants; northern birds winter to central Panama, casually to South America; fall migration in Costa Rica October-November, migrants depart by mid-April (Stiles and Skutch 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Comments: Eats mostly insects, also snails, spiders, seeds, grains, and wild fruits; forages on ground and in shrubs and trees (Terres 1980). Obtains grit from roadsides or streams (Stiles and Skutch 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

In Costa Rica, residents usually are in pairs, migrants solitary or in small groups (Stiles and Skutch 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 10.2 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Clutch size is 2-5 in north (usually 4). Produces 2 broods per year in the south. Incubation, by female, lasts 11-12 days. Young are tended by both parents, leave nest at 9-13 days. Male feeds fledged young if female renests.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Passerina caerulea

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACTGTACCTAATCTTCGGCGCATGAGCCGGAATAGTAGGTACTGCCCTAAGCCTCCTCATTCGAGCAGAACTGGGTCAACCTGGAGCTCTTCTAGGAGACGACCAAGTCTACAATGTGGTCGTCACAGCCCATGCTTTCGTAATAATCTTCTTCATAGTCATGCCAATTATAATTGGAGGGTTCGGAAACTGACTAGTCCCTCTAATAATTGGAGCCCCAGACATAGCATTCCCTCGAATAAACAACATAAGCTTCTGACTACTCCCTCCATCTTTCCTACTCCTCTTAGCATCCTCTACGGTCGAAGCAGGAGTCGGCACAGGCTGAACAGTCTACCCCCCACTAGCCGGTAACCTAGCCCACGCTGGAGCTTCAGTCGACCTGGCAATCTTCTCCCTACATCTAGCCGGTATCTCCTCCATTCTAGGGGCTATCAACTTCATTACAACAGCAATCAACATAAAACCCCCTGCCCTTTCACAATACCAAACCCCCCTATTCGTCTGATCAGTCCTAATCACCGCAGTCCTTCTACTCCTATCCCTCCCAGTACTCGCTGCAGGCATCACAATACTCCTGACAGATCGCAACCTCAACACTACATTTTTCGACCCTGCGGGAGGAGGAGACCCAGTCCTGTACCAGCACCTCTTCTGATTCTTCGGCCACCCGGAAGTCTACATTTTAATCCTG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Passerina caerulea

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
BirdLife International

Reviewer/s
Bird, J., Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be increasing, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2008
    Least Concern
  • 2004
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNA - Not Applicable

United States

Rounded National Status Rank: N5B - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Blue Grosbeak

Quintana, Texas
Quintana, Texas

Blue Grosbeak (Passerina caerulea, formerly Guiraca caerulea)[3], is a medium-sized seed-eating bird in the same family as the Northern Cardinal, "tropical" or New World buntings, and "cardinal-grosbeaks" or New World grosbeaks.

The male Blue Grosbeak is a beautiful bird, being almost entirely deep blue. The female is mostly brown. Both sexes are distinguished by their large, deep bill and double wing bars. These features, as well as the grosbeak's relatively larger size, distinguish this species from the Indigo Bunting. Length can range from 14 to 19 cm (5.5 to 7.5 in) and wingspan is from 26 to 29 cm (10 to 11 in).[2][3] Body mass is typically from 26 to 31.5 g (0.92 to 1.11 oz).[4]

This is a migratory bird, with nesting grounds across most of the southern half of the United States and much of northern Mexico, migrating south to Central America and in very small numbers to northern South America; the southernmost record comes from eastern Ecuador. It eats mostly insects, but it will also eat snails, spiders, seeds, grains, and wild fruits. The Blue Grosbeak forages on the ground and in shrubs and trees.

Contents

Habitat

Male

This species is found in partly open habitat with scattered trees, riparian woodland, scrub, thickets, cultivated lands, woodland edges, overgrown fields, or hedgerows. It nests in a low tree or bush or a tangle of vegetation, usually about 1–3 m above ground, often at the edge of an open area.

References

References

  1. ^ BirdLife International (2012). "Passerina caerulea". IUCN Red List of Threatened Species. Version 2012.1. International Union for Conservation of Nature. Retrieved 16 July 2012. 
  2. ^ [1]
  3. ^ [2]
  4. ^ CRC Handbook of Avian Body Masses by John B. Dunning Jr. (Editor). CRC Press (1992), ISBN 978-0849342585.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: This species formerly was placed in the monotypic genus Guiraca (AOU 1998), but a phylogenetic study using mitochondrial cytochrome-b sequences places this species firmly within the bunting genus Passerina, as a well-supported sister species to the Lazuli Bunting, P. amoena (Klicka et al. 2001). Similarities in behavior, molts and plumages also link this species with Passerina (Phillips et al. 1964, Blake 1969). This generic placement was accepted by the American Ornithologists' Union (Banks et al. 2002).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!