Overview

Comprehensive Description

Description

The California Tiger Salamander is a stocky salamander with a broad, rounded snout. Its eyes are relatively small but protruding, with black irises. The base dorsal color is black, and the dorsal side is commonly marked with bold patches of lemon-yellow spots that are concentrated along the sides of the animal. The belly is generally gray in color, and may display a few small spots of white or yellow color. Adults generally have 12 costal grooves.

Recent molecular research has supported full species status for A. californiense, in contrast to its previous status as a subspecies of Ambystoma tigrinum (Shaffer and McKnight 1996). Full species status for A. californiense is also supported by its geographical isolation plus differences in coloration and natural history seen in A. californiense, as compared to other members of the A. tigrinum complex(Petranka 1998).

See another account at californiaherps.com

  • Petranka, J. W. (1998). Salamanders of the United States and Canada. Smithsonian Institution Press, Washington and London.
  • Fisher, R. N., and Shaffer, H. B. (1996). "The decline of amphibians in California's Great Central Valley." Conservation Biology, 10(5), 1387-1397.
  • Shaffer, H. B., and McKnight, M. L. (1996). ''The polytypic species revisited: differentiation and molecular phylogenetics of the Tiger Salamander Ambystoma tigrinum (Amphibia: Caudata) complex.'' Evolution, 50, 417-433.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Distribution and Habitat

Distribution is restricted to the Central Valley of California and lower elevations to the west. The range includes areas around Sonoma, Petaluma, and the Colusa-Yolo county line, south to the vernal pools in Tulare County, and amongst the coast ranges south to the ponds and vernal pools in the Santa Ynez Drainage (Santa Barbara County).

The habitat of this salamander is restricted to grassland and low foothills, where the long-lasting vernal pools it uses for breeding exist. Permanent aquatic sites can be used for breeding, but use of such sites is only common in the absence of predatory fish. Dry season habitat sites are within reasonable distance of breeding sites, and generally consist of small mammal burrows as well as man-made enclosures.

  • Petranka, J. W. (1998). Salamanders of the United States and Canada. Smithsonian Institution Press, Washington and London.
  • Fisher, R. N., and Shaffer, H. B. (1996). "The decline of amphibians in California's Great Central Valley." Conservation Biology, 10(5), 1387-1397.
  • Shaffer, H. B., and McKnight, M. L. (1996). ''The polytypic species revisited: differentiation and molecular phylogenetics of the Tiger Salamander Ambystoma tigrinum (Amphibia: Caudata) complex.'' Evolution, 50, 417-433.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

This species has a discontinuous distribution in west-central California, USA: coast ranges between Sonoma and Santa Barbara counties, Central Valley and surrounding foothills from southern Colusa County to north-western Kern County on the west side of the valley and southern Butte County to northern Tulare County on the east side. It has been eliminated from much of its former range in the Central Valley as a result of agricultural and urban development (Stebbins 1985b), but still occurs throughout most of its overall historical range and can be locally common (Trenham et al. 2000). About 80% of all extant occurrences are in Alameda, Contra Costa, Madera, Merced, Monterey, San Benito, and Santa Clara counties, with 30% of all occurrences in Alameda County. It has recently been rediscovered on the San Francisco Peninsula (Lagunita Lake, Stanford University) (Barry and Shaffer 1994). Jennings (1996; Herpetological Review 27:147) provides an old record from San Mateo County. It ranges from near sea level to 1,054m asl.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Ambystoma californiense is isolated from Ambystoma tigrinum, with which it was once considered conspecific. It is endemic to California, and are found in the Central Valley and adjacent foothills and coastal grassland (Petranka 1998, Loredo et al. 1996).

Biogeographic Regions: nearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

endemic to a single state or province

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (20,000-200,000 square km (about 8000-80,000 square miles)) Discontinuous distribution in west-central California: coast ranges between Sonoma and Santa Barbara counties, Central Valley and surrounding foothills from southern Colusa County to northwestern Kern County on the west side of the valley and southern Butte County to northern Tulare County on the east side.

This species has been eliminated from much of the historical range in the Central Valley as a result of agricultural and urban development (Stebbins 1985), but it still occurs throughout most of overall historical range and can be locally common (Trenham et al. 2000). About 80% of all extant occurrences are in Alameda, Contra Costa, Madera, Merced, Monterey, San Benito, ad Santa Clara counties, with 30% of all occurrences in Alameda County. Recently rediscovered on the San Francisco Peninsula (Lagunita Lake, Stanford University) (Barry and Shaffer 1994). See Jennings (1996, Herpetological Review 27:147) for an old record from San Mateo County. Elevational range from near sea level to 1054 m.

