Overview

Comprehensive Description

Description

Pseudotriton ruber is a large, red, black-spotted salamander with short limbs found in the eastern United States. Total length ranges from 95 - 180 mm in adults. Eyes are yellow. The body is stout, with 16 or 17 costal grooves. Limbs are short relative to body size. Tail is also short, averaging about 38% of total length. Hatchlings have a snout-vent length of 11 - 14 mm. Larvae are stream adapted (Petranka 1998).

There are currently four recognized sub-species of P. ruber: the northern red salamander (P. r. ruber), the Blue Ridge red salamander (P. r. nitidus), the black-chinned salamander (P. r. schencki), and the southern red salamander (P. r. vioscai). Pseudotriton r. ruber is the largest, reaching 180 mm total length. It is red or red orange with black flecking on the chin. Pseudotriton r. nitidus only reaches 120 mm total length, and has no spotting on the chin or the posterior half of the tail. Pseudotriton r. schencki may reach 150 mm total length, and has heavier black flecking under the chin than P. r. ruber. Pseudotriton r. vioscai is generally purple-brown in color, has tiny white flecks on the snout, and its dorsal spots tend to fuse (Petranka 1998).

Pseudotriton ruber is similar in appearance to and overlaps in range with P. montanus, the mud salamander. The species can be distinguished mainly by eye color and spot patterns. Pseudotriton ruber has yellow eyes, while P. montanus has brown eyes. Pseudotriton montanus has fewer dorsal spots which are widely spaced and rarely overlap, in contrast to the heavy, often overlapping spotting on individuals of P. ruber. The snout of P. montanus tends to be shorter and more blunt than that of P. ruber (Petranka 1998).

The color of the dorsum in P. ruber ranges from purplish brown to red. The dorsum is covered with irregular black spots. The venter is pink or red with black spots. Individuals tend to darken with age, and the spots begin to fuse and become less distinct. Juveniles are typically bright crimson with bold black spots, and may not have spotting on the belly. Older adults are often dark orange or purple-brown in coloration. Recently hatched larvae are typically light brown dorsally, with a whitish venter. The dorsum becomes streaked or mottled as the larvae mature. Larvae may turn red as they near transformation. The adult spotting appears a few months after metamorphosis (Petranka 1998).

The species authority for P. ruber is Pierre André Latreille, 1801 (Hammerson 2004).

The species epithet "ruber" is Latin for "red".

Pseudotriton ruber was the first species of Plethodontid salamander found to be toxic. Skin glands produce the large toxic protein pseudotritontoxin (PTTX), which is mostly concentrated on the dorsal surface (Brandon and Huheey 1981).

  • Petranka, J. W. (1998). Salamanders of the United States and Canada. Smithsonian Institution Press, Washington and London.
  • Hammerson, G. 2004. Pseudotriton ruber. In: IUCN 2012. IUCN Red List of Threatened Species. Version 2012.2. . Downloaded on 01 April 2013.
  • Brandon, R. A., and Huheey, J. E. (1981). ''TOXICITY IN THE PLETHODONTID SALAMANDERS PSEUDOTRITON RUBER AND PSEUDOTRITON MONTANUS (AMPHIBIA, CAUDATA).'' Toxicon, 19, 25-31.
  • Brodie, E. D., and Howard, R. R. (1972). ''Behavioral Mimicry in the Defensive Displays of the Urodele Amphibians Nophthalmus viridescens and Pseudotriton ruber.'' Bioscience, 22(11), 666-667.
  • Bruce, R. C. (1972). ''The Larval Life of the Red Salamander Pseudotriton ruber.'' Journal of Herpetology, 6(1), 43-51.
  • Bruce, R. C. (1978). ''Reproductive Biology of the Salamander Pseudotriton ruber in the Southern Blue Ridge Mountains.'' Copeia, 1978(3), 417-423.
  • Organ, J. A. and Organ, D. J. (1968). ''Courtship Behavior of the Red Salamander, Pseudotriton ruber.'' Copeia, 1968(2), 217-223.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

endemic to a single nation

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Exotic

Regularity: Regularly occurring

Currently: Absent

Confidence: Confident

Type of Residency: Unknown

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (200,000-2,500,000 square km (about 80,000-1,000,000 square miles)) Southern New York to southern Indiana and south to the Gulf Coast; absent from most of Atlantic coastal plain south of Virginia and from peninsular Florida (Petranka 1998).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

