Overview

Comprehensive Description

Description

Batrachuperus pinchonii males measure 181-204 mm in total length, females 150-186 mm. Head is flat, and longer than wide. Snout rounded and short. Adult has no or trace remnant of gills. Vomerine teeth short, 4-6 teeth on each side in the shape of / , with a gap between the two sides. Body cylindrical, covered with smooth skin. Just behind the eyes and outside of the apparent jugular fold, there is a groove going towards the ventral side. Around 12 costal grooves are present. Tips of forelimb and hindlimb toes overlap at the tip when adpressed, or are separated by 1-2 costal grooves in length. There are four unwebbed toes on each forelimb and four unwebbed toes on each hindlimb. Tail comprises half of the salamander's total length or longer, with a cylindrical base but flattening out towards the tip. Tail fin fold obvious, rounded at the tip (Fei and Ye 2001).

Body color varies geographically. Batrachuperus pinchonii is generally brown, olive, or pastel yellow in color, with variable patterning as well. Some specimens have gray cloud-like patterns that run along the dorsum to the side of the tail (Fei and Ye 2001).

Batrachuperus pinchonii larvae have a pair of tri-forked featherlike gills, and a larger tail fin fold. When the total length reaches 80 mm, the gills will disappear (Fei and Ye 2001).

The chromosome number for this species is 2n=66 (Kuro-o et al. 1998).

  • Fei, L. and Ye, C. (2001). The Colour Handbook of the Amphibians of Sichuan. Chinese Forestry Publishing House, Beijing.
  • IUCN, Conservation International, and NatureServe. (2008). Global Amphibian Assessment: Batrachuperus pinchonii. www.globalamphibians.org. Accessed on 6 November 2008.
  • Kuro-o, M., Ikebe, C., Tamamoto, H., Wu, G., Zeng, X., and Kohno, S. (1998). ''Cytogenetic studies of Hynobiidae (Urodela). XIV. Analysis of the chromosome of a Chinese salamander, Batrachuperus pinchonii.'' Cellular and Molecular Life Sciences, 54, 152-157.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

This species is found in western Sichuan and north-western Yunnan provinces in China. It was previously found in south-eastern Guizhou, China, but it has not been seen there for over 60 years. It was previously thought to be in southern Shaanxi, but this is now considered a distinct species. It has been recorded from 1,500-3,900m asl.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution and Habitat

This species is found in China, within the provinces of Sichuan, Yunnan, and Guizhong (though it has not been reported from Guizhong province for about sixty years; IUCN 2008). It occurs near rivers and creeks of mountains, at elevations from 1500-3900m asl. It spends most of its time near water and hiding under cover of rocks and rotting wood (Fei and Ye 2001).

  • Fei, L. and Ye, C. (2001). The Colour Handbook of the Amphibians of Sichuan. Chinese Forestry Publishing House, Beijing.
  • IUCN, Conservation International, and NatureServe. (2008). Global Amphibian Assessment: Batrachuperus pinchonii. www.globalamphibians.org. Accessed on 6 November 2008.
  • Kuro-o, M., Ikebe, C., Tamamoto, H., Wu, G., Zeng, X., and Kohno, S. (1998). ''Cytogenetic studies of Hynobiidae (Urodela). XIV. Analysis of the chromosome of a Chinese salamander, Batrachuperus pinchonii.'' Cellular and Molecular Life Sciences, 54, 152-157.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western mountain areas of Sichuan (tributaries of Dadu River, Anning River and Ming River) and northern Yunnan (Zhao et al., 1988).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Sparreboom, Max; Wu, Yunke

