Overview

Comprehensive Description

Description

Pseudotriton ruber nitidus, P. r. ruber,, P. r. schencki, and P. r. vioscai are subspecies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

This species can be found from the eastern United States from southern New York to southern Indiana and south to the Gulf Coast; absent from most of Atlantic coastal plain south of Virginia and from peninsular Florida (Petranka 1998).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Pseudotriton ruber is found in the Eastern United States from Northern Alabama, Georgia, South Carolina, and North Carolina, to western Ohio, Pennsylvania, New Jersey, and Southen New York. Pseudotriton ruber is usually found between sea level and 1500 ft. Although specimens are rare above 1200 ft. populations have be found near 3900 ft (Conant and Collins, 1998; Harding, 1997).

Biogeographic Regions: nearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

endemic to a single nation

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Exotic

Regularity: Regularly occurring

Currently: Absent

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (200,000-2,500,000 square km (about 80,000-1,000,000 square miles)) Southern New York to southern Indiana and south to the Gulf Coast; absent from most of Atlantic coastal plain south of Virginia and from peninsular Florida (Petranka 1998).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Pseudotriton ruber is a stout-bodied, medium-sized salamander ranging between four and seven inches (10 to 18 cm) in length. There are a few major field marks that can be used to identify this salamander. The dorsum and sides of this salamander vary from a purplish brown to a bright crimson red. Younger specimens are brighter in color, while adults tend to darken with age. The dorsum is also covered with irregularly shaped dark spots or dashes. There are five toes located on the hindlimbs and four toes on the forelimbs. There is also a slight mid-dorsal grove and sixteen or seventeen costal grooves (Conant and Collins, 1998; Harding, 1997).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 18 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Syntype for Pseudotriton ruber
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Locality: Coastal Plain, probably between Riceboro and Augusta, Locality In Multiple Counties, Georgia, United States, North America
  • Syntype: Cope, E. D. 1889. United States National Museum Bulletin. (34): 178.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
It can be found in cold, clear, rocky streams and springs in wooded or open areas. Adults occur in or near water in leaf-litter and under rocks, and in crevices and burrows near water. Adults sometimes disperse into woods. Eggs are attached to underside of rocks in water. Larvae occur in still pools.

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

The Red Salamander can be found in terrestrial or aquatic environments, but are aquatic in winter. In the terrestrial environment they can typically be found in wooded areas under fallen bark, logs, and rocks. Their aquatic preference is in the leaf litter of clean running, cool streams and brooks (Harding, 1997; Petranka, 1998).

Terrestrial Biomes: forest

Aquatic Biomes: rivers and streams

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Cold, clear, rocky streams and springs in wooded or open areas. Adults occur in or near water in leaf litter and under rocks, and in crevices and burrows near water. Adults sometimes disperse into woods. Eggs are attached to underside of rocks in water. Larvae occur in still pools.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

This salamander is a carnivore, feeding on small insects, worms, and other invertebrates, and occasionally smaller salamanders. Larvae eat small aquatic invertebrates One interesting adaptation of this salamander is a projectile tongue, which it can extend and return in 11 milliseconds. The salamander also lunges forward during prey capture. Pseudotriton ruber can be found searching for prey during and after rain events, especially at night. (Pfingsten and Downs, 1989; Harding, 1997; Petranka, 1998).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Eats various invertebrates and, occasionally, small amphibians. Larvae probably eat small invertebrates obtained in water.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 to >300

Comments: Represented by many and/or large occurrences throughout most of the range (e.g., Martof 1975, Tobey 1985, Redmond and Scott 1996, Hulse et al. 2001).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Abundance

100,000 to >1,000,000 individuals

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: captivity:
20.1 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 20.1 years (captivity)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Pseudotriton ruber displays aquatic courtship from spring through fall; courtship involves the male rubbing his snout on the female's head and chin, and eventually moving forward as the female follows with her chin on the male's tail. The male then deposits a spermatophore to be picked up by the female with her cloaca. Females may lay eggs until several months after courting and are capable of storing sperm for a long period of time. The females lay their eggs in cryptic locations during autumn in springs, brooks, and under streambanks. The eggs are attached to the underside of rocks by a single gelatinous stalk and are often submerged in the water. On average the female will lay between 30 - 130 eggs. The eggs hatch in early winter and there is a larval stage lasting between two and three years. Metamorphosis takes place during the summer months. Red Salamanderrs can live over 20 years (Pfingsten and Downs, 1989; Harding, 1997; Petranka, 1998).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lays clutch of 50-100 eggs in fall. Eggs hatch in December-January in South Carolina. Aquatic larval period lasts 27-33 months in Blue Ridge and Piedmont populations, 18-23 months in Coastal Plain of South Carolina (Semlitsch 1983). Sexually mature at 4-5 years, males perhaps sooner.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pseudotriton ruber