This species can be found from the eastern United States from southern New York to southern Indiana and south to the Gulf Coast; absent from most of Atlantic coastal plain south of Virginia and from peninsular Florida (Petranka 1998).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution and Habitat

Pseudotriton ruber ranges from New York in the north to the gulf coast, and reaches as far west as Louisiana. The species may be found at elevations between sea level and 1500 meters (Petranka 1998).

Adults are found under surface cover in forests, meadows, and pasturelands, or in burrows alongside streams. They often spend late fall and winter in and around small streams, seepages, and bogs, which are also used for breeding (Petranka 1998).

  • Petranka, J. W. (1998). Salamanders of the United States and Canada. Smithsonian Institution Press, Washington and London.
  • Hammerson, G. 2004. Pseudotriton ruber. In: IUCN 2012. IUCN Red List of Threatened Species. Version 2012.2. . Downloaded on 01 April 2013.
  • Brandon, R. A., and Huheey, J. E. (1981). ''TOXICITY IN THE PLETHODONTID SALAMANDERS PSEUDOTRITON RUBER AND PSEUDOTRITON MONTANUS (AMPHIBIA, CAUDATA).'' Toxicon, 19, 25-31.
  • Brodie, E. D., and Howard, R. R. (1972). ''Behavioral Mimicry in the Defensive Displays of the Urodele Amphibians Nophthalmus viridescens and Pseudotriton ruber.'' Bioscience, 22(11), 666-667.
  • Bruce, R. C. (1972). ''The Larval Life of the Red Salamander Pseudotriton ruber.'' Journal of Herpetology, 6(1), 43-51.
  • Bruce, R. C. (1978). ''Reproductive Biology of the Salamander Pseudotriton ruber in the Southern Blue Ridge Mountains.'' Copeia, 1978(3), 417-423.
  • Organ, J. A. and Organ, D. J. (1968). ''Courtship Behavior of the Red Salamander, Pseudotriton ruber.'' Copeia, 1968(2), 217-223.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Pseudotriton ruber is found in the Eastern United States from Northern Alabama, Georgia, South Carolina, and North Carolina, to western Ohio, Pennsylvania, New Jersey, and Southen New York. Pseudotriton ruber is usually found between sea level and 1500 ft. Although specimens are rare above 1200 ft. populations have be found near 3900 ft (Conant and Collins, 1998; Harding, 1997).

Biogeographic Regions: nearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Pseudotriton ruber is a stout-bodied, medium-sized salamander ranging between four and seven inches (10 to 18 cm) in length. There are a few major field marks that can be used to identify this salamander. The dorsum and sides of this salamander vary from a purplish brown to a bright crimson red. Younger specimens are brighter in color, while adults tend to darken with age. The dorsum is also covered with irregularly shaped dark spots or dashes. There are five toes located on the hindlimbs and four toes on the forelimbs. There is also a slight mid-dorsal grove and sixteen or seventeen costal grooves (Conant and Collins, 1998; Harding, 1997).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 18 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Syntype for Pseudotriton ruber
Catalog Number: USNM 11475
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Locality: Coastal Plain, probably between Riceboro and Augusta, Locality In Multiple Counties, Georgia, United States, North America
  • Syntype: Cope, E. D. 1889. United States National Museum Bulletin. (34): 178.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Comments: Cold, clear, rocky streams and springs in wooded or open areas. Adults occur in or near water in leaf litter and under rocks, and in crevices and burrows near water. Adults sometimes disperse into woods. Eggs are attached to underside of rocks in water. Larvae occur in still pools.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
It can be found in cold, clear, rocky streams and springs in wooded or open areas. Adults occur in or near water in leaf-litter and under rocks, and in crevices and burrows near water. Adults sometimes disperse into woods. Eggs are attached to underside of rocks in water. Larvae occur in still pools.

