Overview

Comprehensive Description

Description

Adult males are about 67-92 mm in length; females are 61-97 mm. Small, slender body with broad, greenish yellow or orangish dorsum bordered on either side with a dark brown or black stripe, which starts at the snout, widening at the back of the eyes and extends onto the laterally compressed tail. Sides mottled from darkest to lightest when moving towards the yellow venter. Dorsum also has many scattered black spots or blotches. There are about 13-16 costal grooves (Bishop 1943; Petranka 1998).
The sides of the female head are almost parallel back of the eyes, converging to a bluntly rounded snout. The male head widens back of the eyes with a snout somewhat swollen in the area of the nasolabial grooves and sometimes small blunt cirri below the nostrils. The long diameter of the eyes is about equal to the length of the snout. Small, oval tongue with a central pedicel. Irregular line of vomerine teeth and parasphenoid teeth in elongate separate patches (Bishop 1943; Petranka 1998).
Breeding males have unicuspid and elongated teeth relative to bicuspid teeth of females. Male has premaxillary teeth that often pierces male's lip. Unicuspid teeth replaced with typical bicuspid teeth when breeding season ends (Petranka 1998).
Hatchlings and older larvae are dusky colored with six to nine pairs of light dorsolateral spots on body. Streamlined body with tail fin stopping near insertion of rear limbs. Usually light-colored venter with many iridophores. Large larvae from extreme northern parts of the range sometimes have dark colored throats and bellies (Petranka 1998).
  • Petranka, J. W. (1998). Salamanders of the United States and Canada. Smithsonian Institution Press, Washington and London.
  • Bishop, S.C. (1943). Handbook of Salamanders. Comstock Publishing Company, Inc., Ithaca, New York.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

This species can be found in Eastern North America. It is also found in Southern Quebec and eastern Ontario south to northern Virginia, eastern West Virginia, and central Ohio; isolated populations in southern Labrador (Jacobs 1987, Conant and Collins 1991, Sever 1999).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

The range of Eurycea bislineata, the Northern two-lined salamander, extends south from southern Quebec and New Brunswick to northern Virginia, and west from New England to northeastern Ohio (Harding 1997).

Biogeographic Regions: nearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (200,000-2,500,000 square km (about 80,000-1,000,000 square miles)) Southern Quebec and eastern Ontario south to northern Virginia, eastern West Virginia, and central Ohio; isolated populations in southern Labrador (Jacobs 1987, Conant and Collins 1991, Sever 1999).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution and Habitat