The Sonoma County population is geographically separated from the closest populations (in Contra Costa, Yolo, and Solano counties) by the Coast Range, Napa River, and the Carquinez Straits, a distance of about 72 km. This population occurs on the Santa Rosa Plain, an area of about 6.8 x 4.4 km (USFWS 2002). The historical range may have included the Petaluma River watershed, as there is one record of a specimen from the vicinity of Petaluma from the mid-1900s (Borland 1856, cited by Storer 1925).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Historic Range:
U.S.A. (CA)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

male SVL 80-108 mm

female SVL 79-118 mm

Ambystoma californiense has broad rounded snouts with small eyes. It is a lustrous black and marked with rounded or irregular yellow spots. Bellies are a grayish color and may contain a few small dull yellow spots. These salamanders have 12 costal grooves on their sides (Petranka 1998).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 22 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

The following pertains to metamorphosed adults. Differs from A. MACRODACTYLUM in lacking a distinct dorsal stripe or stripelike row of spots. Differs from A. GRACILE in having distinct dorsal markings and tubercles on the underside of the feet and by lacking parotoid glands and a glandular ridge on the tail. Differs from plethodontid salamanders in lacking a nasolabial groove. Differs from other subspecies primarily in color pattern.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species occurs in grassland or open woodland habitats, where it lives in vacant or mammal-occupied burrows (e.g., California Ground Squirrel, Valley Pocker Gopher) (Trenham 2001), and occasionally in other underground retreats, throughout most of the year. Eggs are laid on submerged stems and leaves, usually in shallow ephemeral or semi permanent pools and ponds that fill during heavy winter rains, sometimes in permanent ponds; adults spend little time in breeding sites.

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ambystoma californiense likes a Mediterranean climate of cool wet winters and hot dry summers. They inhabit annual grasslands and open woodlands of foothills and valleys. Ground squirrel burrows are necessary for the survival af A. californiense (Petranka 1998, Loredo et al 1996).

Terrestrial Biomes: savanna or grassland ; chaparral

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Lives in vacant or mammal-occupied burrows (e.g., California ground squirrel, valley pocker gopher) (Trenham 2001), occasionally other underground retreats, throughout most of the year; in grassland, savanna, or open woodland habitats. Sonoma County populations is closely associated with the presence of gopher burrows (see USFWS 2003). Lays eggs on submerged stems and leaves, in shallow ephemeral or semipermanent pools and ponds that fill during heavy winter rains or in permanent ponds (Alvarez 2004); adults spend little time in breeding sites.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Migrates up to about 2 km between terrestrial habitat and breeding pond (S. Sweet, cited by USFWS 2002); rain storms precede major migrations to the breeding sites, with most migration on rainy nights.

During the first night's emigration from a breeding pond, individuals moved up to 129 m from the pond; most moved less than 80 m; total distance moved on subsequent nights were not determined (Loredo et al. 1996). For 8 radio-tagged individuals followed for up to 4 months, Trenham (2001) found that the maximum distance moved from the breeding pond was 248 m (mean = 94 m).

Juveniles have been observed to migrate up to 1.6 km from breeding ponds to estivation areas (Austin and Shaffer 1992).

Migrations may occur from November through April (Holland et al. 1990).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Ambystoma californiense larvae eat aquatic invertebrates (Petranka 1998, Barry and Shaffer 1994). Adults are known to eat earthworms. They feed with a three part gape cycle, tongue extension cycle, and anterior head body movement common to ambystomatids (Beneski et al. 1995).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Larvae eat various aquatic invertebrates and amphibian larvae. Adults eat terrestrial invertebrates and sometimes small vertebrates.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: > 300

Comments: Presumed extant in several hundred sites (USFWS 2004); likely there are a smaller number of distinct occurrences (discrete populations). In the Los Vaqueros watershed, Contra Costa County, Alvarez (2004) found this species in 66 of 90 stock ponds.

The Santa Barbara County distinct population segment occupies six habitat complexes with 27 documented breeding sites; these represent six metapopulations (USFWS 2000).

