Articles on this page are available in 1 other language: Spanish (7) (learn more)

Overview

Brief Summary

Biology

Although the axolotl remains in larval form throughout its life, it becomes sexually mature between 12 and 18 months of age. Males 'dance' to initiate courtship, nudging the female before depositing several cone-shaped packets of sperm known as spermatophores onto rocks and plants. These are taken up by the female's cloaca, for internal fertilisation of her eggs. She lays the eggs 24 hours later, each one becoming enveloped in mucus as it emerges. They become glued to each other and to the substrate (3) where they incubate for two to three weeks (2). A single female can produce up to 400 eggs in a day, averaging 175 – 200 (3). The axolotl is inactive during the day, resting on the substrate with the gills splayed. They move slowly and may surface occasionally to take a breath of air (3). Young axolotl feed on algae, but older individuals will take aquatic invertebrates. The axolotl is primarily preyed upon by herons (2). A species of fascination to scientists the world over, the axolotl has many study-worthy traits. Whilst able to remain in larval form throughout its life, the axolotl can metamorphose into a fully-adult Mexican salamander if its habitat dries up. Additionally, rather than forming scar tissue when wounded, tissues at the wound site convert to a stem cell-like state, meaning that they are able to re-grow missing tissue in its entirety, even a whole limb (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

This astonishing species is part of the family of 'mole salamanders', but exhibits an unusual and extreme trait known as neoteny, or paedomorphosis. This is the retention of larval stage characteristics throughout life, so axolotls usually never fully resemble an adult salamander. Unlike other amphibians, most axolotl fail to metamorphose, living permanently in water (3). Although it does develop lungs, the axolotl's most bizarre feature is its retention of its branch-like gills. These are external projections from the neck on each side of the head. Each side has three branches covered with feathery filaments which increase the surface area for gas exchange. The axolotl has a long, slim and darkly coloured body, and short legs, with four digits on the front feet and five digits on the hind feet. Albino individuals have been bred in captivity, but are not known to live in the wild (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Description

A. mexicanum, also known as the Mexican Axolotl, is a long, cylindrical salamander, reaching lengths of about 30 centimeters (12 inches). A neotenic salamander, its most notable physical feature is its gills, which protrude from the back of its wide head and remain there throughout adulthood. Its legs are short. It has four fingers on each of its front legs and five toes on each of its back legs. In the wild, its coloration is dark, but an albino variety has been bred in captivity (Utah's Hogle Zoo 2003).
  • Griffiths, H. I. and Thomas, D. H. (1988). ''What is the status of the Mexican Axolotl?'' British Herpetological Society Bulletin, 88, 3-5.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

This species is known only from central Mexico, on the southern edge of Mexico City, in canals and wetlands in the general vicinity of Xochimilco (including outside the Xochimilco city limits, around the Chalco wetland). The animals are not homogeneously distributed through their range, and congregate in particular places. Records from close to downtown Mexico City in the Chapultepec Lake could refer to either this species or Ambystoma velasci, and require confirmation. It was originally found in Lakes Xochimilco and Chalco (and presumably in the connecting lakes Texcoco and Zumpango), but it has disappeared from most of its range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Ambystoma mexicanum is historically found in Lakes Chalco and Xochimilco of the Valley of Mexico near Mexico City, Mexico.

Biogeographic Regions: neotropical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution and Habitat

Ambystoma mexicanum lives only in Lake Xochimilco and Lake Chalco, both adjacent to Mexico City. Xochimilco and Chalco are part of a complex of five lakes, among which the Aztecs built Mexico City and around which the city has since expanded. The lakes were once highly productive, many of their species being economically and nutritionally valuable. Today a great deal of the area has been drained, or compromised by development of other kinds. Lake Xochimilco is known for its "floating gardens," or "chinampas," strips of land between drainage channels where locals grow vegetables and flowers for market. A. mexicanum can be found in these channels and in remaining lake areas. It may have previously lived in the channels joining two of the other lakes in the complex (Griffiths et al. 1988). In the wild, the species lives underwater. Outside of the wild, it is kept as an aquarium pet and is used widely in laboratory experiments.
  • Griffiths, H. I. and Thomas, D. H. (1988). ''What is the status of the Mexican Axolotl?'' British Herpetological Society Bulletin, 88, 3-5.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

The axolotl previously occupied Lakes Xochimilca and Chalco and the surrounding water channels on the southern edge of Mexico City, but has been lost from most of its range (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Axolotls are paedomorphic or neotenic aquatic salamanders, meaning they retain certain larval characteristics in the adult, reproductive state. They possess feathery external gills and finned tails for swimming. Laboratory animals exist in several color morphs, ranging from wild type (dark, mottled brownish-green) to albino. Axolotls reach lengths on average of 20 cm (9 inches), but can grow to more than 30 cm (12 inches) in length.