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The Red Salamander can be found in terrestrial or aquatic environments, but are aquatic in winter. In the terrestrial environment they can typically be found in wooded areas under fallen bark, logs, and rocks. Their aquatic preference is in the leaf litter of clean running, cool streams and brooks (Harding, 1997; Petranka, 1998).

Terrestrial Biomes: forest

Aquatic Biomes: rivers and streams

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: Eats various invertebrates and, occasionally, small amphibians. Larvae probably eat small invertebrates obtained in water.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

This salamander is a carnivore, feeding on small insects, worms, and other invertebrates, and occasionally smaller salamanders. Larvae eat small aquatic invertebrates One interesting adaptation of this salamander is a projectile tongue, which it can extend and return in 11 milliseconds. The salamander also lunges forward during prey capture. Pseudotriton ruber can be found searching for prey during and after rain events, especially at night. (Pfingsten and Downs, 1989; Harding, 1997; Petranka, 1998).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 to >300

Comments: Represented by many and/or large occurrences throughout most of the range (e.g., Martof 1975, Tobey 1985, Redmond and Scott 1996, Hulse et al. 2001).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

100,000 to >1,000,000 individuals

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: captivity:
20.1 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 20.1 years (captivity)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Lays clutch of 50-100 eggs in fall. Eggs hatch in December-January in South Carolina. Aquatic larval period lasts 27-33 months in Blue Ridge and Piedmont populations, 18-23 months in Coastal Plain of South Carolina (Semlitsch 1983). Sexually mature at 4-5 years, males perhaps sooner.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Pseudotriton ruber displays aquatic courtship from spring through fall; courtship involves the male rubbing his snout on the female's head and chin, and eventually moving forward as the female follows with her chin on the male's tail. The male then deposits a spermatophore to be picked up by the female with her cloaca. Females may lay eggs until several months after courting and are capable of storing sperm for a long period of time. The females lay their eggs in cryptic locations during autumn in springs, brooks, and under streambanks. The eggs are attached to the underside of rocks by a single gelatinous stalk and are often submerged in the water. On average the female will lay between 30 - 130 eggs. The eggs hatch in early winter and there is a larval stage lasting between two and three years. Metamorphosis takes place during the summer months. Red Salamanderrs can live over 20 years (Pfingsten and Downs, 1989; Harding, 1997; Petranka, 1998).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Pseudotriton ruber