Source: Salamanders of China

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Batrachuperus pinchonii is a slender salamander with a flattened head, longer than wide, with short rounded snout. Eyes prominent, projecting laterally. Mouth wide, buccal angle situated below eye; labial fold well developed, partly covering lower jaw, which also has a fold but less well developed. Vomero-palatine teeth in two small transverse rows, separated from each other by a distance equaling half of the length of each row. Neck rather long, provided with a fold curved anteriorly. Body cylindrical, of medium length, measuring three times length of head, with 12 costal grooves (11–13, rarely 14). Tail long, shorter than snout-vent length, cylindrical at base and gradually diminishing toward the end. It shows a straight superior keel that becomes a low crest terminating in a rather obtuse point. Feet flattened; when adpressed, digits of fore and hind limbs are normally separated by a distance of 1 or 2 costal grooves, occasionally they meet or overlap. A soft, cornified sheath under carpus and tarsus, extending to beyond the phalanges like a nail. Cornification of digits extending to palms and soles, lower parts of lower limbs and tip of tail. Most animals have two tubercles on each palm or sole. Skin smooth, with minute pores everywhere except on the throat and under the palms and soles. A vertebral groove; another groove extending from eye to gular fold marks the paratoid; throat provided with distinct longitudinal folds in front of gular fold. In the male, the vent is a transverse crescentic opening, convex anteriorly, with a light-colored papilla in the middle of the anterior lip. A shallow longitudinal groove extends backward from the middle of the transverse opening. The vent of the female is a longitudinal opening, with or without lateral grooves. The vent is more prominently swollen in the female than in the male. Color uniform, with light brown background color on the back and dorsal sides of the limbs and tail; irregularly scattered dark spots and markings on sides of the tail; some specimens have dark spots more concentrated, and arranged more or less in dorso-lateral rows (Chang, 1936; Liu, 1945, 1950).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Sparreboom, Max; Wu, Yunke

Source: Salamanders of China

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

All measurements are from Fei et al. (2006).

Male (9 specimens). Total length: 118.7–139.2 mm; snout-vent length: 66.2–79.5 mm; Head length: 15.2–18.5 mm; Head width: 12.4–14.4 mm; forelimb length: 16.5–20 mm.

Female (10 specimens). Total length: 104.4–134 mm; snout-vent length: 57.4–72 mm; Head length: 12.5–16.9 mm; Head width: 10.1–12.8 mm; forelimb length: 16.5–19.5 mm.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Sparreboom, Max; Wu, Yunke

Source: Salamanders of China

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Salamander with depressed head and prominent eyes, four fingers and four toes. Light brown epidermis covering palms and soles and extending to lower parts of arms and legs, covering ventral sides of all digits and even extending to dorsal sides of first or second segments of fingers and toes. Batrachuperus pinchonii usually has two small tubercles on each palm and sole and only shares this character with B. yenyuanensis, but differs from that species by having a shorter and stronger tail, longer and stronger limbs, and large dark spots on the back (Liu, 1950).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Sparreboom, Max; Wu, Yunke

Source: Salamanders of China

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Syntype; Syntype for Batrachuperus pinchonii
Catalog Number: USNM 10995
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Locality: Kiang-si, China, Asia
  • Syntype: Sauvage, H. E. 1877. Bulletin de la Société Philomathique de Paris, Series 7. 1 (3): 117.; Syntype: David, A. 1872. Nouvelles Archives du Muséum d'Histoire Naturelle de Paris. 7 (5): 95.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Look Alikes

This salamander looks like B. londongensis, which also has horny covers on palms and soles. But in the latter species most animals are neotenic.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Sparreboom, Max; Wu, Yunke

Source: Salamanders of China

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
It is an inhabitant of high-altitude streams and lakes, and also the surrounding forests (broadleaf and coniferous), and sometimes occurs in marshy grassland. Breeding occurs in the streams and lakes.

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

This salamander is adapted to cold, rapid mountain streams at elevations of 1,500–4,000 m. Streams are surrounded by conifers and bushes. Adults like to hide under rocks and logs fallen in the stream. Some adults stay under roots of vegetation on the bank (Fei et al., 2006). Larvae and recently metamorphosed juveniles are found at upper reach of the stream or upstream springs (Liu, 1950).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Sparreboom, Max; Wu, Yunke

Source: Salamanders of China

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Reproduction

The female lays a pair of egg sacs, attaching one end to stones, with 5 to 23 eggs in each egg sac. Egg sacs are spiral or C-shaped, ranging from 65-96 mm in length. Eggs are oval and 3.7 mm in diameter (Fei & Ye, 2001). The larva is brown or dark grey above, the underside is lighter. At 30 mm length the tail fin fold is apparent, beginning from the middle of the tail. Three pairs of gills. At 50 mm, colored spots appear and the gills become shorter; horny extensions of toes and digits become apparent. At around 80 mm length metamorphosis is completed (Fei et al., 2006). According to Liu (1950), larvae of B. pinchonii and B. karlschmidti differ in size and condition of the gills.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Sparreboom, Max; Wu, Yunke

Source: Salamanders of China

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Evolution and Systematics

Evolution

Fu et al. (2001) suggest that the presence/absence of horny cover on palms and soles is a good character to diagnose species in Batrachuperus. This is also the main character to separate B. pinchonii from congeners except B. londongensis. However, with denser sampling Fu & Zeng (2008) claim that the horny cover, as well as color of dorsum, length of tail and height of tail fin, are problematic for species delimitation. Batrachuperus cochranae, a species with no or only a weak labial fold and having a deep gular fold, is considered a valid species by Fei et al. (2006). But it is synonymized under B. pinchonii by Fu & Zeng (2008) based on the findings that all specimens collected from the supposed range of B. cochranae nest within the latter species in the molecular phylogeny.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Sparreboom, Max; Wu, Yunke