The sexes can be easily distinguished in adult axolotls. Males can be identified by their enlarged cloaca (similar to other urodeles), while females have a smaller cloaca and round, plump bodies.

Range mass: 60 to 110 g.

Range length: 30 (high) cm.

Average length: 23 cm.

Sexual Dimorphism: sexes shaped differently

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species is native to the ancient system of water channels and lakes in Mexico City. It requires deep-water lakes (both natural and artificial canals) with abundant aquatic vegetation. Structures such as plants are needed to lay eggs. It is a paedomorphic species, living permanently in water, and does not undergo complete metamorphosis.

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

The native habitats of A. mexicanum are large, relatively permanent (until recently), high-altitude lakes located near Mexico City. Of the two lakes - Chalco and Xochimilco - where these animals are historically native, only Xochimilco (elevation: ~ 2,274 m) remains. Axolotls are almost extinct in their native habitat, largely due to the introduction of predatory fishes and habitat loss.

Average elevation: 2290 m.

Habitat Regions: freshwater

Aquatic Biomes: lakes and ponds

  • Encyclopædia Britannica Premium Service. 2003. Xochimilco. Encyclopaedia Britannica. Accessed 06/13/03 at http://www.britannica.com/eb/article?.eu=79786.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

It is native to the ancient water channel system of Mexico City, preferring deep brackish water with plenty of vegetation (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Generally the top predator in their natural environment, axolotls will eat anything that they can catch, including molluscs, fishes, and arthropods, as well as conspecifics.

Animal Foods: amphibians; fish; insects; mollusks; terrestrial worms; zooplankton

Primary Diet: carnivore (Piscivore , Insectivore , Eats non-insect arthropods, Molluscivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Axolotls were the top predator in their native environment, making them important in structuring community dynamics.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Axolotls may be preyed on by large fish and conspecifics. Large fish have only recently been introduced into the lakes where axolotls are found, contributing to the demise of their populations.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Ambystoma mexicanum preys on:
non-insect arthropods
Actinopterygii
zooplankton
Annelida
Mollusca
Insecta
Amphibia

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Axolotls communicate mainly via visual cues and chemical cues during mating. At other times of the year there is little to no intraspecific communication.

Axolotls can detect electrical fields and also use their vision and chemical cues to perceive their environment and discover prey.

Communication Channels: visual ; chemical

Other Communication Modes: pheromones

Perception Channels: visual ; chemical ; electric

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

Development

A. mexicanum is paedomorphic, which means that it retains larval characteristics in the reproductively mature adult form. Juvenile and adult axolotls possess feathery, external gills and tail fins suited to an aquatic lifestyle. Metamorphosis can be induced in axolotls via thyroid hormone injections. In the wild, axolotls rarely, if ever, metamorphose.

Development - Life Cycle: neotenic/paedomorphic; metamorphosis

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Expected laboratory longevity is 5 to 6 years; however, some animals have been known to live as long as 10 to 15 years. Most laboratory animals die shortly after metamorphosis.

Range lifespan

Status: captivity:
15 (high) years.

Average lifespan

Status: captivity:
5 - 6 years.

Typical lifespan

Status: captivity:
6 (high) years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 17 years (captivity) Observations: The axolotl is a classic case of neoteny in that animals become sexually mature without undergoing the final metamorphosis to the land-borne adult. Although very rare in the wild, it is possible to induce metamorphosis in the lab using thyroxine injections but animals die shortly afterwards (Brunst 1955). Like other similar species, the axolotl is capable of limb regeneration, the study of which could be of benefit to regenerative medicine (Roy and Gatien 2008). Anecdotal evidence, which seems possible, suggests these animals may live up to 25 years.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

The courtship behavior of A. mexicanum follows the general Ambystoma pattern; it first involes each animal nudging the other's cloacal region, eventually leading to a "waltz," with both animals moving in a circle. Next, the male moves away while undulating the posterior part of his body and tail (resembling a "hula dance"), and the female follows. The male will deposit a spermatophore (a cone-shaped jelly mass with a sperm cap) by vigorously shaking his tail for about half a minute, and will then move forward one body length. The female then moves over the spermatophore, also shaking her tail, and picks up the spermatophore with her cloaca.