Sonoma County distinct population segment: currently there are 8 known breeding sites (USFWS 2003).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Abundance

10,000 - 100,000 individuals

Comments: Total adult population size is unknown but certainly exceeds 10,000 and likely is at least several 10,000s. Total population size of the Sonoma County distinct population segment is unknown (USFWS 2003).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

See Holland et al. (1990) for a description of late summer overland movements of juveniles and mass mortality of newly metamorphosed individuals.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Cyclicity

Comments: Inactive in cold or hot temperatures. Adults remain in underground burrows or crevices for much of the year, but they emerge to breed during the rainy season.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Ambystoma californiense breeds from late winter into early spring in large temporary ponds. They are explosive breeders, meaning they emerge, breed quickly, and then return to their burrows. They may breed two or three times a year this way. Juveniles migrate from these ponds to underground burrows in the spring during the rains. They are especially vulnerable to dehydration and heat stress during their overland movement (Petranka 1998, Loredo et al. 1996, Holland et al. 1990). They are rarely seen, due to nocturnal breeding migrations, and living in burrows underground (Loredo et al. 1996). Females attach one egg at a time to twigs, grass stems, vegetation, or detrious. These eggs are covered by a vitelline membrane and three jelly coats. They are distinguished by a pale yellow brown coloring and are about 2 mm in diameter (Petranka 1998). Eggs hatch 2-4 weeks after deposition (Petranka 1998, Barry and Shaffer 1994). Larvae coloring is yellowish gray. They are similiar to adults, except for large dorsal fins extending onto the back, and large feathery gills (Petranka 1998).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Breeding occurs mainly December-February, after rains fill pools and ponds. Fertilization internal. Eggs are laid singly or in small clusters, hatch in 2-4 weeks. Larvae transform in about 4 months (Behler and King 1979), as water recedes in late spring or summer, but larvae may overwinter in permanent ponds (Alvarez 2004). May not breed in drought years when ponds fail to fill. Production of metamorphs tends to be "boom or bust" at a given site (Loredo and Van Vuren 1996).

In a pond in Monterey County, most individuals matured sexually at 4-5 years, but less than 50 percent returned to breed a second time; numbers of breeding adults varied by more than a factor of four over several years, and annual juvenile production ranged from 121-775 metamorphs. This level of reproduction indicated that the population was a reproductive sink during the period of the study (Trenham et al. 2000).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Ambystoma californiense

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGATAATTACTCGATGACTATTTTCTACAAATCATAAAGATATTGGCACCCTTTATTTAGTATTTGGTGCTGGAGGCCAAATTCTTGGCACTGCCATTAGCCTATTAATCCGAGCAGAACTAAGCCAACCAGGGGCCCTATTAGGGGATGATCAAATCTATAATGTTATTGTAACAGCTCACGCATTTGTAATAATTTTTTTTATAGTTATACCTGTAATAATTGGGGGTTTTGGAAACTGATTAGTGCCATTAATAATTGGCGCACCAGATATAGCCTTCCCTCGAATGAATAATATAAGTTTTTGACTTCTTCCACCCTCTTTCCTCCTTCTATTAGCCTCCTCTGGAGTCGAAGCAGGGGCTGGAACGGGGTGAACTGTGTACCCCCCACTTGCGGGTAACCTAGCTCATGCCGGGGCCTCAGTCGATTTAACAATTTTTTCACTTCATCTAGCAGGTGTATCATCTATTTTAGGTGCAATTAATTTTATTACAACTTCAATTAACATAAAACCCGCATCAATATCACAATACCAAACCCCTTTATTTGTTTGATCAGTATTAATTACAGCAGTCCTTCTATTACTTTCTCTTCCGGTTTTAGCAGCGGGTATTACAATACTGCTGACGGATCGAAACTTAAACACAACATTCTTTGACCCTGCTGGAGGGGGTGACCCTGTACTTTACCAACACCTATTTTGATTTTTCGGACACCCAGAGGTATATATCTTAATTTTACCGGGGTTTGGAATAATTTCACATATTGTAACTTATTATTCTGCAAAAAAAGAACCATTCGGCTATATAGGAATAGTGTGAGCTATAATATCTATTGGTCTTTTAGGATTTATTGTATGAGCACATCATATATTTACAGTAGATTTAAATGTTGACACACGGGCATATTTTACATCCGCTACAATAATTATTGCCATTCCAACTGGGGTAAAAGTATTTAGCTGATTAGCAACTATACACGGAGGGGCAATTAAATGAGATGCAGCAATACTATGGGCCCTAGGCTTTATTTTTTTATTTACAGTAGGTGGTCTTACAGGAATCGTACTAGCTAATTCATCTTTAGATATTGTCCTACATGACACATATTATGTAGTAGCCCACTTTCACTATGTTCTATCAATAGGTGCCGTATTTGCTATTATAGGGGGATTTGTACACTGATTTCCACTATTCTCAGGATACACACTTCACTCAACTTGATCAAAAATTCACTTTGGGGTTATATTTATTGGTGTAAACTTAACTTTCTTCCCACAACATTTTTTAGGTTTAGCCGGGATACCGCGACGATATTCAGATTATCCTGATGCATATACGCTATGAAACACTGTTTCATCTATTGGCTCACTTATTTCTCTTGTTGCAGTAATTATAATAATATTTATTATTTGAGAAGCTTTTGCATCTAAACGAGAAGTATTATCAACAGAATTAACATCCACTAATATTGAATGACTACATAATTGCCCTCCCCCTTACCACACATTCGAAGAACCATCTTTTGTACAATCACGAATTTAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Ambystoma californiense