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBAP0069-06|AY728220|Pseudotriton ruber| ACTCGATGACTATTCTCAACAAACCATAAAGATATTGGCACCCTATACCTTATATTCGGGGCCTGGGCCGGCATAGTAGGCACAGCTTTA---AGCCTATTAATCCGAGCAGAACTAAGCCAACCGGGTGCACTTCTTGGAGAC---GACCAAATTTATAATGTAATTGTCACCGCCCATGCTTTTGTTATAATTTTCTTTATAGTTATACCAATTATAATCGGGGGCTTTGGCAATTGATTATTGCCTTTAATA---ATTGGAGCCCCAGACATAGCTTTCCCTCGAATAAATAATATAAGCTTCTGATTACTCCCTCCATCTCTTCTCCTACTTTTAGCCTCCTCAGGAGTTGAAGCTGGAGCAGGGACAGGATGAACAGTCTATCCTCCCCTTGCCGGAAACATAGCTCATGCAGGGGCTTCAGTAGATTTA---ACCATTTTCTCCCTACATTTAGCCGGCGTCTCCTCAATTTTAGGTGCTATTAACTTTATTACAACCTCTATTAATATGAAACCACCAGCAATGTCACAATATCAAACCCCTTTATTTGTCTGATCTGTTTTAATTACAGCTATTTTATTATTACTATCTTTACCAGTACTTGCAGCC---GGAATTACAATATTACTTACAGATCGAAACCTAAACACTACATTTTTTGACCCTGCGGGAGGGGGGGACCCAGTACTCTATCAACATCTATTTTGGTTTTTTGGTCACCCAGAAGTTTATATTCTTATTCTTCCTGGTTTCGGAATAATTTCACACATTGTTACATATTATTCAACTAAAAAA---GAACCCTTCGGATATATAGGCATAGTATGAGCAATAATATCAATTGGCCTATTAGGATTTATCGTATGAGCCCATCACATATTTACAGTAGACCTTA 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Pseudotriton ruber

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Species: 2
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2004

Assessor/s
Geoffrey Hammerson

Reviewer/s
Global Amphibian Assessment Coordinating Team (Simon Stuart, Janice Chanson, Neil Cox and Bruce Young)

Justification
Listed as Least Concern in view of its wide distribution, presumed large population, and because it is unlikely to be declining fast enough to qualify for listing in a more threatened category.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Because Pseudotriton ruber requires intact deciduous forests and clean streams, this species can be severly impacted by deforestation, pollution, acid drainage from coal mines, and stream siltation and warming (Harding, 1997).

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNA - Not Applicable

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Intrinsic Vulnerability: Moderately vulnerable

Environmental Specificity: Narrow. Specialist or community with key requirements common.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
It is widespread and secure.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Short Term Trend: Relatively stable to decline of 30%

Comments: Likely stable in extent of occurrence and probably stable to slightly declining in population size, area of occupancy, and number/condition of occurrences.

Global Long Term Trend: Increase of 10-25% to decline of 50%

Comments: Likely relatively stable in extent of occurrence, unknown trend in population size, area of occurrence, and number/condition of occurrences.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
Deforestation, acid drainage from coalmines, and stream siltation and pollution undoubtedly has resulted in the loss of many populations (Petranka 1998). However, the species is secure on a global scale.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Deforestation, acid drainage from coal mines, and stream siltation and pollution undoubtedly have resulted in the loss of many populations (Petranka 1998). However, the species is secure on a global scale.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
None needed. It occurs in many protected areas,
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Positive

Woodland salamanders play a significant ecological role as predators, prey, and cyclers of nutrients in the woodland and stream habitats they live in (Petranka, 1998).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Red salamander

The red salamander (Pseudotriton ruber) is a species of salamander in the Plethodontidae family. It is endemic to the United States. Its skin is orange/red in color with random black spots.

Its habitats are temperate forests, small creeks, ponds, forests, temperate shrubland, rivers, intermittent rivers, and freshwater springs. It is threatened by habitat loss. Red salamanders eat insects, spiders and smaller salamanders.