Mating System: polygynandrous (promiscuous)

Axolotls breed in the wild generally from March to June. From 100 to 300 eggs are deposited in the water and attached to substrates. Eggs hatch at 10 to 14 days and the young are immediately independent. Sexual maturity is reached in the next breeding season.

Breeding interval: Axolotls in the wild breed once yearly.

Breeding season: Breeding laboratory axolotls can be accomplished at almost any time; in the wild, it is thought that the best time for spawning is March to June.

Range number of offspring: 100 to 300.

Range time to hatching: 10 to 14 days.

Range time to independence: 10 to 14 days.

Average age at sexual or reproductive maturity (female): 1 years.

Average age at sexual or reproductive maturity (male): 1 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (Internal ); oviparous

Eggs are surrounded by a protective jelly coat and are laid singly, unlike frog eggs (which are laid in clumped masses), because they possess higher oxygen requirements. They are often attached to substrates such as rocks or floating vegetation.

Parental Investment: no parental involvement; pre-hatching/birth (Provisioning: Female)

  • Eisthen, H. 1989. Courtship and mating behavior in the axolotl. Axolotl Newsletter, 18: 18-19.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Ambystoma mexicanum

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBAP0056-06|AY659991|Ambystoma mexicanum| ACCGGATGATTATTTTCTACAAATCATAAAGATATTGGCACCCTTTATTTAGTATTTGGTGCTTGAGCCGGGATAGTTGGCACTGCATTA---AGCCTTCTAATCCGAGCAGAATTAAGCCAACCAGGAGCCCTACTAGGGGAT---GATCAAATCTATAATGTTATTGTAACAGCACACGCATTTGTAATAATTTTTTTTATAGTAATACCTGTAATAATCGGGGGATTCGGAAACTGATTAGTACCATTAATA---ATTGGTGCACCAGATATGGCCTTCCCCCGTATAAACAATATAAGCTTTTGGCTTCTTCCTCCTTCATTCCTCCTTCTATTAGCATCCTCTGGAGTTGAGGCAGGAGCTGGAACGGGATGAACTGTATATCCCCCACTTGCAGGGAACCTAGCCCATGCCGGGGCCTCAGTCGATTTA---ACAATTTTTTCACTTCATTTAGCAGGTGTTTCATCTATCCTGGGTGCAATTAATTTTATTACAACCTCAATTAATATAAAACCCGCATCAATATCACAATATCAAACCCCTTTATTTGTTTGATCAGTATTAATTACAGCAGTTCTTCTATTACTTTCTCTTCCGGTTTTAGCAGCG---GGAATTACAATACTGCTGACAGATCGAAACTTAAACACAACATTCTTTGATCCCGCCGGAGGGGGTGACCCTGTACTTTATCAACATCTATTTTGATTTTTTGGGCACCCAGAAGTATATATCTTAATCTTACCCGGATTTGGAATAATTTCACATATTGTGACTTATTATTCTGCAAAAAAA---GAACCATTTGGTTACATAGGAATAGTATGAGCTATAATATCTATCGGGCTTCTAGGGTTTATCGTATGGGCACATCATATATTTACAGTAGATTTAA 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Ambystoma mexicanum

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Species: 3
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
CR
Critically Endangered

Red List Criteria
B2ab(iii,v)

Version
3.1

Year Assessed
2010

Assessor/s
Luis Zambrano, Paola Mosig Reidl, Jeanne McKay, Richard Griffiths, Brad Shaffer, Oscar Flores-Villela, Gabriela Parra-Olea, David Wake

Reviewer/s
Global Amphibian Assessment Coordinating Team (Simon Stuart, Janice Chanson, Neil Cox and Bruce Young)

Contributor/s

Justification
Listed as Critically Endangered because its Area of Occupancy is less than 10km2, its distribution is severely fragmented, and there is a continuing decline in the extent and quality of its habitat and in the number of mature individuals.