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
A2c

Version
3.1

Year Assessed
2004

Assessor/s
Geoffrey Hammerson

Reviewer/s
Global Amphibian Assessment Coordinating Team (Simon Stuart, Janice Chanson, Neil Cox and Bruce Young)

Contributor/s

Justification
Listed as Vulnerable because of a population decline, estimated to be more than 30% over the last three generations, inferred from habitat destruction and degradation. The generation length is estimated to be eight years.

History
  • 1996
    Vulnerable
  • 1994
    Vulnerable
    (Groombridge 1994)
  • 1990
    Vulnerable
    (IUCN 1990)
  • 1988
    Vulnerable
    (IUCN Conservation Monitoring Centre 1988)
  • 1986
    Vulnerable
    (IUCN Conservation Monitoring Centre 1986)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Special Concern species in California (Holland et al. 1990)

Category I species on Federal Endangered Species List (Loredo et al. 1996)

IUCN Red List of Threatened Species: vulnerable

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: N2 - Imperiled

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G2 - Imperiled

Reasons: Restricted to the central portion of California, where range and abundance have declined substantially as a result of habitat loss and degradation and other factors related primarily to human population growth and agricultural expansion. These factors, as well as hybridization with non-native tiger salamanders, effects of non-native species, and habitat fragmentation continue to threaten many populations. Although the species still occurs throughout most of the historical range and remains locally common in some areas, the recent and projected future rate of decline remains high. Consequently, the species was federally listed as Threatened rangewide in 2004.

Intrinsic Vulnerability: Moderately vulnerable

Comments: Populations can recover from drastic declines over a period of a few years, with high recruitment of juveniles. Given normal dispersal distances (see occurrence specifications), recolonization of habitats from which extirpated may be slow to absent if nearby populations within about 0.5-1 km are also extirpated.

USFWS (2002) reported the following: Lifetime reproductive success is low. Trenham (1998) found the average female bred 1.3 times and produced 8.5 young that survived to metamorphosis per reproductive effort; this resulted in roughly 11 metamorphic offspring over the lifetime of a female. One of the reasons for the low reproductive success is because individuals do not breed until they are 4 to 6 years old. While individuals may survive for more than 10 years, many may breed only once, and, in some populations, less than 5
percent of marked juveniles survive to become breeding adults (Trenham 1998). With such low
recruitment, isolated populations can decline greatly from unusual, randomly occurring natural events as well as from human-caused factors that reduce breeding success and individual survival. Factors that repeatedly lower breeding success in isolated ponds that are too far from other ponds for migrating individuals to replenish the population can quickly extirpate a population.

Environmental Specificity: Narrow. Specialist or community with key requirements common.

Comments: Species is a generalist with respect to terrestrial habitats, but reproduction is largely dependent on fishless bodies of water.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Current Listing Status Summary

Status: Endangered
Date Listed: 01/19/2000
Lead Region:   California/Nevada Region (Region 8)   
Where Listed: U.S.A. (CA - Santa Barbara County)

Status: Endangered
Date Listed: 07/22/2002
Lead Region:   California/Nevada Region (Region 8)   
Where Listed: U.S.A. (CA - Sonoma County)

Status: Threatened
Date Listed: 08/04/2004
Lead Region:   California/Nevada Region (Region 8)   
Where Listed: U.S.A. (Central CA DPS)


Population detail:

Population location: U.S.A. (CA - Sonoma County)
Listing status: E

Population location: U.S.A. (CA - Santa Barbara County)
Listing status: E

Population location: U.S.A. (Central CA DPS, not including Santa Barbara and Sonoma DPS)
Listing status: T

For most current information and documents related to the conservation status and management of Ambystoma californiense , see its USFWS Species Profile

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History, Abundance, Activity, and Special Behaviors

The California Tiger Salamander engages in nocturnal breeding migrations. Movement occurs from dry season refuge sites to the breeding ponds from November to April, thought most commonly from December to March. These migrations don't occur until the ground has become moist, because the breeding pools do not form until the soil below them becomes saturated from the autumn rains. Males precede females to the breeding sites, and males often outnumber females at these sites. Shortly after breeding, the adults vacate the ponds. Eggs are deposited singly or in small groups of 2-4, submerged in the relatively shallow depths of the temporary pools. A minimum of 10 weeks is required for complete development (including metamorphosis).

