Overview

Comprehensive Description

Description

M 28-35 mm, F 35-45 mm. Tibiotarsal articulation reaches beyond snout tip. Fifth toe longer than third toe. Femoral glands in males large and very prominent. Frenal stripe relatively distinct but fading before reaching the nostril. Ventrally whitish, including the throat. No distinct colour border between dorsum and flanks like in other Chonomantis. Often with a vertebral stripe (Glaw and Vences 2007).

Variation: Specimens from Itremo have a smaller body size, shorter hindlimbs, and their femoral glands are located closer to the cloaca; however, they do not show important genetic differentiation (Glaw and Vences 2007).

Taken with permission from Glaw and Vences (2007) and Nussbaum et. al (2008).

  • Nussbaum, R., Cadle, J., and Glaw, F. (2008). Mantidactylus brevipalmatus. In: IUCN 2008. 2008 IUCN Red List of Threatened Species. www.iucnredlist.org. Downloaded on 08 April 2009.
  • Glaw, F., and Vences, M. (2007). Field Guide to the Amphibians and Reptiles of Madagascar. Third Edition. Vences and Glaw Verlag, Köln.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

This species is known from the mountains of the high plateau of central and east-central Madagascar, from Ambohitantely south to Andringitra. Additional localities will probably be found as a result of further survey work. It is recorded from 1,400-2,400m asl.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution and Habitat

Species is located in Ambatomenaloha, Ambohimirandrana, Ambohitantely, Antoetra, Antratrabe, Beanjombona, Farihimazava, Itremo, Manjakatompo, Manjavona valley, Nosiarivo, Soamazaka, Tsiafajavona plateau, Vohisokina (Glaw and Vences 2007).

It has been recorded from 1400-2400 m asl (Nussbaum et. al 2008).

  • Nussbaum, R., Cadle, J., and Glaw, F. (2008). Mantidactylus brevipalmatus. In: IUCN 2008. 2008 IUCN Red List of Threatened Species. www.iucnredlist.org. Downloaded on 08 April 2009.
  • Glaw, F., and Vences, M. (2007). Field Guide to the Amphibians and Reptiles of Madagascar. Third Edition. Vences and Glaw Verlag, Köln.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
It lives alongside streams in mid to high-elevation forests. It also occurs outside forest in high-altitude savannah and in disturbed and cleared areas in wet marshy places, but not in agricultural land. It breeds in streams.

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Mantidactylus brevipalmatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATTCGAGCCGAACTAGGACAGCCCGGAACCCTACTCGGTGAC---GACCAGATTTATAACGTTGTTGTCACCGCTCACGCATTCGTAATAATCTTTTTTATAGTTATACCCGTCTTAATCGGAGGGTTCGGAAATTGACTTGTCCCCCTAATAATTGGAGCACCTGACATAGCCTTTCCTCGTATAAACAATATAAGTTTTTGACTTCTACCCCCATCCTTTTTTCTTCTTCTTGCTTCCTCCATAGTAGAAGTCGGAGCTGGGACCGGCTGAACAGTATATCCACCATTAGCTAGTAACCTCGCCCACGCGGGGCCGTCAGTTGACCTTACTATCTTTTCCCTCCACCTTGCAGGTGTGTCCTCAATCCTTGGGGCAATCAACTTTATTACTACCATCTTAAATATGAAACCCACATCAATAATTCAATATCAGACACCTCTATTTGTCTGATCTGTCCTAATTACAGCTGTTCTCCTCCTACTCTCTCTGCCTGTTTTAGCCGCAGGCATTACTATACTCCTCACAGACCGAAACCTTAACACAACCTTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Mantidactylus brevipalmatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2004

Assessor/s
Ronald Nussbaum, John Cadle, Frank Glaw

Reviewer/s
Global Amphibian Assessment Coordinating Team (Simon Stuart, Janice Chanson and Neil Cox)

Contributor/s

Justification
Listed as Least Concern in view of its wide distribution, tolerance of a broad range of habitats, presumed large population, and because it is unlikely to be declining fast enough to qualify for listing in a more threatened category.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
It is a reasonably common species.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History, Abundance, Activity, and Special Behaviors

Habits: Found along streams in montane forest, but more commonly in deforested areas or above the tree line. Males call during day and evening from the ground at the edge of streams. Clutches of about 30 eggs are deposited on land (Glaw and Vences 2007).

Calls: A rapid series of five to seven very short notes of slightly melodious appearance (Glaw and Vences 2007).

  • Nussbaum, R., Cadle, J., and Glaw, F. (2008). Mantidactylus brevipalmatus. In: IUCN 2008. 2008 IUCN Red List of Threatened Species. www.iucnredlist.org. Downloaded on 08 April 2009.
  • Glaw, F., and Vences, M. (2007). Field Guide to the Amphibians and Reptiles of Madagascar. Third Edition. Vences and Glaw Verlag, Köln.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
It is probably not affected by deforestation, and is adaptable and is unlikely to be threatened. There might be some threatened cryptic species within this unresolved complex.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History, Abundance, Activity, and Special Behaviors

This species is listed as least concern because of its wide distribution, tolerance of a broad range of habitats, presumed large population, and because it is unlikely to be declining fast enough to qualify for listing in a more threatened category (Nussbaum et. al 2008).

It occurs in protected areas such as Réserve Spéciale d’Ambohitantely and the Parc National d'Andringitra. It is probably not affected by deforestation, and is adaptable and is unlikely to be threatened. There might be some threatened cryptic species within this unresolved complex (Nussbaum et. al 2008).

  • Nussbaum, R., Cadle, J., and Glaw, F. (2008). Mantidactylus brevipalmatus. In: IUCN 2008. 2008 IUCN Red List of Threatened Species. www.iucnredlist.org. Downloaded on 08 April 2009.
  • Glaw, F., and Vences, M. (2007). Field Guide to the Amphibians and Reptiles of Madagascar. Third Edition. Vences and Glaw Verlag, Köln.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
It occurs in Réserve Spéciale d’Ambohitantely and in the Parc National d'Andringitra.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Mantidactylus brevipalmatus

Mantidactylus brevipalmatus is a species of frog in the Mantellidae family. It is endemic to Madagascar. Its natural habitats are subtropical or tropical moist montane forests, subtropical or tropical high-altitude grassland, rivers, swamps, pastureland, and heavily degraded former forest.

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!