Southeastern Canada to Gulf Coast and west to Louisiana, Arkansas, and Illinois; elevations from sea level to 2000 m. Found beneath rocks and logs by small, rocky streams or seeps and in forest floor far from running water. During breeding season, can be found beneath submerged rocks and debris in streams (Petranka 1998).
  • Petranka, J. W. (1998). Salamanders of the United States and Canada. Smithsonian Institution Press, Washington and London.
  • Bishop, S.C. (1943). Handbook of Salamanders. Comstock Publishing Company, Inc., Ithaca, New York.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Adult Northern two-lined salamanders, 6.4 to 12.1 cm in length, are characterized by a broad stripe stretching from head to tail along their slender bodies. The stripe, bordered on both sides by narrow black lines that may separate into dashes along caudal regions, ranges in color from yellow to greenish yellow or tan. Medially, the stripe may be marked with a row of dark spots. Yellow or mottled pigmentation extends down the sides, each with fifteen to sixteen costal grooves, and small legs to the yellow belly. Sexual dimorphism exists among males and females, but is more pronounced in the breeding season. During this time period, males possess whitish lower eyelid glands, a distinictive mental gland on the chin, and cirri (protruding extensions of the naso-labial gooves). Young and older Eurycea bislineata larvae differ from adults in coloration and markings. The yellowish ground color of young larvae is spotted with gray or brown on the head and back. Young larvae also possess one dark irregular stripe containing six to nine light spots along upper regions of each side. A secondary row of spots may develop as the larvae age. Distinctive short, reddish brown gills are also characteristic of the larvae (Harding 1997).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 12 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Paratype for Eurycea bislineata
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Year Collected: 1932
Locality: Marietta, Washington, Ohio, United States, North America
  • Paratype: Mittleman, M. B. 1949. Proc. Biol. Soc. Washington. 62: 93.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Eurycea bislineata
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Year Collected: 1930
Locality: Marietta, Washington, Ohio, United States, North America
  • Paratype: Mittleman, M. B. 1949. Proc. Biol. Soc. Washington. 62: 93.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Eurycea bislineata
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Year Collected: 1930
Locality: Marietta, Washington, Ohio, United States, North America
  • Paratype: Mittleman, M. B. 1949. Proc. Biol. Soc. Washington. 62: 93.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Eurycea bislineata
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Year Collected: 1930
Locality: Marietta, Washington, Ohio, United States, North America
  • Paratype: Mittleman, M. B. 1949. Proc. Biol. Soc. Washington. 62: 93.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Eurycea bislineata
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Year Collected: 1930
Locality: Marietta, Washington, Ohio, United States, North America
  • Paratype: Mittleman, M. B. 1949. Proc. Biol. Soc. Washington. 62: 93.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Eurycea bislineata
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Year Collected: 1932
Locality: Belleview, 5 mi W of, Davidson, Tennessee, United States, North America
  • Paratype: Mittleman, M. B. 1949. Proc. Biol. Soc. Washington. 62: 93.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Eurycea bislineata
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Year Collected: 1932
Locality: Shacklett, 2 mi E of, Cheatham, Tennessee, United States, North America
  • Paratype: Mittleman, M. B. 1949. Proc. Biol. Soc. Washington. 62: 93.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Eurycea bislineata
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Year Collected: 1932
Locality: Bean Station, 4 mi SW of, Grainger, Tennessee, United States, North America
  • Paratype: Mittleman, M. B. 1949. Proc. Biol. Soc. Washington. 62: 93.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Eurycea bislineata
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Year Collected: 1932
Locality: Dowelltown, 2 mi E of, De Kalb, Tennessee, United States, North America
  • Paratype: Mittleman, M. B. 1949. Proc. Biol. Soc. Washington. 62: 93.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Eurycea bislineata
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Year Collected: 1932
Locality: Pleasant Hill, 3 mi E of, Cumberland, Tennessee, United States, North America
  • Paratype: Mittleman, M. B. 1949. Proc. Biol. Soc. Washington. 62: 93.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Syntype for Eurycea bislineata
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Year Collected: 1852
Locality: Lake Oquassa (= Rangeley Lake), Franklin, Maine, United States, North America
  • Syntype: Baird, S. F. 1889. United States National Museum Bulletin. (34): 165.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Eurycea bislineata
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Locality: Godbout, Saguenay, Quebec, Canada, North America
  • Paratype: Trapido, H. & Clausen, R. T. 1938. Copeia. 1938 (3): 118.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Eurycea bislineata
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Locality: Godbout, Saguenay, Quebec, Canada, North America
  • Paratype: Trapido, H. & Clausen, R. T. 1938. Copeia. 1938 (3): 118.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Eurycea bislineata
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Locality: Godbout, Saguenay, Quebec, Canada, North America
  • Paratype: Trapido, H. & Clausen, R. T. 1938. Copeia. 1938 (3): 118.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Holotype for Eurycea bislineata
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Sex/Stage: Male;
Preparation: Ethanol
Year Collected: 1937
Locality: Ouiatchouan River at Val Jalbert, Lake St. John, Quebec, Canada, North America
  • Holotype: Trapido, H. & Clausen, R. T. 1938. Copeia. 1938 (3): 118.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Eurycea bislineata
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Locality: Cincinnati, Hamilton, Ohio, United States, North America
  • Paratype: Mittleman, M. B. 1949. Proc. Biol. Soc. Washington. 62: 93.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Eurycea bislineata
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Year Collected: 1892
Locality: Lafayette, Tippecanoe, Indiana, United States, North America
  • Paratype: Mittleman, M. B. 1949. Proc. Biol. Soc. Washington. 62: 93.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Eurycea bislineata
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Year Collected: 1892
Locality: Lafayette, Tippecanoe, Indiana, United States, North America
  • Paratype: Mittleman, M. B. 1949. Proc. Biol. Soc. Washington. 62: 93.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Eurycea bislineata
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Year Collected: 1892
Locality: Lafayette, Tippecanoe, Indiana, United States, North America
  • Paratype: Mittleman, M. B. 1949. Proc. Biol. Soc. Washington. 62: 93.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Eurycea bislineata
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Year Collected: 1929
Locality: Camden, 5 mi SE of, Preble, Ohio, United States, North America
  • Paratype: Mittleman, M. B. 1949. Proc. Biol. Soc. Washington. 62: 93.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Eurycea bislineata
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Year Collected: 1929
Locality: Camden, 5 mi SE of, Preble, Ohio, United States, North America
  • Paratype: Mittleman, M. B. 1949. Proc. Biol. Soc. Washington. 62: 93.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Eurycea bislineata
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Locality: Indianapolis, springs along Fall Creek, Marion, Indiana, United States, North America
  • Paratype: Mittleman, M. B. 1949. Proc. Biol. Soc. Washington. 62: 93.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Eurycea bislineata
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Locality: Indianapolis, springs along Fall Creek, Marion, Indiana, United States, North America
  • Paratype: Mittleman, M. B. 1949. Proc. Biol. Soc. Washington. 62: 93.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Eurycea bislineata
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Locality: Indianapolis, springs along Fall Creek, Marion, Indiana, United States, North America
  • Paratype: Mittleman, M. B. 1949. Proc. Biol. Soc. Washington. 62: 93.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Eurycea bislineata
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Year Collected: 1891
Locality: Indianapolis, springs along Fall Creek, Marion, Indiana, United States, North America
  • Paratype: Mittleman, M. B. 1949. Proc. Biol. Soc. Washington. 62: 93.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Eurycea bislineata
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Sex/Stage: Female;
Preparation: Ethanol
Year Collected: 1942
Locality: Echo Canyon, McCormick's Creek State Park, Owen, Indiana, United States, North America
  • Paratype: Mittleman, M. B. 1949. Proc. Biol. Soc. Washington. 62: 93.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Holotype for Eurycea bislineata
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Sex/Stage: Male;
Preparation: Ethanol
Year Collected: 1942
Locality: Echo Canyon, McCormick's Creek State Park, Owen, Indiana, United States, North America
  • Holotype: Mittleman, M. B. 1949. Proc. Biol. Soc. Washington. 62: 93.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
It can be found in rocky brooks, springs, and seepages; animals may disperse into wooded terrestrial habitats in wet warm weather. Bahret (1996) documented a breeding population in an acidic, fish-free lake in New York; occurred to depths of 19.5m. Adults hide under objects in or near water. In New York, rarely found on soils of low pH (Wyman 1988, Wyman and Jancola 1992). Eggs typically are laid on underside of submerged rocks, logs, or aquatic plants. Bahret (1996) found eggs in a lake at depths of 9.0-13.5 m, on the topmost leaves of water moss, far from shore and from surface drainage inlets.