Contents

Abstract

The red salamander (Pseudotriton ruber) is a member of the Plethodontidae family which is a group of salamanders that lacks lungs and respires through their skin. The purpose of this paper is to give an overview of the red salamander and to examine its general characteristics such as its distinguishing features, fossil record, distribution, ecology, life history, behavior, and conservation. Understanding this organism’s basic behaviors and characteristics will give us more insight to its ecology and help preserve biodiversity by enabling us to better our conservation attempts.

Diagnosis

Pseudotriton ruber is a larger salamander, averaging from 4–6 inches (10–15 cm) long. Its sides and back vary in color from an orange-brownish tint to a bright red depending on its age. Like other salamanders, the red salamander seems to lose its color as it ages, becoming more darkly pigmented with less obscure patterns (Conant & Collins 1998)[1]Another distinguishing characteristic of Pseudotriton ruber is the appearance of numerous irregular black spots down its back. Although the Red Salamander is brilliantly colored and has many distinguishing features, it is sometimes difficult to tell species apart. Pseudotriton ruber is most similar in appearance to the mud salamander (Pseudotriton montanus), but can be distinguished by the difference in size and number of spots running down the dorsum and also by the difference in the color of the iris. The red salamander has more spots than the mud salamander and the spots also tend to be larger in size than those of the mud salamander. In regards to eye color, the red salamander’s iris is a gold-like tint, whereas the mud salamander’s iris is brown (http://www.uga.edu/srelherp/salamanders/pserub.htm).[2]Another way to distinguish the red salamander from the mud salamander is to look at the shape of the head. Mud salamanders typically have a blunter snout than the red salamander (Conant & Collins 1998).[1]Also, the mud salamanders typically have a more contrasting dorsal and ventral coloration than the red salamanders that are more uniform in color (Conant & Collins 1998).[1]When in doubt, other information such as the species’ habitat will be useful for distinguishing one salamander from another.

Taxonomy

Salamanders along with frogs and caecilians collectively form the class Amphibia. Amphibians are ectothermic and are considered tetrapods even though the limbs are often reduced (Petranka 1998).[3] Salamanders form the order Caudata and are distinguished from other amphibians due to the fact that they have tails and paired appendages. Salamanders are extremely diverse and are classified further based on descriptive characteristics, habitats, and behaviors.

The red salamander is a member of the Plethodontidae family which can be referred to collectively as the lungless salamanders. In this family, all members respire through their skin and the lining in their mouth. It has been proposed by W. Wilder and E.R. Dunn (1920) that lunglessness in this family evolved due to an adaptation for life in streams and this theory was further reinforced by C.K. Beachy and R.C. Bruce (1992), finding that members of the Plethodontidae family probably did evolve other methods for respiration other than lungs (i.e. gills) due to enhanced survival of larval salamanders in fast-moving stream environments of Southern Appalachia.[4][5]Lungs in general help aquatic animals maintain position in the water column, but the larvae of Plethodontidae members are benthic creatures, therefore the adaptation of lunglessness would be beneficial to them since buoyancy would endanger their survival (Beachy & Bruce 1992).[5]The red salamander is further classified as a member of the genus Pseudotriton. Members of this genus include only the red salamander and the mud salamander. These salamanders are difficult to tell apart by appearances, but can be distinguished by ecological factors such as the species’ habitat.

Distribution

There are four subspecies of Pseudotriton ruber: P.r. ruber, P.r.nitidus, P.r.schencki, and P.r. vioscai. All of these subspecies are found across the eastern United States, occupying streams through open areas such as fields and meadows as well as aquatic areas through forested areas and mountains. Each subspecies is similar in appearance with slight differences in size and coloration but are found in different habitats. The Northern Red Salamander, P.r.ruber, is characterized as being red or reddish orange with numerous black spots down its back. This species is the most common and can be found from southern New York and Ohio to northeast Alabama (Conant & Collins 1998).[1] Similar in appearance to the Northern Red Salamander is the Blue Ridge Red Salamander, P.r.nitidus. This species differs from the Northern Red Salamander in that it is slightly smaller and lacks black coloration on the tip of the tail and chin (Conant & Collins 1998).[1] The Blue Ridge Salamander is found in elevations to more than 5000 feet in the southern part of the Blue Ridge Mountains of Virginia (Conant & Collins 1998).[1] Another subspecies of Pseudotriton ruber is the Blackchin Red Salamander, P.r. schencki. This salamander differs in appearance by having strong black coloration under its chin as well as spotting all the way to the tip of the tail (Conant & Collins 1998).[1] It can also be found in elevations to more than 5000 feet in the Blue Ridge Mountains (Conant & Collins 1998).[1] The last subspecies, the Southern Red Salamander (P.r. vioscai) is often purplish to salmon colored and normally has white spots on its head. This subspecies is found from southern South Carolina to southeast Louisiana and southwest Kentucky. All subspecies of Pseudotriton ruber occupy moist environments such as under moss and stones near clear water sources such as streams or springs (Conant & Collins 1998).[1] Pseudotriton ruber is normally not found near large streams, but insteasd near smaller water sources (Petranka 1998).[3]