  • Petranka, J. W. (1998). Salamanders of the United States and Canada. Smithsonian Institution Press, Washington and London.
  • Fisher, R. N., and Shaffer, H. B. (1996). "The decline of amphibians in California's Great Central Valley." Conservation Biology, 10(5), 1387-1397.
  • Shaffer, H. B., and McKnight, M. L. (1996). ''The polytypic species revisited: differentiation and molecular phylogenetics of the Tiger Salamander Ambystoma tigrinum (Amphibia: Caudata) complex.'' Evolution, 50, 417-433.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Total adult population size is unknown, but certainly exceeds 10,000. However, it appears to be in decline due to habitat loss. It has been eliminated from 55-58% of historic breeding sites, and reportedly about 75% of the historical vernal pool-breeding habitat has been lost (Holland 1998) (though some question the reliability of this estimate). Barry and Shaffer (1994) stated that this salamander soon would be in danger of extinction throughout its range, and they noted that it already is gravely threatened in the San Francisco Bay Area and in the San Joaquin Valley. But Trenham et al. (2000) noted that the species still occurs in most of the historical range and can be locally common. In Santa Barbara County, of 14 documented breeding sites, half have been destroyed or have suffered severe degradation since mid-1999 (USFWS 2000).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Short Term Trend: Relatively stable to decline of 30%

Comments: Studies cited by USFWS (2004) indicate that losses of vernal pool habitat (the natural breeding habitat of this species) were about 1.5% annually in the 1980s and 1990s and likely will continue at a similar rate. Assuming a generation time of 8 years (generation time is the average age of parents of the current cohort), the breeding habitat decline (and consequently the population decline) would be roughly 36% over three generations (24 years; see IUCN Red List criteria). Additional reductions due to hybridization, effects of non-native species, and other factors (see USFWS 2004) would increase the extent of population reduction. Hence, a recent/ongoing population reduction of more than 30% over three generations would not be an unreasonable projection.

In Santa Barbara County, of 14 documented breeding sites, half have been destroyed or have suffered severe degradation since mid-1999 (USFWS 2000).

Sonoma County population: in the past two years, four breeding sites have been destroyed or have suffered severe degradation; only seven remain (USFWS 2002).

Global Long Term Trend: Decline of 30-70%

Comments: Eliminated from 55-58% of historical breeding sites; reportedly about 75% of the historical vernal pool breeding habitat has been lost (Holland 1998) (though some question the reliability of this estimate).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Life History, Abundance, Activity, and Special Behaviors

Like many other amphibians in central California, this species has suffered from habitat lost due to the conversion of land for agricultural and urban uses (Fisher and Shaffer 1996). In Sonoma County, 95% of the salamander's preferred vernal pool and grassland/oakland habitat has been lost. The Sonoma population was classified as Endangered in 2003, and the Santa Barbara population of Ambystoma californiense was listed as Endangered in 2000. Another threat comes from the introduction of predatory fishes such as the mosquitofish, which is still used as a method of mosquito control. California Tiger Salamanders also seem to have been adversely affected by the 1986-1990 California drought, which led to a decrease in suitable breeding habitat.

  • Petranka, J. W. (1998). Salamanders of the United States and Canada. Smithsonian Institution Press, Washington and London.
  • Fisher, R. N., and Shaffer, H. B. (1996). "The decline of amphibians in California's Great Central Valley." Conservation Biology, 10(5), 1387-1397.
  • Shaffer, H. B., and McKnight, M. L. (1996). ''The polytypic species revisited: differentiation and molecular phylogenetics of the Tiger Salamander Ambystoma tigrinum (Amphibia: Caudata) complex.'' Evolution, 50, 417-433.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats
Most of the remaining range, including population strongholds in eastern Alameda and Contra Costa counties and areas south and west of Millerton Lake in Madera and Fresno counties, is imminently threatened by urban development, conversion of natural habitat to agriculture, introduction of exotic predatory animals (bullfrogs, crayfish, various fishes) that temporarily may occupy salamander breeding habitat, and/or other anthropogenic factors (e.g., rodent control programs, vehicle-related mortality). Reduced ground squirrel populations might reduce the availability of burrows, which are important habitats during the dry season. The use of pesticides for mosquito abatement might reduce food resources for salamanders. Introduction of non-native tiger salamanders might harm populations through hybridization and/or competition. Contaminated runoff from roads might adversely affect salamanders in breeding sites. Localities in the Diablo Range, inner Coast Ranges, and Sierra Nevada foothills are not significantly threatened at present, and there are still a relatively large number of remaining breeding localities. In Santa Barbara County, plans to convert remaining breeding areas from grazing to intensive agriculture are being developed and implemented (USFWS 2000). Five of the six existing habitat complexes supporting this population suffered moderate to severe levels of habitat destruction or degradation between 1996 and 2000 (USFWS 2000). See USFWS (2000) for further information on threats to the Santa Barbara County population.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Degree of Threat: B : Moderately threatened throughout its range, communities provide natural resources that when exploited alter the composition and structure of the community over the long-term, but are apparently recoverable