History
  • 2006
    Critically Endangered
    (IUCN 2006)
  • 2004
    Vulnerable
  • 1996
    Vulnerable
  • 1994
    Rare
    (Groombridge 1994)
  • 1990
    Rare
    (IUCN 1990)
  • 1988
    Rare
    (IUCN Conservation Monitoring Centre 1988)
  • 1986
    Rare
    (IUCN Conservation Monitoring Centre 1986)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

The natural habitat of A. mexicanum is nearly gone. Historically, they have been known to live in high altitude lakes near Mexico City. Lake Chalco is gone completely, drained for drinking water, and Lake Xochimilco is now nothing more than a scattering of canals and swamps. Because known populations are few and far between, very little is known about the ecology and natural history of A. mexicanum; there have been few ecological studies on wild populations.

CITES: appendix ii

IUCN Red List of Threatened Species: critically endangered

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

The axolotl is classified as Critically Endangered (CR) on the IUCN Red List 2006 (1) and is listed on Appendix II of CITES (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
The surviving wild population is very small. Although populations are difficult to assess, recent surveys covering almost all of its known distribution range have usually captured fewer than 100 individuals (e.g., during 2002 and 2003, more than 1,800 net casts were made along Xochimilco canals covering 39,173m² and this resulted in a catch of only 42 specimens). In a study covering a span of six years (from 1998 to 2004), axolotl density had reduced from 0.006-org/ m2 to 0.001-org/ m2, although it is thought that this reduction could also be due to its own population dynamics (Zambrano 2006). A recent scientific survey revealed no axolotls, although wild-caught animals are still found in the local market, which indicates that fishermen still know where to find them. There has not been a density study of the Chalco population, but evidence suggests that the population there is small and, furthermore, Chalco is a highly unstable system that runs the risk of disappearing in the near future.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History, Abundance, Activity, and Special Behaviors

The most notable feature of the life history of A. mexicanum is that the species exhibits an extreme form of neoteny: it remains in its aquatic larval form its entire life, meaning that when it reaches sexual maturity at the approximate age of one and a half years, it remains in other regards a larva. Paedomorphic features include the maintenance of gills into adulthood. While young, A. mexicanum feeds on algae, but as it grows older, it takes to eating aquatic insects. If a locality where it lives dries up, A. mexicanum metamorphoses into the Mexican salamander. As for reproduction, the male releases sperm packets, which are taken up by the female for internal fertilization. Incubation lasts 2-3 weeks. In the wild, A. mexicanum lives ten to twelve years. Its major predators are predatory birds such as herons (Utah's Hogle Zoo 2003).
  • Griffiths, H. I. and Thomas, D. H. (1988). ''What is the status of the Mexican Axolotl?'' British Herpetological Society Bulletin, 88, 3-5.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
The desiccation and pollution of the canal system and lakes in Xochimilco and Chalco, as a result of urbanization, as well as the traditional consumption of the species by local people, is threatening the survival of this species. Increased tourist activity is poorly regulated and adds further pollution (Zambrano, 2006). The species is also captured for medicinal purposes. The harvesting is targeted at animals that are less than one year old. It was formerly also captured for the international pet trade, although probably all animals in the international trade are now of captive origin. Introduced fishes (tilapia and carp) have increased to high abundances (a recent study collected 600kg of tilapia in one small channel using a 100m net) and have also impacted axolotls through competition and predation. The animals are also being affected by disease, probably spread by invasive species, and as a result of poor water quality. Although the water regime has changed in the last 10 years, and it is reported that pollution levels are decreasing, factors such as very high levels of bacterial contamination could still pose a serious threat.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History, Abundance, Activity, and Special Behaviors

