Articles on this page are available in 1 other language: Spanish (7) (learn more)

Overview

Distribution

Range Description

This species ranges from southwestern Costa Rica (a single locality) and adjacent western Panama (1,050-1,600m), through eastern Panama in lowland and premontane zones (200-860m) to the Pacific coast of western Colombia, south to Valle de Cauca Department (up to 800m in Colombia).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Countries

Countries

Colombia, Costa Rica, Panama

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Myra Hughey

Source: Amphibians of Panama

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Diagnostic Description

Identification

Adult

Species description based on Savage (2002).  A tiny rocket frog (male to 20 mm, females to 23 mm). Males have a swollen middle finger.

Dorsal

The dorsal surface is dark brown; the coloration becomes black along the sides. The brown and black portions are separated by a thin cream-colored line that extends from the groin forward to the eye. A second light line extending from the upper lip to the groin borders the black sides below; this line is more evident in males because the throat and chest are black. The upper surface of the thigh is mottled brown.

Concealed surfaces

Some red-orange coloration is apparent where mottling is not extensive.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Myra Hughey

Source: Amphibians of Panama

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Paratype for Colostethus nubicola
Catalog Number: USNM 118675
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Year Collected: 1923
Locality: Boquete, 2 mi above, on trail from Chiriquicito to Boquete, Chiriquí, Panama
Elevation (m): 1189 to 1189
  • Paratype: Dunn, E. R. 1924. Occ. Paps. Mus. Zool. Univ. Mich. (151): 7.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Paratype for Colostethus nubicola
Catalog Number: USNM 118674
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Year Collected: 1923
Locality: Boquete, 2 mi above, on trail from Chiriquicito to Boquete, Chiriquí, Panama
Elevation (m): 1189 to 1189
  • Paratype: Dunn, E. R. 1924. Occ. Paps. Mus. Zool. Univ. Mich. (151): 7.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Paratype for Colostethus nubicola
Catalog Number: USNM 118236
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Year Collected: 1923
Locality: Gutierrez, above, on trail from Chiriquicito to Boquete, Atlantic slope, Bocas del Toro, Panama
Elevation (m): 1829 to 1829
  • Paratype: Dunn, E. R. 1924. Occ. Paps. Mus. Zool. Univ. Mich. (151): 7.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
It is a terrestrial and diurnal species of humid lowland, premontane and montane forest. Adults may be encountered along rocky sections of forest streams. It can occur in secondary forest and plantation forests, and occurs in degraded habitats in Colombia. The eggs are deposited in the leaf-litter and the males transport hatching tadpoles to forest streams to complete metamorphosis.

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat

Lowland and premontane forest to 860 m.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Myra Hughey

Source: Amphibians of Panama

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Ecology

Ecology

Silverstoneia nubicola is a diurnal inhabitant of leaf litter (Savage 2002).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Myra Hughey

Source: Amphibians of Panama

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Behaviour

Call

A rapid series of "peets" (Ibanez and Smith 1995)

Behavior and communication

Females deposit their eggs in leaf litter in the territories of males (Savage 2002). Males carry hatchlings to streams to continue development (Savage 2002).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Myra Hughey

Source: Amphibians of Panama

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

Life History

Breeding season

Breeding takes place year-round (Savage 2002). Males call during the early morning and late afternoon from territories on the forest floor (Savage 2002).

Tadpole

The body of the tadpole is oval-shaped, with a long tai, and very low tail fins (Savage 2002). Tadpoles are brown above, pale below (Savage 2002). Some darker pigmentation is generally present (Savage 2002).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Myra Hughey

Source: Amphibians of Panama

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Silverstoneia nubicola

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 24 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACCTTATATTTAGTGTTTGGAGCATGAGCCGGAATAGTCGGAACAGCCCTTAGTCTCTTGATTCGAGCAGAACTAAGCCAGCCCGGATCTCTGTTAGGTGAC---GACCAAATTTATAATGTAATCGTAACCGCCCATGCTTTCGTCATAATTTTTTTTATGGTTATACCAATCCTAATCGGCGGATTCGGAAATTGACTAGTACCTTTAATAATTGGAGCCCCAGACATAGCCTTCCCCCGAATAAACAATATAAGTTTCTGACTTCTTCCACCCTCGTTTCTTCTTCTCCTTGCATCTGCAGGAGTAGAAGCGGGGGCTGGTACAGGCTGAACTGTATACCCACCACTTGCTGGCAACCTAGCCCACGCAGGCCCATCCGTAGATTTAACCATTTTTTCTCTTCATCTTGCAGGTGTATCATCAATTTTAGGAGCAATTAACTTTATTACAACAACTTTAAACATAAAACCGCCCTCACTAACTCAATACCAAACCCCACTTTTTGTTTGATCAGTTTTAATCACCGCAGTCCTACTTCTTCTTTCTCTTCCTGTATTAGCTGCTGGCATTACAATACTTCTTACAGACCGCAACCTTAATACCACCTTCTTTGATCCGGGGGGAGGGGGAGACCCTGTTCTGTACCAACACTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Silverstoneia nubicola

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 13
Specimens with Barcodes: 28
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
NT
Near Threatened

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Bolaños, F., Ibáñez, R., Chaves, G., Savage, J., Jaramillo, C., Fuenmayor, Q., Grant, T., Lötters, S. & Lips, K.

Reviewer/s
Stuart, S.N., Chanson, J.S., Cox, N.A. & Young, B.E.

Contributor/s

Justification
Listed as Near Threatened, because this species is in significant decline in the western parts of its range, but has probably globally declined at a rate of less than 30% over ten years (largely associated with the disease chytridiomycosis), thus making the species close to qualifying for Vulnerable. It seems probable that population declines in this species will continue into the east of the species range, whereby it may meet the Red List Criteria for Vulnerable or possibly Endangered during the next global assessment.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
It remains widespread in the Choco of Colombia (Taran Grant pers. comm. 2007). It was formerly recorded at a single Costa Rica locality, Las Cruces (observed in 2002), but and has recently been found in the San Vito area (Federico Bolaños pers. comm. 2007). It was formerly common in Panama, and while it is still present in Cerro Campana and eastern Panama (Roberto Ibáñez pers. comm. 2007) it has significantly declined in western Panama and is now absent from Fortuna, Santa Fe and El Cope (Karen Lips pers. comm.).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Declines in this species within the western part of the range are associated with the disease chytridiomycosis. Lips et al. (2006) report that 48 dead Colostethus nubicola (infected with the chytrid fungus Batrachochytrium dendrobatidis) were recorded at El Cope in 2004. It is probably also affected by general habitat loss in Panama through deforestation. It is not generally considered to be threatened in Colombia at present.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
It is present in several protected areas in Colombia, and in more than twelve protected areas in Panama, as well as in a single protected area in Costa Rica. There is an urgent need to complete the taxonomic revision of the Colostethus nubicola species complex. Following a clarification of the taxonomic status of this group, it may be necessary to develop ex-situ insurance colonies for remaining western populations.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Silverstoneia nubicola

The Boquete Rocket Frog, Colostethus nubicola, is a species of frog in the Dendrobatidae family. It is found in Colombia, Costa Rica, and Panama. Its natural habitats are subtropical or tropical moist lowland forests, subtropical or tropical moist montane forests, rivers, plantations, rural gardens, and heavily degraded former forest. It is threatened by habitat loss.

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!