Source: Salamanders of China

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Genetics

2n=66, 1M, 2M, 3T, 4SM, 5M, 6ST, 7ST, 8T, 9T, 10T, 11T, 12T, 13T, 14T, 15M, 16T, 17SM, m (18–33), from Kuro-o et al. 1988. Allozyme data have been collected by Fu & Zeng (2008).

M: metacentric; SM: submetacentric; T: telocentric; ST: subtelocentric; m: micro-chromosome

The mitochondrial genome has been sequenced by Zhang et al. (2006).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Sparreboom, Max; Wu, Yunke

Source: Salamanders of China

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology

Barcode data: Batrachuperus pinchonii

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGATGATCACTCGATGACTATTTTCAACTAATCATAAAGATATTGGCACTCTGTATTTAGTATTTGGTGCTTGGGCCGGAATGGTCGGCACTGCTTTAAGTCTCTTAATCCGAGCTGAATTAAGTCAGCCTGGAACACTTCTTGGAGATGATCAGATTTATAATGTAATCGTAACTGCCCATGCATTCGTTATAATTTTCTTTATAGTAATGCCTGTAATAATCGGCGGGTTTGGGAATTGATTAGTCCCATTAATAATTGGAGCCCCAGACATAGCATTTCCACGAATAAATAACATAAGTTTTTGACTTCTACCCCCTTCATTCTTACTACTTCTAGCATCATCCGGAGTAGAAGCAGGGGCAGGAACAGGCTGAACCGTATATCCCCCCTTAGCCGGTAACCTCGCACATGCTGGAGCTTCAGTTGATTTAACAATTTTTTCACTCCATTTAGCAGGAATTTCATCAATCTTAGGGGCAATTAACTTCATTACAACTTCTATTAATATAAAACCCCCATCTATATCACAATACCAAACACCACTTTTTGTATGATCCGTATTAATTACTGCTATTCTCCTCTTATTATCATTACCGGTTCTTGCTGCAGGAATTACAATACTTTTAACAGATCGAAACCTAAACACAACATTTTTTGACCCTGCTGGTGGAGGAGACCCAGTTCTTTATCAACACTTATTCTGATTCTTTGGTCACCCGGAGGTTTATATTCTTATTCTCCCAGGGTTTGGAATAATTTCTCACATTGTTACATATTACTCAGCAAAAAAAGAACCCTTCGGGTATATAGGAATAGTATGAGCTATAATATCTATCGGATTATTAGGATTTATCGTCTGAGCCCATCATATATTTACAGTAGATTTAAATGTAGACACGCGAGCTTACTTCACATCCGCCACAATAATTATTGCCATCCCTACCGGAGTAAAAGTATTCAGCTGATTAGCAACAATGCATGGCGGATCTATTAAATGAGATGCTGCAATATTATGAGCCCTTGGATTTATTTTTTTATTTACTGTGGGCGGATTAACTGGAATTGTTCTTGCTAACTCATCATTAGATATGGTTTTACATGATACTTATTATGTAGTAGCACACTTTCACTATGTATTATCCATAGGAGCTGTATTTGCTATTATAGGCGGATTTGTCCATTGATTCCCGTTATTTTCAGGATACACCTTGCACCCCACTTGGTCAAAAATCCACTTTGGGGTAATATTTATTGGAGTAAATTTAACCTTTTTTCCTCAACATTTTTTAGGCTTAGCAGGTATACCCCGACGCTACTCTGATTACCCAGACGCTTATACATTATGAAATACGGTTTCATCCATTGGATCATTAATTTCTCTTGTCGCAGTCATTATAATAATGTTTATTATCTGAGAGGCATTTTCATCAAAACGTGAAGTATTAACAACTGAATTAAATTCTACAAATATTGAATGACTTCACGGATGCCCCCCACCCTATCATACATTTGAAGAACCTTCATATGTTCAAGCTCGGATTTATTAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Batrachuperus pinchonii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 12
Specimens with Barcodes: 19
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
A2ad

Version
3.1

Year Assessed
2004

Assessor/s
Fei Liang, Ye Changyuan

Reviewer/s
Global Amphibian Assessment Coordinating Team (Simon Stuart, Janice Chanson and Neil Cox)