A. mexicanum has become vulnerable in the wild. The major threats to its continued existence are land drainage and the growth of Mexico City. Various efforts at flood control and sewage disposal starting in the seventeenth century have led to serious damage to the lake complex. The digging of wells for the burgeoning population of Mexico City has also caused drying of the valley in which the lakes are located. The largest of the lakes, Texcoco, has been greatly diminished in size, while Lake Chalco has all but disappeared. Xochimilco has likewise suffered a decline in size and water quality (Griffiths et al. 1988). A further threat specific to A. mexicanum is its commercial sale as food in the markets of Mexico (Utah's Hogle Zoo 2003).
  • Griffiths, H. I. and Thomas, D. H. (1988). ''What is the status of the Mexican Axolotl?'' British Herpetological Society Bulletin, 88, 3-5.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Whilst there are large numbers of axolotls in captivity around the world, particularly in biomedical and physiological research laboratories, numbers of wild axolotls are very low. Previously, capture of this species for the international pet and research trade contributed to population declines, but the axolotl now breeds well in captivity, alleviating this threat. It was also captured for consumption by local people, although numbers are now too low for this. The most significant threat to the axolotl is the increasing pollution of the lakes and canal system as Mexico City continues to grow (1). Land drainage, flood control and sewage disposal methods from the 17th century to the present have all contributed to the destruction of the water system of Mexico City (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Conservation action is focusing on raising the profile of Lake Xochimilco through conservation education and a nature tourism initiative, coupled with work on habitat restoration and bioremediation. A species action plan has been drafted. There are several captive colonies around the world, since the species is used in physiological and biomedical research, as well as in the pet trade, but the re-introduction of captive-bred axolotls is not recommended until threats can be mitigated, and disease and genetic risks to the wild populations assessed. This species is protected under the category Pr (Special protection) by the Government of Mexico and is in process of being amended to a higher risk category. Although this species is currently on CITES Appendix II, it is currently under the process of "Periodic Review of species included in CITES Appendices".
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Recent stabilisation of axolotl numbers may be attributable to the restoration of the Parco Ecologico Xochimilco over the last 20 years. This protected area requires continued restoration to support the axolotl population, which, it is hoped, may begin to increase with the introduction of captive-bred axolotls. The axolotl is protected under category Pr (special protection) by the government of Mexico (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There are no negative effects of axolotls on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Axolotls are an important research animal and have been used in studies of the regulation of gene expression, embryology, neurobiology, and regeneration. Occasionally taken as a food item (substituted for fish), axolotls are prepared by either roasting or boiling and the tail is eaten with vinegar or cayenne pepper. They have also been used for medicinal purposes.

Positive Impacts: pet trade ; food ; source of medicine or drug ; research and education

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Risks

Relation to Humans

In the wild, the species lives underwater and is not commonly seen. Outside of the wild, it is a popular aquarium species around the world and is used widely in laboratory experiments (Griffiths et al. 1988).
  • Griffiths, H. I. and Thomas, D. H. (1988). ''What is the status of the Mexican Axolotl?'' British Herpetological Society Bulletin, 88, 3-5.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Axolotl

The axolotl (play /ˈæksəlɒtəl/; etymol. náhuatl axolotl - "water monster"), Ambystoma mexicanum, is a neotenic salamander, closely related to the Tiger Salamander. Larvae of this species fail to undergo metamorphosis, so the adults remain aquatic and gilled. It is also called ajolote (which is also a common name for different types of salamander).[1] The species originates from numerous lakes, such as Lake Xochimilco underlying Mexico City.[2] Axolotls are used extensively in scientific research due to their ability to regenerate limbs.

Axolotls should not be confused with waterdogs, the larval stage of the closely related Tiger Salamanders (Ambystoma tigrinum and Ambystoma mavortium), which are widespread in much of North America and also occasionally become neotenic, nor with mudpuppies (Necturus spp.), fully aquatic salamanders which are not closely related to the axolotl but bear a superficial resemblance.[1]

As of 2010, wild axolotls are near extinction[3] due to urbanization in Mexico City and polluted waters. Nonnative fish such as African tilapia and Asian carp have also recently been introduced to the waters. These new fish have been eating the axolotls' young, as well as its primary source of food.[4] The axolotl is currently on the International Union for Conservation of Nature's annual Red List of threatened species.[5]