Comments: Most of the remaining range, including population strongholds in eastern Alameda and Contra Costa counties and areas south and west of Millerton Lake in Madera and Fresno counties, is imminently threatened by urban development, conversion of natural habitat to agriculture, introduction of exotic predatory animals (bullfrogs, crayfish, various fishes) that temporarily may occupy salamander breeding habitat, and/or other anthropogenic factors (e.g., rodent control programs, vehicular-related mortality). Reduced ground squirrel populations may reduce the availability of burrows, which are important habitat during the dry season. Use of pesticides for mosquito abatement may reduce food resources for salamanders. Introduction of non-native tiger salamanders may harm populations through hybridization and/or competition. Contaminated runoff from roads may adversely affect salamanders in breeding sites. Chytrid fungus (associated with decline of other amphibian species) has been identified in this species (Santa Clara County), but the infection was not reported as being associated with a die-off (Padgett-Flohr and Longcore 2005). Localities in the Diablo Range, inner Coast Ranges, and Sierra Nevada foothills are not significantly threatened at the present time, and there is a relatively large number of remaining breeding localities.

In Santa Barbara County, plans to convert remaining breeding areas from grazing to intensive agriculture are being developed and implemented (USFWS 2000). Five of the six existing habitat complexes supporting this population suffered moderate to severe levels of habitat destruction or degradation between 1996 and 2000 (USFWS 2000). See USFWS (2000) for further information on threats to the Santa Barbara County population.

Sonoma County population: Primary threat is continuing habitat destruction, degradation, and fragmentation. Reduction in the extent and amount of suitable water bodies, grasslands, and other suitable upland habitats likely has eliminated connectivity among most of the breeding sites, making recolonization of some sites following local extinction more difficult. In addition, habitat reduction lowers the quality of the remaining habitat, by reducing the amount of food, rodent burrows, and other resources (USFWS 2002). Plans to construct a residential development will result in the loss of one of the seven remaining breeding sites and severely impact and further isolate another two of the remaining breeding sites. Because these losses constitute an emergency posing a significant and imminent risk to the well-being of the Sonoma County Distinct Population Segment, USFWS (2002) found that emergency listing was necessary. Secondary threats exist from predation and competition from introduced exotic species; possible commercial overutilization; disease; hybridization with non-native salamanders; various chemical contaminants; road-crossing mortality; rodent control operations, and the species' small remaining population (USFWS 2003). The various primary and secondary threats are not currently being offset by existing Federal, State, or local regulatory mechanisms. The Sonoma County California tiger salamander also is vulnerable to chance environmental or demographic events, to which small populations are particularly vulnerable. The combination of its biology and specific habitat requirements makes the animal highly susceptible to random events, such as drought, disease, and other occurrences. Such events are not usually a concern until the number of breeding/estivation sites or geographic distribution become severely limited, as is the case with the Sonoma County California tiger salamander (USFWS 2003). Predation and competition by introduced or non-native species potentially affects all of the known Sonoma County California tiger salamander breeding sites (USFWS 2002). USFWS (2003) discussed hybridization with non-native tiger salamanders (A. tigrinum)--documented as occurring elsewhere in the range of A. californiense--as a potential threat to this population. See USFWS (2002, 2003) for further discussion of potential threats.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
This species occurs in several state and regional parks and other at least semi-protected areas. Most populations are on private land; an estimated 5% of known populations occur on government-owned lands. In Santa Barbara County, all of the known and potential habitat is largely on unprotected private land (USFWS 2000). As of August 2005, the California Tiger Salamander is protected by California law as a threatened species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Preserve Selection and Design Considerations: Isolated breeding ponds may be insufficient for long-term maintenance of viable populations (Trenham et al. 2000).