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Adult Northern two-lined salamanders prefer woodland or open habitats with sufficient cover provided by layers of fallen leaves, logs, or rocks. Although occasionally found several meters from a water source, adult salamanders commonly occur along stream banks. Adults may remain active in springs, streams, or water laden soil where temperatures are above freezing in winter months. Alternatively, adults may burrow deep into leaf litter, becoming inactive during cold seasons. Larvae typically inhabit the flowing waters of springs or streams (Harding 1997). In at least one region of their range, larvae may also live in lakes (Bahret 1996).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Rocky brooks, springs, seepages; may disperse into wooded terrestrial habitats in wet warm weather. Bahret (1996) documented a breeding population in an acidic, fish-free lake in New York; occurred to depths of 19.5 m. Adults hide under objects in or near water. In New York, rarely found on soils of low pH (Wyman 1988, Wyman and Jancola 1992). Eggs typically are laid on underside of submerged rocks, logs, or aquatic plants. Bahret (1996) found eggs in a lake at depths of 9.0-13.5 m, on the topmost leaves of water moss, far from shore and from surface drainage inlets.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Eurycea bilineata is primarily insectivorous. Adult diets consist of insects such as beetles, mayflies, and springtails, as well as spiders, pillbugs, and centipedes. Adults may also consume other small invertebrates including earthworms and snails. Larvae eat crustaceans and copepods in addition to aquatic larvae of midges, mosquitos, caddisflys, stoneflys,and beetles (Harding 1997). A high dietary overlap exists among the different sizes of larvae which feed continuously throughout the night and day. The larvae act as opportunistic generalists as they mature, continuing to ingest large amounts of small prey after the developmental point when their jaw size can accomodate larger prey items (Petranka 1984).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Feeds opportunistically on a wide variety of small invertebrates, a large proportion of which are of terrestrial origin.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Global Abundance

100,000 - 1,000,000 individuals

Comments: Total adult population size is unknown but surely exceeds 100,000.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Ohio individuals moved over an area of less than 14 square meters (Ashton and Ashton 1978). Aggregates in winter. In experimental stream communities, Resetarits (1991) found that the brook trout Salvelinus fontinalis and the spring salamander Gyrinophilus porphyriticus affected the growth of the two-lined salamander Eurycea and the crayfish Cambarus bartonii. Salvelinus caused Cambarus and Eurycea to alter their activity levels and habitat; Eurycea and Cambarus were able to avoid predation by Salvelinus and Gyrinophilus but at a significant cost to growth.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Cyclicity