Contents

Description

Axolotl in captivity

A sexually mature adult axolotl, at age 18–24 months, ranges in length from 15–45 cm (6–18 in), although a size close to 23 cm (9 in) is most common and greater than 30 cm (12 in) is rare. Axolotls possess features typical of salamander larvae, including external gills and a caudal fin extending from behind the head to the vent.[citation needed] Their heads are wide, and their eyes are lidless. Their limbs are underdeveloped and possess long, thin digits. Males are identified by their swollen cloacae lined with papillae, while females are noticeable for their wider bodies full of eggs. Three pairs of external gill stalks (rami) originate behind their heads and are used to move oxygenated water. The external gill rami are lined with filaments (fimbriae) to increase surface area for gas exchange.[citation needed] Four gill slits lined with gill rakers are hidden underneath the external gills. Axolotls have barely visible vestigial teeth, which would have developed during metamorphosis. The primary method of feeding is by suction, during which their rakers interlock to close the gill slits. External gills are used for respiration, although buccal pumping (gulping air from the surface) may also be used in order to provide oxygen to their lungs. Axolotls have four different colours, two naturally occurring colors and two mutants. The two naturally occurring colors are "wildtype" (varying shades of brown usually with spots) and melanoid (black). The two mutant colors are leucistic (pale pink with black eyes) and albino (golden, tan or pale pink with pink eyes).[citation needed]

Habitat and ecology

The axolotl is only native to Lake Xochimilco and Lake Chalco in central Mexico. Unfortunately for the axolotl, Lake Chalco no longer exists as it was artificially drained to avoid periodic flooding, and Lake Xochimilco remains a diminished glimpse of its former self, existing mainly as canals. The water temperature in Xochimilco rarely rises above 20 °C (68 °F), though it may fall to 6 or 7 °C (45 °F) in the winter, and perhaps lower. The wild population has been put under heavy pressure by the growth of Mexico City.[5] Axolotls are also sold as food in Mexican markets and were a staple in the Aztec diet.[4] They are currently listed by CITES as an endangered species and by IUCN as critically endangered in the wild, with a decreasing population.

Axolotls are members of the Ambystoma tigrinum (Tiger salamander) complex, along with all other Mexican species of Ambystoma. Their habitat is like that of most neotenic species—a high altitude body of water surrounded by a risky terrestrial environment. These conditions are thought to favor neoteny. However, a terrestrial population of Mexican Tiger Salamanders occupies and breeds in the axolotl's habitat.

The axolotl is carnivorous, consuming small prey such as worms, insects, and small fish in the wild. Axolotls locate food by smell, and will "snap" at any potential meal, sucking the food into their stomachs with vacuum force.[citation needed]

Axolotl's neoteny

Axolotls exhibit a property called neoteny, meaning that they reach sexual maturity without undergoing metamorphosis. Many species within the axolotl's genus are either entirely neotenic or have neotenic populations. In the axolotl, metamorphic failure is caused by a lack of thyroid stimulating hormone, which is used to induce the thyroid to produce thyroxine in transforming salamanders. The genes responsible for neoteny in laboratory animals may have been identified; however, they are not linked in wild populations, suggesting artificial selection is the cause of complete neoteny in laboratory and pet axolotls.[citation needed]

Unlike some other neotenic salamanders (Sirens and Necturus), axolotls can be induced to metamorphose by an injection of iodine (used in the production of thyroid hormones) or by shots of thyroxine hormone. Another method for inducing transformation, though one that is very rarely successful, involves removing an axolotl in good condition to a shallow tank in a vivarium and slowly reducing the water level so that the axolotl has difficulty submerging.[citation needed] It will then, over a period of weeks, slowly metamorphose into an adult salamander. During transformation, the air in the vivarium must remain moist, and the maturing axolotl sprayed with a fine mist of pure water. The odds of the animal being able to metamorphose via this method are extremely small, and most attempts at inducing metamorphosis lead to death.[citation needed] This is likely due to the strong genetic basis for neoteny in laboratory and pet axolotls, which means that few captive animals have the ability to metamorphose on their own. Artificial metamorphosis also dramatically shortens the axolotl's lifespan if it survives the process. A neotenic axolotl will live an average of 10–15 years (though an individual in Paris is credited with achieving 25 years), while a metamorphosed specimen will scarcely live past the age of five. The adult form resembles a terrestrial Mexican Tiger Salamander, but has several differences, such as longer toes, which support its status as a separate species.[citation needed]

Use as a model organism

Six adult axolotls (including a leucistic specimen) were shipped from Mexico City to the Jardin des Plantes in Paris in 1863. Unaware of their neoteny, Auguste Duméril was surprised when, instead of the axolotl, he found in the vivarium a new species, similar to the salamander. This discovery was the starting point of research about neoteny. It is not certain that Mexican Tiger Salamanders were not included in the original shipment.