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Pseudotriton ruber

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGATAATCACTCGATGACTATTCTCAACAAACCATAAAGATATTGGCACCCTATACCTTATATTCGGGGCCTGGGCCGGCATAGTAGGCACAGCTTTAAGCCTATTAATCCGAGCAGAACTAAGCCAACCGGGTGCACTTCTTGGAGACGACCAAATTTATAATGTAATTGTCACCGCCCATGCTTTTGTTATAATTTTCTTTATAGTTATACCAATTATAATCGGGGGCTTTGGCAATTGATTATTGCCTTTAATAATTGGAGCCCCAGACATAGCTTTCCCTCGAATAAATAATATAAGCTTCTGATTACTCCCTCCATCTCTTCTCCTACTTTTAGCCTCCTCAGGAGTTGAAGCTGGAGCAGGGACAGGATGAACAGTCTATCCTCCCCTTGCCGGAAACATAGCTCATGCAGGGGCTTCAGTAGATTTAACCATTTTCTCCCTACATTTAGCCGGCGTCTCCTCAATTTTAGGTGCTATTAACTTTATTACAACCTCTATTAATATGAAACCACCAGCAATGTCACAATATCAAACCCCTTTATTTGTCTGATCTGTTTTAATTACAGCTATTTTATTATTACTATCTTTACCAGTACTTGCAGCCGGAATTACAATATTACTTACAGATCGAAACCTAAACACTACATTTTTTGACCCTGCGGGAGGGGGGGACCCAGTACTCTATCAACATCTATTTTGGTTTTTTGGTCACCCAGAAGTTTATATTCTTATTCTTCCTGGTTTCGGAATAATTTCACACATTGTTACATATTATTCAACTAAAAAAGAACCCTTCGGATATATAGGCATAGTATGAGCAATAATATCAATTGGCCTATTAGGATTTATCGTATGAGCCCATCACATATTTACAGTAGACCTTAATGTAGACACACGAGCATATTTTACCTCAGCAACAATAATTATTGCTATCCCTACAGGAGTAAAAGTATTTAGCTGATTAGCCACGATACATGGTGGAGCAATCAAATGAGATGCAGCTATACTATGAGCACTTGGATTTATTTTTCTTTTTACTATCGGGGGCTTAACCGGAATTGTCCTAGCCAACTCCTCCTTAGACATTGTCCTACATGATACTTACTATGTAGTTGCCCATTTCCACTACGTCCTATCAATAGGCGCTGTATTCGCTATTATAGGAGGATTTGTACACTGATTTCCTCTTTTCTCAGGGTTTACTCTTCACCCAACATGATCAAAAATTCACTTTGGAGTAATATTTATTGGAGTTAACTTAACATTCTTCCCACAACACTTTTTAGGACTTGCAGGGATACCACGACGATATTCTGACTACCCAGACGCTTATACCCTTTGAAATACAATTTCATCAATTGGGTCCCTAATCTCATTGGTAGCAGTTATTATAATAATATTTATTATTTGAGAAGCCTTCGCATCAAAACGAGAAATTTTAACAACAGAACTTAATCAAACAAACATTGAGTGATTATATGGATGTCCTCCACCTTATCACACTTTTGAAGAACCATCTTACGTTCAAACACGACTTAATACAAGA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNA - Not Applicable

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Intrinsic Vulnerability: Moderately vulnerable

Environmental Specificity: Narrow. Specialist or community with key requirements common.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2004

Assessor/s
Geoffrey Hammerson

Reviewer/s
Global Amphibian Assessment Coordinating Team (Simon Stuart, Janice Chanson, Neil Cox and Bruce Young)

Contributor/s

Justification
Listed as Least Concern in view of its wide distribution, presumed large population, and because it is unlikely to be declining fast enough to qualify for listing in a more threatened category.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Because Pseudotriton ruber requires intact deciduous forests and clean streams, this species can be severly impacted by deforestation, pollution, acid drainage from coal mines, and stream siltation and warming (Harding, 1997).

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Short Term Trend: Relatively stable to decline of 30%

Comments: Likely stable in extent of occurrence and probably stable to slightly declining in population size, area of occupancy, and number/condition of occurrences.

Global Long Term Trend: Relatively stable to decline of 50%

Comments: Likely relatively stable in extent of occurrence, unknown trend in population size, area of occurrence, and number/condition of occurrences.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
It is widespread and secure.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History, Abundance, Activity, and Special Behaviors

Pseudotriton ruber is active nocturnally, remaining under cover or in burrows during the day. It feeds on various invertebrates, and may also eat smaller amphibians. Predators include birds, shrews, raccoons, skunks, and snakes (Petranka 1998). When threatened, P. ruber assumes a defensive posture where the body is curled, and the tail is raised over the head and moved side to side (Brodie and Howard 1972; Petranka 1998).

Several salamander genera within the range of P. ruber have red coloration, including the highly toxic red eft stage of Notophthalmus viridescens. Pseudotriton, Notophthalmus, and Gyrinophilus are believed to be part of a mimicry complex, either Müllerian, in which all species are unpalatable to some degree and all benefit from reduced predation by having similar appearance, or Batesian, where Pseudotriton and Gyrinophilus both mimic the toxic Notophthalmus to reduce predation (Petranka 1998).