Comments: Sometimes active during day in shaded wet areas. Apparently active throughout year in most of range.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Northern two-lined salamanders reach sexual maturity the first fall, or occassionally, one year after metamorphosis. Fertilization occurs internally after the female collects a spermatophore in her cloaca. The breeding season lasts from October through May with females typically laying their eggs in April or May. Females may attach as few as fifteen or greater than one hundred eggs to the underside of firm substrate, usually rock, in flowing streams or spring water (Harding 1997). Recent evidence suggests Northern two-lined salamanders, in some areas of their range, attach eggs to vegetational carpets in fish free, acidic lakes (Bahret 1996). Females tend to guard nests for at least part of the incubation period lasting thirty to sixty days. Only one female typically guards a nest in cases where multiple females deposit eggs at the same site. The larvae measure 1.2 to 1.4 cm snout to vent length (svl) when hatched, and usually transform into semiterrestrial juveniles after two to three years as aquatic larvae. Parental care ceases after eggs hatch (Harding 1997).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Eggs are laid April-June; May-June in Massachusetts (Johnson and Goldberg 1975). Female typically remains with eggs until hatching in summer after an incubation period of about 30 days. Larvae metamorphose in 2-3 years in Massachusetts (Wilder 1924). Most sexually mature during second fall after metamorphosis in New York (Stewart 1956).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Eurycea bislineata

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBAP0415-06|NC_006329|Eurycea bislineata| ACCCGATGACTATTTTCAACAAACCACAAAGATATTGGCACCCTTTACCTAATATTTGGGGCCTGGGCCGGCATAGTGGGTACAGCTCTA---AGTTTATTAATTCGCGCAGAATTAAGCCAACCAGGTGCCCTATTAGGAGAT---GATCAAATCTATAATGTTATTGTTACTGCCCATGCCTTTGTTATAATTTTTTTTATAGTTATACCCATCATAATTGGTGGGTTTGGTAACTGACTGCTGCCACTAATA---ATTGGGGCCCCAGATATGGCCTTCCCACGAATAAATAATATAAGCTTTTGACTCCTCCCACCATCCTTCTTACTTCTCCTCGCCTCGTCAGGGGTTGAAGCGGGAGCCGGAACCGGGTGAACTGTTTATCCCCCCCTTGCAGGAAATATAGCTCATGCCGGAGCCTCTGTAGACCTA---ACCATCTTTTCCCTACACTTAGCTGGCGTATCCTCTATCCTTGGAGCAATTAACTTTATTACTACATCAATTAATATAAAACCACCATCAATATCACAATACCAAACTCCACTATTTGTATGATCTGTATTAATTACAGCTATTCTACTGCTTCTTTCACTTCCAGTATTAGCAGCA---GGAATTACAATATTATTAACAGATCGAAATCTAAATACCACATTCTTTGACCCAGCTGGTGGTGGCGATCCAGTCCTATATCAACACCTGTTTTGATTTTTTGGTCACCCAGAAGTCTATATTCTCATTTTACCCGGGTTCGGAATAATCTCACACATTGTCACATATTATTCAGCTAAAAAA---GAGCCATTTGGCTATATGGGTATAGTCTGAGCAATAATATCAATTGGCCTGCTAGGCTTTATTGTATGAGCCCACCATATATTTACAGTTGACTTAA 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Eurycea bislineata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Species: 71
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2004

Assessor/s
Geoffrey Hammerson

Reviewer/s
Global Amphibian Assessment Coordinating Team (Simon Stuart, Janice Chanson, Neil Cox and Bruce Young)

Justification
Listed as Least Concern in view of its wide distribution, tolerance of a degree of habitat modification, presumed large population, and because it is unlikely to be declining fast enough to qualify for listing in a more threatened category.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Continued exploitation of Northern two-lined salamanders by humans, for fish bait, or destruction of salamander habitat could lead to reduction or extinction of local populations (Harding 1997).

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: Large range in northeastern United States and southeastern Canada; high abundance; many stable populations.

Intrinsic Vulnerability: Moderately vulnerable

Environmental Specificity: Narrow. Specialist or community with key requirements common.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Total adult population size is unknown but surely exceeds 100,000. Many stable populations.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Short Term Trend: Relatively stable to decline of 30%

Comments: Short-term trend likely stable to slightly declining, based on habitat degradation.

Global Long Term Trend: Increase of 10-25% to decline of 30%

Comments: Extent of occurrence has been relatively stable; other criteria probably have declined by less than 25%.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History, Abundance, Activity, and Special Behaviors

Courtship: Male noses other animals nearby until he encounters a female, which may then be stimulated to follow him and pick up spermatophores, a gelatinous base capped with an elongate head (Bishop 1943). Aggressive courting males will attempt to drive off intruding rival males (Petranka 1998).