Vilem Laufberger of Germany used thyroid hormone injections to induce an axolotl to grow into a terrestrial adult salamander. The experiment was repeated by the Englishman Julian Huxley, who was unaware the experiment had already been done, using ground thyroid hormones. Since then, experiments have been done often with injections of iodine or various thyroid hormones used to induce metamorphosis.[citation needed]

Today, the axolotl is still used in research as a model organism, and large numbers are bred in captivity. Axolotls are especially easy to breed compared to other salamanders in their family, which are almost never captive bred due to the demands of terrestrial life. One attractive feature for research is the large and easily manipulated embryo, which allows viewing of the full development of a vertebrate. Axolotls are used in heart defect studies due to the presence of a mutant gene that causes heart failure in embryos. Since the embryos survive almost to hatching with no heart function, the defect is very observable. The presence of several color morphs has also been extensively studied.[citation needed]

The feature of the salamander that attracts most attention is its healing ability: the axolotl does not heal by scarring and is capable of the regeneration of entire lost appendages in a period of months, and, in certain cases, more vital structures. Some have indeed been found restoring the less vital parts of their brains. They can also readily accept transplants from other individuals, including eyes and parts of the brain—restoring these alien organs to full functionality. In some cases, axolotls have been known to repair a damaged limb as well as regenerating an additional one, ending up with an extra appendage that makes them attractive to pet owners as a novelty. In metamorphosed individuals, however, the ability to regenerate is greatly diminished. The axolotl is therefore used as a model for the development of limbs in vertebrates.[6]

Captive care

Axolotls live at temperatures of 12 °C (54 °F)-20 °C (68 °F), preferably 17 °C (63 °F)-18 °C (64 °F). As for all poikilothermic organisms, lower temperatures result in slower metabolism; higher temperatures can lead to stress and increased appetite. Chlorine, commonly added to tapwater, is harmful to axolotls. A single typical axolotl typically requires a 40 l (11 US gal) tank with a water depth of at least 15 cm (6 in). Axolotls spend a majority of the time at the bottom of the tank.[citation needed]

Salts, such as Holtfreter's solution, are usually added to the water to prevent infection.[7]

In captivity, axolotls eat a variety of readily available foods, including trout and salmon pellets, frozen or live bloodworms, earthworms, and waxworms. Axolotls can also eat feeder fish, but care should be taken as fish left in the tank may graze on the axolotls' exposed gills.[citation needed]

It should also be noted that Axolotls may suffer from impaction related issues if not kept on the correct substrate with fine sand being the preferred option. Impaction can be caused by the digestion of gravel and could be severe enough to cause death, therefore they must never be kept on gravel or stones that are smaller than the axolotls' head.

In Popular Culture

The Pokémon, Mudkip, is based on the axolotl.

The fictional axlotl tanks of Frank Herbert's Dune series of novels.

Argentine author Julio Cortazar wrote a story titled "Axolotl"; in this story, a man develops a fascination with the axolotls in Paris' Jardin des Plantes and ultimately becomes one of them. The story appeared in his collection Final del Juego and has appeared in multiple anthologies.

See also

References

  1. ^ a b Malacinski, George M. (Spring, 1978). "The Mexican Axolotl, Ambystoma mexicanum: Its Biology and Developmental Genetics, and Its Autonomous Cell-Lethal Genes". American Zoologist (Oxford University Press). 
  2. ^ "Ambystoma mexicanum". http://www.iucnredlist.org/apps/redlist/details/1095/0. Retrieved July 10, 2011. 
  3. ^ Matt Walker (2009-08-26). "Axolotl verges on wild extinction". BBC. http://news.bbc.co.uk/earth/hi/earth_news/newsid_8220000/8220636.stm. Retrieved 2010-06-28. 
  4. ^ a b Weird Creatures with Nick Baker (Television series). Dartmoor, England, U.K.: The Science Channel. 2009-11-11. Event occurs at 00:25. 
  5. ^ a b "Mexico City's 'water monster' nears extinction". 2008-11. http://www.uswaternews.com/archives/arcglobal/8mexicity11.html. Retrieved 2010-06-28. 
  6. ^ Roy, S; Gatien, S (2008 Nov). "Regeneration in axolotls: a model to aim for!". Experimental gerontology 43 (11): 968–73. PMID 18814845. 
  7. ^ Clare, John P. "Health and Diseases", Axolotls
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!