Microhyla butleri — Details

Tubercled Pygmy Frog learn more about names for this taxon

Overview

Distribution

Range Description

Learn more about this article

This species is known from central, southern and south-western China, including Taiwan and Hong Kong, eastern Myanmar, throughout Thailand, Lao People's Democratic Republic, Cambodia, Viet Nam and Peninsular Malaysia and Singapore (Bourret 1942, Taylor 1962, Berry 1975, Lim and Lim 1992, Nguyen and Ho 1996, Stuart 1999). It generally occurs in lowlands and at mid-altitudes up to about 220-1,500 m asl.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Physical Description

Type Information

Learn more about this article

Holotype for Microhyla butleri
Catalog Number: USNM 65309
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Locality: Yen-Ping Fu, near, Fujian, China, Asia
  • Holotype: Stejneger, L. 1924. Occ. Pap. Boston Soc. Nat. Hist. 5: 119.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Learn more about this article

Paratype for Microhyla butleri
Catalog Number: USNM 65937
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Year Collected: 1923
Locality: Suifu, Sichuan, China, Asia
  • Paratype: Stejneger, L. 1924. Occ. Pap. Boston Soc. Nat. Hist. 5: 119.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Learn more about this article

Holotype for Microhyla butleri
Catalog Number: USNM 65936
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Year Collected: 1923
Locality: Suifu, Sichuan, China, Asia
  • Holotype: Stejneger, L. 1924. Occ. Pap. Boston Soc. Nat. Hist. 5: 119.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Ecology

Habitat

Habitat and Ecology

Learn more about this article

Habitat and Ecology
A species of the forest edge, occasionally encountered on the forest floor of primary forest, but most often heard in massive choruses at forest edge puddles and pools. It is also known occasionally from plantations, tall shrublands and cultivated fields. It breeds in relatively permanent still waters, such as grassy pools, marshes, ponds and paddy fields in hilly areas.

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Molecular Biology and Genetics

Molecular Biology

Barcode data: Microhyla butleri

Learn more about this article

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

GAC---GACCAGATTTACAATGTCATCGTTACTGCTCATGCTTTTGTAATAATTTTCTTCATAGTCATACCAATTATAATTGGCGGCTTCGGAAACTGATTAGTCCCACTAATAATTGGAGCCCCTGACATGGCATTCCCTCGTATAAACAACATAAGTTTTTGACTTCTTCCCCCCTCATTTCTCCTTCTTTTAGCCTCATCTGCAGTCGAGGCCGGGGCCGGAACTGGCTGAACAGTCTATCCCCCTCTAGCAGGGAACCTAGCTCACGCTGGCCCATCAGTAGACCTAACCATTTTCTCCCTACACTTAGCTGGGGTATCCTCTATCCTTGGGGCAATCAATTTTATTACCACAATTATTAACATAAAGCCCCCATCGGTAACCCAGTACCAAACACCCTTATTTGTTTGATCTGTTCTAATTACAGCTGTCCTTCTTCTACTTTCCCTCCCTGTTCTTGCCGCAGGCATTACGATACTTTTAACCGACCGCAACCTCAATACAACATTCTTTGACCCAGCTGGTGGTGGTGACCCGGTCTTATACCAACACCTGTTCTGATTCTTTGGCCACCC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Statistics of barcoding coverage: Microhyla butleri

Learn more about this article

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 14
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Conservation

Conservation Status

IUCN Red List Assessment

Learn more about this article


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
van Dijk, P.P., Ohler, A., Lue Kuangyang, Chou Wenhao, Geng Baorong & Bosco Chan

Reviewer/s
Chanson, J.S., Cox, N.A. & Stuart, S.N.

Contributor/s

Justification
Listed as Least Concern in view of its wide distribution, tolerance of a broad range of habitats, presumed large population, and because it is unlikely to be declining to qualify for listing in a more threatened category.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Population

Learn more about this article

Population
It is generally abundant in appropriate habitat in Southeast Asia. It is regarded as a rare species in Taiwan, Province of China. The distribution in China is fragmented.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Threats

Learn more about this article

Major Threats
Habitat destruction and degradation due to residential and agricultural development are threats to this species in China. No populations were ever found in paddy fields in Taiwan, Province of China, presumably owing to the use of pesticides and fertilizer application.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Management

Conservation Actions

Learn more about this article

Conservation Actions
Many protected areas in the region support this species. It is a Class II protected species in Taiwan, Province of China.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Wikipedia

Painted Chorus Frog

Learn more about this article

The Painted Chorus Frog or Tubercled Pygmy Frog (Microhyla butleri) is a species of frog in the Microhylidae family. It is found in Cambodia, China, Hong Kong, Laos, Malaysia, Myanmar, Singapore, Taiwan, Thailand, and Vietnam. Its natural habitats are subtropical or tropical moist lowland forests, subtropical or tropical moist montane forests, subtropical or tropical moist shrubland, swamps, intermittent freshwater marshes, arable land, plantations, rural gardens, ponds, open excavations, and irrigated land. It is not considered threatened by the IUCN.

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!