Management Requirements: For the Lagunita population at Stanford University, Barry and Shaffer (1994) recommended construction of a drift fence and tunnel system to divert migrating adults and juveniles underneath the highway, maintenance of water levels through mid-summer to allow most larvae to complete metamorphosis, and excavation of sumps in the lake bed to entrap larvae and keep them from being swept down the lake drain.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Protection: Several (4-12) occurrences appropriately protected and managed

Comments: This species occurs in several state and regional parks and other at least semi-protected areas. Most populations are on private land; an estimated 5% of known populations occur on government-owned lands.

In Santa Barbara County, all of the known and potential habitat is largely on unprotected private land (USFWS 2000).

USFWS (2005) decided that none of the potential critical habitat for the Sonoma County distinct population
segment of the California tiger salamander would de designated as critical habitat, based on interim conservation strategies and measures being implemented by those local governing agencies with land use authority over the area and also as a result of economic exclusions authorized under section 4(b)(2) of the Endangered Species Act.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Risks

Relation to Humans

The California Department of Fish and Game has just declared Ambystoma californiense a candidate Endangered Species, as of February 5, 2009. Within one year the decision will be made by Fish and Game as to whether all California Tiger Salamanders will be protected under the Endangered classification. Public action will help determine if Ambystoma californiense receives this protection. If you agree that the California Tiger Salamander should be declared Endangered, write to:

California Fish and Game Commission
1416 Ninth Street
P.O. Box 944209
Sacramento, CA 94244-2090
Phone (916) 653-4899
Fax (916) 653-5040

For more information see The Center for Biological Diversity's website.

  • Petranka, J. W. (1998). Salamanders of the United States and Canada. Smithsonian Institution Press, Washington and London.
  • Fisher, R. N., and Shaffer, H. B. (1996). "The decline of amphibians in California's Great Central Valley." Conservation Biology, 10(5), 1387-1397.
  • Shaffer, H. B., and McKnight, M. L. (1996). ''The polytypic species revisited: differentiation and molecular phylogenetics of the Tiger Salamander Ambystoma tigrinum (Amphibia: Caudata) complex.'' Evolution, 50, 417-433.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

California tiger salamander

The California tiger salamander (Ambystoma californiense) is a vulnerable amphibian native to Northern California. Previously considered to be a tiger salamander subspecies, the California tiger salamander was recently designated a separate species again.[2] The California tiger salamander distinct population segment (DPS) in Sonoma County is listed as federally endangered and in the Santa Barbara County) DPS and Central California DPS, they are federally threatened.[3][4] The Sonoma County and Santa Barbara County DPS's have been split from the rest of the California tiger salamander population for over 1 million years, and they may warrant status as separate species.

Contents

Description [edit]

The California tiger salamander is a relatively large, secretive amphibian endemic to California. Adults can grow to a length of about 7–8 inches. It has a stocky body and a broad, rounded snout. Adults are black with yellow or cream spots; larvae are greenish-grey in color. The California tiger salamander has brown protruding eyes with black irises.

Habitat and range [edit]

The California tiger salamander depends on vernal pools for reproduction; its habitat is limited to the vicinity of large, fishless vernal pools or similar water bodies. It occurs at elevations up to 1000 m (3200 ft). Adults migrate at night from upland habitats to aquatic breeding sites during the first major rainfall events of fall and early winter, and return to upland habitats after breeding.

Historically, the California tiger salamander probably occurred in grassland habitats throughout much of the state. It occurs from Sonoma County, especially in the Laguna de Santa Rosa (outside the floodplain), south to Santa Barbara County, in vernal pool complexes and isolated ponds along the Central Valley from Colusa County to Kern County, and in the coastal range. Both the Sonoma and Santa Barbara populations are listed as endangered since 2000 and 2003, respectively. On August 4, 2004, the US Fish and Wildlife Service listed the California tiger salamander as threatened within the Central Valley DPS. The Santa Barbara and Sonoma County populations were returned to endangered status on August 19, 2005.

The six populations are found in Sonoma County, the Bay Area (Stanislaus County, western Merced, and the majority of San Benito counties), the Central Valley, the southern San Joaquin Valley, the Central Coast Range, and Santa Barbara County. [5][6]

The loss of California tiger salamander populations has been due primarily to habitat loss within their historic range, although introduced predators, such as American bullfrogs might also be an issue.[7][8]

Lifecycle [edit]

Adults spend the majority of their lives underground, in burrows created by other animals, such as ground squirrels and gophers;[9] these salamanders are poorly equipped for burrowing. Little is known about their underground life. This underground phase has often been referred to as estivation (the summertime equivalent of hibernation), but true estivation has never been observed, and fiber optic cameras in burrows have allowed researchers to witness salamanders actively foraging. Adults are known to eat earthworms,[10] snails, insects, fish, and even small mammals[11][12] but adult California tiger salamanders eat very little.[13]

Breeding takes place after the first rains in late fall and early winter, when the wet season allows the salamanders to migrate to the nearest pond, a journey that may be as far as a mile and take several days. The eggs, which the female lays in small clusters or singly, hatch after 10 to 14 days.