Eggs: Females lay unpigmented or white to pale yellow eggs with a diameter of 2.5-3 mm. Clutch size positively correlates with size of female. Two envelopes surround the eggs; the outer one is drawn out to form an attachment disk (Bishop 1943). Sometimes in the same place as others, a female attaches eggs singly to lower surface of a support in running, but rarely stagnant water. Ovipositional sites usually attended by at least one adult through hatching. Incubation period is about 4-10 weeks, depending on temperature of water (Petranka 1998).

Larvae: In an aquatic environment, hatch with yolk reserves and most likely do not start feeding until yolk is mostly resorbed. Often live in the slow moving pools of streams; rarely in fast currents unless drifting. Mostly benthic feeders, hunting stream bottoms or over rocks for prey such as isopods, amphipods, chironomid larvae, and zooplankton. Larval period length is about 2-3 years; tends to be longer in northern than southern populations (Petranka 1998).
In a terrestrial environment, live along stream margins and surrounding forests, making seasonal migrations to and from breeding streams. Juveniles and adults both feed on prey such as wood roaches, spiders, ticks, earthworms, isopods, millipedes, beetles, snails, and flies (Petranka 1998).

Defense: Adults will actively defend home shelters by aggressive posturing or biting. Predators include owls, snakes, and fish. Most E. bislineata become immobile when contacted by snakes but will engage in protean flipping and flight when contacted by the snake's tongue. The decision to stay or flee depends on the individual's physical abilities. Can also autotomize the tail when attacked by snakes (Petranka 1998).

  • Petranka, J. W. (1998). Salamanders of the United States and Canada. Smithsonian Institution Press, Washington and London.
  • Bishop, S.C. (1943). Handbook of Salamanders. Comstock Publishing Company, Inc., Ithaca, New York.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
No major pervasive threats. Often common in and along streams in semi-cleared areas and in second-growth woods surrounded by suburban areas (G. Hammerson pers. obs), though Petranka (1998) stated that the species is often absent from urban areas or highly disturbed landscapes such as result from intensive timbering, land clearing, stream pollution, and stream siltation.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: No major pervasive threats. Often common in and along streams in semi-cleared areas and in second-growth woods surrounded by suburban areas (G. Hammerson, pers. obs), though Petranka (1998) stated that the species is often absent from urban areas or highly disturbed landscapes such as result from intensive timbering, land clearing, stream pollution, and stream siltation.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History, Abundance, Activity, and Special Behaviors

Relatively common species and requires minimal protection. Like other species of salamanders, sensitive to intensive timbering, land clearing, stream pollution, and stream siltation. Avoids urban areas or highly disturbed land and soils with low pH (Petranka 1998).
  • Petranka, J. W. (1998). Salamanders of the United States and Canada. Smithsonian Institution Press, Washington and London.
  • Bishop, S.C. (1943). Handbook of Salamanders. Comstock Publishing Company, Inc., Ithaca, New York.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
In minimal need of protection (Petranka 1998).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Positive

Northern two-lined salamanders are often collected and used as fish bait by humans (Harding 1997).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Northern two-lined salamander

The Northern two-lined salamander (Eurycea bislineata) is a species of salamander in the Plethodontidae family. It is found in Canada and the United States. Its natural habitats are temperate forests, temperate shrubland, rivers, intermittent rivers, freshwater marshes, freshwater springs, arable land, and urban areas.

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Jacobs (1987) examined allozyme variation and concluded that Eurycea bislineata subspecies bislineata , cirrigera, and wilderae should be regarded as distinct species. Most subsequent authors, including Sever (1999), have followed this treatment, but Petranka (1998) retained these taxa as subspecies of Eurycea bislineata, pending study of genetic interactions in contact zones.

A phylogeographic analysis of the E. bislineata complex based on mtDNA data (Kozak et al. 2006) revealed that E. cirrigera and E. wilderae as currently circumscribed are not monophyletic lineages but rather consist of several distinct lineages. Eurycea bislineata (as currently defined, separate from E. cirrigera and E. wilderae) was represented by two lineages. Eurycea junaluska and E. aquatica (Alabama samples) each formed monophyletic lineages that were deemed worthy of recognition as distinct species. Kozak et al. did not make a formal taxonomic revision of the E. bislineata complex and did not propose names for the newly identified lineages. Until the taxonomy has been resolved, this database retains E. bislineata, E. cirrigera, and E. wilderae as mapped by Conant and Collins (1991), except that E. aquatica is recognized as a distinct species rather than as part of E. cirrigera.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!