Contributor/s

Justification
Listed as Vulnerable because of an observed population decline, estimated to be more than 30% over the last three generations, due to over-harvesting. The generation length is estimated as seven years.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Listed as vulnerable on the IUCN Red List of Threatened Species (IUCN, 2010). The biggest threat comes from over-harvesting for traditional Chinese medicine. This salamander is also taken as food by local people. Illegal collection by hobbyists could further reduce wild population. Habitat destruction by mining and water pollution may pose a new threat (IUCN, 2010).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Sparreboom, Max; Wu, Yunke

Source: Salamanders of China

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
This species is common within its range, but it has declined significantly in recent years due to over-harvesting.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History, Abundance, Activity, and Special Behaviors

Oviposition occurs from May to July. The female lays a pair of egg sacs, attaching one end onto rocks, with 5-23 eggs in each egg sac, and 10-45 eggs in total for the pair. Egg sacs are spiral or C-shaped, and range from 65-96 mm in length, and 12-19 mm in diameter. Eggs themselves are oval and 3.7 mm in diameter (Fei and Ye 2001).

  • Fei, L. and Ye, C. (2001). The Colour Handbook of the Amphibians of Sichuan. Chinese Forestry Publishing House, Beijing.
  • IUCN, Conservation International, and NatureServe. (2008). Global Amphibian Assessment: Batrachuperus pinchonii. www.globalamphibians.org. Accessed on 6 November 2008.
  • Kuro-o, M., Ikebe, C., Tamamoto, H., Wu, G., Zeng, X., and Kohno, S. (1998). ''Cytogenetic studies of Hynobiidae (Urodela). XIV. Analysis of the chromosome of a Chinese salamander, Batrachuperus pinchonii.'' Cellular and Molecular Life Sciences, 54, 152-157.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
Over-collecting for traditional Chinese medicine and for food is a major threat to this species; harvesting methods include poisoning and electrocution. There are also reports of a recent outbreak of disease. Water pollution from mining is also a threat.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History, Abundance, Activity, and Special Behaviors

Threatened by intense collection for food and medicine (Fei and Ye 2001), although most of the range occurs in protected areas (IUCN 2008). Disease and mining are also reported as threats to the species (IUCN 2008).

  • Fei, L. and Ye, C. (2001). The Colour Handbook of the Amphibians of Sichuan. Chinese Forestry Publishing House, Beijing.
  • IUCN, Conservation International, and NatureServe. (2008). Global Amphibian Assessment: Batrachuperus pinchonii. www.globalamphibians.org. Accessed on 6 November 2008.
  • Kuro-o, M., Ikebe, C., Tamamoto, H., Wu, G., Zeng, X., and Kohno, S. (1998). ''Cytogenetic studies of Hynobiidae (Urodela). XIV. Analysis of the chromosome of a Chinese salamander, Batrachuperus pinchonii.'' Cellular and Molecular Life Sciences, 54, 152-157.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Most of the range of this species falls within several protected areas. There is a need to implement measures to ensure that the offtake of this species from the wild is managed sustainably. Further research is needed to determine the impact of the recent disease outbreak.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Western Chinese mountain salamander

The Western Chinese mountain salamander or stream salamander (Batrachuperis pinchonii) is a species of hynobid salamander that is endemic to China. It is found in Sichuan, Yunnan, and Guangxi provinces.[2]

Batrachuperis pinchonii is known in Chinese legend as the White Dragon. During the 16th century, a Chinese author documented its presence at the Omei mountain in the province of Sichuan. He wrote, "the salamanders living in clear water have some larger toes, a yellow coloration with black spots, four feet, a snout that is slightly raised, a graceful body and an amiable air." Moreover, local peasants would entreat it to bring rain during especially dry seasons.

Batrachuperis pinchonii are used for traditional Chinese medicine and for food. Over-collection is now threatening the species.[1]

References[edit]

  1. ^ a b Fei Liang, Ye Changyuan (2004). "Batrachuperus pinchonii". IUCN Red List of Threatened Species. Version 2013.1. International Union for Conservation of Nature. Retrieved 24 November 2013. 
  2. ^ Frost, Darrel R. (2013). "Batrachuperus pinchonii (David, 1872)". Amphibian Species of the World 5.6, an Online Reference. American Museum of Natural History. Retrieved 24 November 2013. 
  • Chang, Mangven L. Y. 1936. Contribution à l'étude Morphologique, Biologique et systématique des Amphibiens urodèles de la Chine. Libraire Picart, Paris, 156 p.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!