Pseudotriton ruber usually breeds annually, but mating season varies geographically (Petranka 1998). Courtship involves head rubbing and a tail-straddling walk, typical of plethodontid salamanders. The male then deposits a spermatophore for the female to pick up, to be used later for fertilization. Females may retain sperm for several months before oviposition. Males may deposit up to two spermatophores per night. Some males have been observed courting other males, in what may be an effort to improve their own chances with females by causing a rival male to waste a spermatophore (Organ and Organ 1968; Petranka 1998).

Eggs are laid during fall or early winter. The eggs, about 4mm in diameter, are attached in water to the underside of rocks and logs in streams, bogs, or springs. Females brood the eggs for 2 - 3 months until the eggs hatch (Petranka 1998).

Males typically begin breeding 4 - 5 years after metamorphosis, females after 5 or more years. Snout vent length at time of reproduction is 53 - 63 mm in males, 55 - 68 mm in females (Bruce 1978; Petranka 1998).

Larvae are found in slow moving regions of streams or springs, feeding on aquatic invertebrates among decaying leaves and aquatic plants. The larval stage may last 1.5 - 3.5 years, with longer larval periods corresponding to more northern populations. Transformation occurs in late spring and summer (Bruce 1972; Petranka 1998).

  • Petranka, J. W. (1998). Salamanders of the United States and Canada. Smithsonian Institution Press, Washington and London.
  • Hammerson, G. 2004. Pseudotriton ruber. In: IUCN 2012. IUCN Red List of Threatened Species. Version 2012.2. . Downloaded on 01 April 2013.
  • Brandon, R. A., and Huheey, J. E. (1981). ''TOXICITY IN THE PLETHODONTID SALAMANDERS PSEUDOTRITON RUBER AND PSEUDOTRITON MONTANUS (AMPHIBIA, CAUDATA).'' Toxicon, 19, 25-31.
  • Brodie, E. D., and Howard, R. R. (1972). ''Behavioral Mimicry in the Defensive Displays of the Urodele Amphibians Nophthalmus viridescens and Pseudotriton ruber.'' Bioscience, 22(11), 666-667.
  • Bruce, R. C. (1972). ''The Larval Life of the Red Salamander Pseudotriton ruber.'' Journal of Herpetology, 6(1), 43-51.
  • Bruce, R. C. (1978). ''Reproductive Biology of the Salamander Pseudotriton ruber in the Southern Blue Ridge Mountains.'' Copeia, 1978(3), 417-423.
  • Organ, J. A. and Organ, D. J. (1968). ''Courtship Behavior of the Red Salamander, Pseudotriton ruber.'' Copeia, 1968(2), 217-223.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Degree of Threat: Medium

Comments: Deforestation, acid drainage from coal mines, and stream siltation and pollution undoubtedly have resulted in the loss of many populations (Petranka 1998). However, the species is secure on a global scale.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Major Threats
Deforestation, acid drainage from coalmines, and stream siltation and pollution undoubtedly has resulted in the loss of many populations (Petranka 1998). However, the species is secure on a global scale.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History, Abundance, Activity, and Special Behaviors

Pseudotriton ruber does best in mature deciduous forests with clear streams. Deforestation, pollution, stream siltation, and acid runoff (coal mining) all may result in local declines (Petranka 1998).

The species as a whole is doing well, with a wide distribution, large populations, and presence in many protected areas throughout the eastern United States (Hammerson 2004; Petranka 1998).