Ecology

Some important aquatic and terrestrial ecological aspects of Pseudotriton ruber include its diet, predators, and microhabitat preferences. Pseudotriton ruber larvae mainly feed on invertebrates such as insect larvae and worms (Bishop 1941).[6]Larval growth rates differ depending on the temperature of the water (Petranka 1998) and tend to be higher be higher in the warmer months when water temperature is higher (Bruce 1972).[3][7]The Red Salamander generally lays eggs in the fall and then the hatching season takes place in the late fall and winter months(Bruce 1972).[7]The larval period varies between 27-31 months and then metamorphosis takes place in the spring and early summer of the third year (Bruce 1972).[7] Cecala et al. ultimately found that larval Red Salamanders are generalists, eating whatever is available (2007).[8] They also found that feeding rates typically increase when water temperature is low and that larger individuals feed more than smaller individuals (Cecala et al. 2007).[8] Although feeding rates appear to increase with increasing size, mortality rates on the other hand seem to be independent of size or age and survivorship is estimated to be about 50 % per year (Bruce 1972).[7] The longer larval period ensures that transformation occurs when the salamanders are much larger than other species of salamanders and typically have a short juvenile period, maturing quickly (Petranka 1998).[3] Males mature at about 53–63 mm (2.1–2.5 in), typically at 4 years of age, and females mature at about 55–68 mm (2.2–2.7 in), typically at about 5 years of age (Petranka 1998).[3]

Red Salamanders generally live in springs or streams during the winter and then disperse to and from these sites in the fall and spring (Bruce 1978).[9] Due to its semiaquatic nature, the Red Salamander remains in terrestrial environments until early spring then disperse to more aquatic sites (Petranka 1998).[3] Adult Pseudotriton ruber often lives in burrows along streams and in other moist environments such as under logs and rocks along the forest floor (Bishop 1941).[6] Adult Red Salamanders like larval Red Salamanders are generalists and tend to feed on invertebrates as well as small amphibians (Bishop 1941).[6] Predators of the Red Salamander include birds and small carnivores such as skunks and raccoons (Petranka 1998).[3] Since the Red Salamander is a larger species of salamander, its presence or absence can greatly affect the ecosystem that it lives in and understanding its ecology is important in order to understand its role in community structure.

Life History, Behavior, etc.

Pseudotriton ruber has a wide range in their breeding season, which is only limited by extremely cold temperatures (Petranka 1998).[3] Generally, however, adult Red Salamanders mate annually (Bruce 1978) and engage in primitive courting activities (Organ & Organ 1968).ref name="ref9"/>[10] Organ and Organ observed courtship between two Pseudotriton ruber individuals as the following: "A male approaches a female, rubbing his snout against her snout, cheeks, and chin. The male then moves his head and body under her chin and starts tail undulations. The female then straddles the male’s tail and the pair engages in a straddled “walk” until the male deposits sperm on the substrate. The “straddle-walk” approximately lasts two minutes and once the sperm is deposited, the female picks up the sperm cap as she moves over it and then they separate" (Organ & Organ 1968).[10] Female Pseudotriton ruber are capable of long term sperm storage and may not lay eggs for months after mating (Petranka 1998).[3] Females typically lay eggs in the fall or early winter in headwater streams and have very cryptic nests (Bishop 1941).[6]