The larval period lasts for three to six months. However, California tiger salamander larvae may also "overwinter". Transformation for overwintering larvae may take 13 months or more. Recent discoveries, such as overwintering, have management implications for this threatened species, particularly when aquatic habitats undergo modification. The larvae feed on other small invertebrates, including tadpoles. When their pond dries, they resorb their gills, develop lungs, and then the metamorphs leave the pond in search of a burrow.

California tiger salamanders can live up to 15 years.[citation needed]

See also [edit]

References [edit]

  1. ^ Hammerson (2004). "Ambystoma californiense". IUCN Red List of Threatened Species. Version 2004. International Union for Conservation of Nature. Retrieved 17 February 2010. 
  2. ^ Shaffer, H. B. and S. Stanley. 1991. Final report to California Department of Fish and Game; California tiger salamander surveys, 1991 - Contract FG9422. California Department of Fish and Game, Inland Fisheries Division, Rancho Cordova, California.
  3. ^ "Species Account: California Tiger Salamander". U.S. Fish and Wildlife Service. July 29, 2009. Retrieved February 17, 2010. 
  4. ^ California Tiger Salamander Endangered Species Facts (Report). Environmental Protection Agency. 2010-02. http://www.epa.gov/espp/factsheets/ca-tiger-salamander.pdf. Retrieved 2013-03-14.
  5. ^ Federal Register / Vol. 68, No. 53 / Wednesday, March 19, 2003 / Rules and Regulations Access date 2009 10 19 http://ftp.resource.org/gpo.gov/register/2003/2003_13498.pdf
  6. ^ Shaffer, H. B. and P. C. Trenham. 2002. Distinct population segments of the California tiger salamander, Ambystoma californiense. Report to the USFWS.
  7. ^ Fisher, R. N. and H. B. Shaffer. 1996. The decline of amphibians in California’s Great Central Valley. Conservation Biology 10:1387-1397.
  8. ^ Center for Biological Diversity, Citizens for a Sustainable Cotati, Petitioners June 11, 2001. Accessed 2009 10 19 http://www.biologicaldiversity.org/species/amphibians/California_tiger_salamander/pdfs/PETITION.PDF
  9. ^ CaliforniaHerps.com. Ambystoma californiense - California Tiger Salamander. Access 2009 10 19. http://www.californiaherps.com/salamanders/pages/a.californiense.html
  10. ^ University of Michigan Animal Diversity Web: Ambystoma californiense, California tiger salamander. Accessed 2009 10 19. http://animaldiversity.ummz.umich.edu/site/accounts/information/Ambystoma_californiense.html
  11. ^ T. Kucera, 1997 California Department of Fish and Game- California Wildlife Habitat Relationships System. Updated by: CWHR Program Staff, August 2005
  12. ^ Stebbins, R. C. 1972. California amphibians and reptiles. Univ. California Press, Berkeley. 152 pp.
  13. ^ Shaffer, H. B., R. N. Fisher, and S. E. Stanley. 1993. Status report: the California tiger salamander (Ambystoma californiense). Final report to the California Department of Fish and Game, Inland Fisheries Division, Rancho Cordova California, under Contracts (FG9422 and 1383)
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Formerly regarded as a subspecies of Ambystoma tigrinum. See Kraus (1988), Shaffer et al. (1991), and Jones et al. (1993) for phylogenetic analyses of North American Ambystoma; these analyses treated californiense as a distinct species.

Based on genetic analysis, there are six populations of California tiger salamanders, distributed as follows: (1) Santa Rosa area of Sonoma County; (2) Bay Area (central and southern Alameda, Santa Clara, western
Stanislaus, western Merced, and the majority of San Benito counties); (3) Central Valley (Yolo, Sacramento,
Solano, eastern Contra Costa, northeast Alameda, San Joaquin, Stanislaus, Merced, and northwestern Madera
counties); (4) southern San Joaquin Valley (portions of Madera, central Fresno, and northern Tulare and Kings
counties); (5) Central Coast Range (southern Santa Cruz, Monterey, northern San Luis Obispo, and portions
of western San Benito, Fresno, and Kern counties); and (6) Santa Barbara County (Shaffer and Trenham 2002).


USFWS (2000, 2002) reviewed the biogeographical and genetic information supporting the recognition of the Santa Barbara County population and Sonoma County population as distinct population segments under the U.S. Endangered Species Act.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!