  • Petranka, J. W. (1998). Salamanders of the United States and Canada. Smithsonian Institution Press, Washington and London.
  • Hammerson, G. 2004. Pseudotriton ruber. In: IUCN 2012. IUCN Red List of Threatened Species. Version 2012.2. . Downloaded on 01 April 2013.
  • Brandon, R. A., and Huheey, J. E. (1981). ''TOXICITY IN THE PLETHODONTID SALAMANDERS PSEUDOTRITON RUBER AND PSEUDOTRITON MONTANUS (AMPHIBIA, CAUDATA).'' Toxicon, 19, 25-31.
  • Brodie, E. D., and Howard, R. R. (1972). ''Behavioral Mimicry in the Defensive Displays of the Urodele Amphibians Nophthalmus viridescens and Pseudotriton ruber.'' Bioscience, 22(11), 666-667.
  • Bruce, R. C. (1972). ''The Larval Life of the Red Salamander Pseudotriton ruber.'' Journal of Herpetology, 6(1), 43-51.
  • Bruce, R. C. (1978). ''Reproductive Biology of the Salamander Pseudotriton ruber in the Southern Blue Ridge Mountains.'' Copeia, 1978(3), 417-423.
  • Organ, J. A. and Organ, D. J. (1968). ''Courtship Behavior of the Red Salamander, Pseudotriton ruber.'' Copeia, 1968(2), 217-223.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
None needed. It occurs in many protected areas,
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Positive

Woodland salamanders play a significant ecological role as predators, prey, and cyclers of nutrients in the woodland and stream habitats they live in (Petranka, 1998).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Red salamander

The red salamander (Pseudotriton ruber) is a species of salamander in the Plethodontidae family endemic to the United States. Its skin is orange/red in color with random black spots. Its habitats are temperate forests, small creeks, ponds, forests, temperate shrubland, rivers, intermittent rivers, freshwater, trees springs. It is threatened by habitat loss. Red salamanders eat insects, spiders and smaller salamanders. The red salamander, as a member of the Plethodontidae family, lacks lungs and respires through its skin.

Diagnosis[edit]

Pseudotriton ruber is a larger salamander, averaging from 4–8 in (10–20 cm) long. Its sides and back vary in color from an orange-brownish tint to a bright red depending on its age. Like other salamanders, the red salamander seems to lose its color as it ages, becoming more darkly pigmented with less obscure patterns.[1] Another distinguishing characteristic of P. ruber is the appearance of numerous irregular black spots down its back. Although the red salamander is brilliantly colored and has many distinguishing features, it is sometimes difficult to tell species apart. P. ruber is most similar in appearance to the mud salamander (P. montanus), but can be distinguished by the difference in size and number of spots running down the dorsum and also by the difference in the color of the iris. The red salamander has more spots and the spots also tend to be larger in size than those of the mud salamander. In regard to eye color, the red salamander’s iris is a gold-like tint, whereas the mud salamander’s iris is brown. (http://www.uga.edu/srelherp/salamanders/pserub.htm).[2] Mud salamanders typically have a blunter snout than the red salamander.[1] Also, the mud salamanders typically have a more contrasting dorsal and ventral coloration than the red salamanders that are more uniform in color.[1]

Taxonomy[edit]

In the Plethodontidae, many members respire through their skin and the lining in their mouths. Lunglessness in this family may have evolved due to an adaptation for life in streams, and members of the Plethodontidae family probably did evolve other methods for respiration other than lungs (i.e. gills) due to enhanced survival of larval salamanders in fast-moving stream environments of southern Appalachia.[3][4] Lungs in general help aquatic animals maintain position in the water column, but the larvae of Plethodontidae members are benthic creatures, therefore the adaptation of lunglessness would be beneficial to them since buoyancy would endanger their survival.[4] The red salamander is further classified as a member of the genus Pseudotriton. Members of this genus include only the red salamander and the mud salamander.