Other important behavioral aspects of Pseudotriton ruber include its defensive mechanisms. In regards to mating, males appear to not be aggressive towards one another, but do occasionally court other males as a means of sperm competition to get the other male to deposit spermatophores, giving them a better chance of successful mating over their competitors (Organ & Organ 1968).[10] When threatened, Red Salamanders assume a defensive posture in which they curl their body, elevating and extending their rear, and placing their head under their tail which is elevated and undulated from side to side (Brandon et al. 1979).[11] The coloration of the Red Salamander has been hypothesized to mimic that of the red eft stage of the eastern newt (Notophythalmus viridescens) which emits a powerful neurotoxin in their skin (Howard & Brodie 1971).[12]This hypothesis however was heavily criticized due to significant size differences in the organisms and the differences in the species’ times of foraging ( i.e. Pseudotriton ruber mainly at night and the red eft mainly during the day) (Brandon & Huheey 1975).[13] More recently, biologists argue that since Pseudotriton themselves have reduced palatability they are considered part of a Müllerian mimicry system in which all species are unpalatable and benefit from aposematic coloration (Petranka 1998).[3]

Conservation

In Indiana, the Red Salamander is listed as an endangered species.[14]

The Red Salamander is arguably one of the most primitive plethodontids (Organ & Organ 1968) and therefore is extremely valuable in understanding the links to previous ancestors and the evolutionary processes that have occurred throughout time.[10] Maintaining species diversity is an important part of conservation and in order to prevent the loss of salamander diversity as a whole, it is important to have some type of management plan in place to prevent Pseudotriton ruber from escalating from a low conservation status to a higher level of concern. Since the Red Salamander prefers streams that are relatively pure, it is important to monitor human waste and pollution since debris and silt could have adverse effects on the Red Salamander’s habitat, potentially causing a threat to its survival. Informing the public of this species will encourage campers and fellow recreationists to respect the natural environment and to keep the streams clean. In addition to learning about the wildlife that occupies our local ecosystems; simple management plans such as waste monitoring for businesses would also be beneficial for Pseudotriton ruber.

References

  1. ^ a b c d e f g h i Conant, R. and J.T. Collins.Peterson Field Guides: Reptiles and Amphibians.New York: Houghton Mifflin, 1998.
  2. ^ Red Salamander(Pseudotriton ruber).Savannah River Ecology Laboratory: Herpetology Program.1 April 2011< http://www.uga.edu/srelherp/salamanders/pserub.htm>.
  3. ^ a b c d e f g h i j Petranka, J.W. Salamanders of the United States and Canada. Washington and London: Smithsonian Institution Press, 1998.
  4. ^ Wilder, I.W. and E.R. Dunn. 1920. The correlation of lunglessness in salamanders with a mountain brook habitat. Copeia 84: 63-68.
  5. ^ a b Beachy, C.K. and R.C. Bruce.1992.Lunglessness in Plethodontid Salamanders is Consistent with the Hypothesis of a Mountain Stream Origin: A Response to Ruben and Boucot.The American Naturalists 139 (4): 839-847.
  6. ^ a b c d Bishop,S.C.1941.Salamanders of New York. New York State Museum Bulletin 324: 1-365.
  7. ^ a b c d Bruce, R.C. 1972.The larval life of the Red Salamander,Pseudotriton ruber.Journal of Herpetology6(1): 43-51.
  8. ^ a b Cecala, K.K., S.J. Price, and M.E. Dorcas. 2007. Diet of larval Red Salamanders (Pseudotriton ruber) examined using a nonlethal technique. Journal of Herpetology 41(4): 741-745.
  9. ^ Bruce, R.C. 1978. Reproductive biology of the salamander Pseudotriton ruber in the southern Blue Ridge Mountains. Copeia 1978: 417-423.
  10. ^ a b c d Organ, J.A., and D.J. Organ. 1968. Courtship behavior of the Red Salamander, Pseudotriton ruber. Copeia 1968: 217-223.
  11. ^ Brandon, R.A.,Labanick, G.N., and J.E. Huheey. 1979. Relative palatability, defensive behavior, and mimetic relationships of red salamanders (Pseudotriton ruber), mud salamanders (Pseudotriton monatnus), and red efts (Notophyhalmus viridescens). Herpetoligca 35: 289-303.
  12. ^ Howard, R.R. and E.D.Brodie.1971.Experimental study of mimicry in salamanders involving Notophythalmus viridescens and Pseudotriton ruber schencki.Nature 233:277.
  13. ^ Brandon, R.A., and J. E. Huheey. 1975. Diurnal activity, avian predation, and the question of warning coloration and cryptic coloration in salamanders. Herpetologica 31: 252-255.
  14. ^ Indiana Legislative Services Agency (2011), "312 IAC 9-5-4: Endangered species of reptiles and amphibians", Indiana Administrative Code, http://www.in.gov/legislative/iac/, retrieved 28 Apr 2012 

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!