Distribution[edit]

The four subspecies of P. ruber are found across the eastern United States, occupying streams through open areas such as fields and meadows, as well as aquatic areas through forested areas and mountains. Each subspecies is similar in appearance with slight differences in size and coloration, but are found in different habitats. The northern red salamander, P. r. ruber, is characterized as being red or reddish-orange with numerous black spots down its back. This species is the most common and can be found from southern New York and Ohio to northeast Alabama.[1] Similar in appearance to the northern red salamander is the Blue Ridge red salamander, P. r. nitidus. This species differs it is slightly smaller and lacks black coloration on the tip of the tail and chin.[1] The Blue Ridge red salamander is found in elevations to more than 5000 ft in the southern part of the Blue Ridge Mountains of Virginia.[1] The blackchin red salamander, P. r. schencki, differs in appearance by having strong black coloration under its chin, as well as spotting all the way to the tip of the tail.[1] It can also be found in elevations to more than 5000 ft in the Blue Ridge Mountains.[1] The southern red salamander (P. r. vioscai) is often purplish- to salmon-colored and normally has white spots on its head. This subspecies is found from southern South Carolina to southeast Louisiana and southwest Kentucky. All subspecies of P. ruber occupy moist environments such as under moss and stones near clear water sources such as streams or springs.[1] Red salamanders are normally not found near large streams, but insteasd near smaller water sources.[5]

Ecology[edit]

Some important aquatic and terrestrial ecological aspects of this salamander include its diet, predators, and microhabitat preferences. Larvae mainly feed on invertebrates such as insect larvae and worms.[6] Larval growth rates differ depending on the temperature of the water and tend to be higher in the warmer months when water temperature is higher.[5][7] The red salamander generally lays eggs in the fall and hatching season takes place in the late fall and winter.[7] The larval period varies between 27 and 31 months and then metamorphosis takes place in the spring and early summer of the third year.[7] Larval red salamanders are generalists, eating whatever is available.[8] Feeding rates typically increase when water temperature is low and larger individuals feed more than smaller individuals.[8] Although feeding rates appear to increase with increasing size, mortality rates, though, seem to be independent of size or age and survival is estimated to be about 50% per year.[7] The longer larval period ensures that transformation occurs when the salamanders are much larger than other species of salamanders and typically have a short juvenile period, maturing quickly.[5] Males mature at about 53–63 mm (2.1–2.5 in), typically at four years of age, and females mature at about 55–68 mm (2.2–2.7 in), typically at about five years of age.[5]

Red salamanders generally live in springs or streams during the winter and then disperse to and from these sites in the fall and spring.[9] Due to its semiaquatic nature, the red salamander remains in terrestrial environments until early spring then disperses to more aquatic sites.[5] Adults often live in burrows along streams and in other moist environments such as under logs and rocks along the forest floor.[6] Adult red salamanders, like their larvae, are generalists and tend to feed on invertebrates, as well as small amphibians.[6] Its predators include birds and small carnivores such as skunks and raccoons.[5] Since the red salamander is a large species of salamander, its presence or absence can greatly affect the ecosystem where it lives, and understanding its ecology is important to understand its role in community structures.

Life history[edit]

P. ruber has a wide range in its breeding season, which is only limited by extremely cold temperatures.[5] Generally, however, adult red salamanders mate annually and engage in primitive courting activities.[9][10] Courtship between two red salamanders involves: "A male approaches a female, rubbing his snout against her snout, cheeks, and chin. The male then moves his head and body under her chin and starts tail undulations. The female then straddles the male’s tail and the pair engages in a straddled “walk” until the male deposits sperm on the substrate. The “straddle-walk” approximately lasts two minutes and once the sperm is deposited, the female picks up the sperm cap as she moves over it and then they separate".[10] Females are capable of long-term sperm storage and may not lay eggs for months after mating.[5] Females typically lay eggs in the fall or early winter in headwater streams, and have very cryptic nests.[6]

Other important behavioral aspects of P. ruber include its defensive mechanisms. In regards to mating, males appear to not be aggressive towards one another, but do occasionally court other males as a means of sperm competition to get the other male to deposit spermatophores, giving them a better chance of successful mating over their competitors.[10] When threatened, red salamanders assume a defensive posture in which they curl their bodies, elevating and extending their rears, and placing their heads under their tails which are elevated and undulated from side to side.[11] The coloration of the red salamander has been hypothesized to mimic that of the red eft stage of the eastern newt (Notophythalmus viridescens) which emits a powerful neurotoxin in their skin.[12] This hypothesis, however, was heavily criticized due to significant size differences in the organisms and the differences in the species’ times of foraging ( i.e. P. ruber mainly at night and the red eft mainly during the day).[13] More recently, red salamanders have been noted to have reduced palatability, so they are considered part of a Müllerian mimicry system in which all species are unpalatable and benefit from aposematic coloration.[5]

Conservation[edit]

In Indiana, the red salamander is listed as an endangered species.[14]

The red salamander is arguably one of the most primitive plethodontids, so is extremely valuable in understanding the links to ancestors and the evolutionary processes that have occurred.[10] Maintaining species diversity is an important part of conservation, and to prevent the loss of salamander diversity as a whole, it is important to have some type of management plan in place to prevent P. ruber from escalating from a low conservation status to a higher level of concern. Since the red salamander prefers streams that are relatively pure, it is important to monitor human waste and pollution, since debris and silt could have adverse effects on the their habitat, potentially causing a threat to survival.

References[edit]

  1. ^ a b c d e f g h i Conant, R. and J.T. Collins.Peterson Field Guides: Reptiles and Amphibians.New York: Houghton Mifflin, 1998.
  2. ^ Red salamander(Pseudotriton ruber).Savannah River Ecology Laboratory: Herpetology Program.1 April 2011< http://www.uga.edu/srelherp/salamanders/pserub.htm>.
  3. ^ Wilder, I.W. and E.R. Dunn. 1920. The correlation of lunglessness in salamanders with a mountain brook habitat. Copeia 84: 63-68.
  4. ^ a b Beachy, C.K. and R.C. Bruce.1992.Lunglessness in Plethodontid Salamanders is Consistent with the Hypothesis of a Mountain Stream Origin: A Response to Ruben and Boucot.The American Naturalists 139 (4): 839-847.
  5. ^ a b c d e f g h i Petranka, J.W. Salamanders of the United States and Canada. Washington and London: Smithsonian Institution Press, 1998.
  6. ^ a b c d Bishop,S.C.1941.Salamanders of New York. New York State Museum Bulletin 324: 1-365.
  7. ^ a b c d Bruce, R.C. 1972.The larval life of the Red Salamander,Pseudotriton ruber.Journal of Herpetology6(1): 43-51.
  8. ^ a b Cecala, K.K., S.J. Price, and M.E. Dorcas. 2007. Diet of larval Red Salamanders (Pseudotriton ruber) examined using a nonlethal technique. Journal of Herpetology 41(4): 741-745.
  9. ^ a b Bruce, R.C. 1978. Reproductive biology of the salamander Pseudotriton ruber in the southern Blue Ridge Mountains. Copeia 1978: 417-423.
  10. ^ a b c d Organ, J.A., and D.J. Organ. 1968. Courtship behavior of the Red Salamander, Pseudotriton ruber. Copeia 1968: 217-223.
  11. ^ Brandon, R.A.,Labanick, G.N., and J.E. Huheey. 1979. Relative palatability, defensive behavior, and mimetic relationships of red salamanders (Pseudotriton ruber), mud salamanders (Pseudotriton monatnus), and red efts (Notophyhalmus viridescens). Herpetoligca 35: 289-303.
  12. ^ Howard, R.R. and E.D.Brodie.1971.Experimental study of mimicry in salamanders involving Notophythalmus viridescens and Pseudotriton ruber schencki.Nature 233:277.
  13. ^ Brandon, R.A., and J. E. Huheey. 1975. Diurnal activity, avian predation, and the question of warning coloration and cryptic coloration in salamanders. Herpetologica 31: 252-255.
  14. ^ Indiana Legislative Services Agency (2011), "312 IAC 9-5-4: Endangered species of reptiles and amphibians", Indiana Administrative Code, retrieved 28 Apr 2012 

More References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!