Overview

Comprehensive Description

Description

Gyrinophilus porphyriticus danielsi, G. p. dunni, G. p. duryi, and G. p. porphyriticus are subspecies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

This species can be found in eastern North America from southern Quebec and southern Maine to northern Georgia, Alabama, and northeastern Mississippi (Conant and Colins 1991).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

The Spring Salamander has an extensive range. It is found in and around the Applachian Mountains in eastern North America and north into the Adirondacks and just into Canada. Although it has the potential to be found anywhere within this range, its specific habitat requirements mean that actual distribution is spotty (Conant&Collins 1998).

Biogeographic Regions: nearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (200,000-2,500,000 square km (about 80,000-1,000,000 square miles)) Southern Quebec and southern Maine to northern Georgia, Alabama, and northeastern Mississippi (Conant and Colins 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

The Spring Salamander is one of the largest species in the family of

lungless salamanders (Tenn. Aquarium, 1998), and can grow up to 21 cm in

length (Watkins-Colwell, 2001). The males often grow to be about 12-19 cm in length, and the females grow to be slightly smaller (Tenn. Aquarium, 1998).

As larvae, the Spring Salamander is 19 mm long when it hatches, and has the potential to grow to be 10.2 cm long, before it transforms into an adult. Larvae have a broad, elongated snout that is slightly upturned at the tip (Leary, 2001). The Spring Salamander has a stout body and a broad nose that ends abruptly. Its back and tail are light brownish-orange or salmon-red with small dark spots. The belly is a faded peach color, and the throat may be flecked with black. A light line, bordered below by a dark line, begins at the eye and extends to the nostril. As an adult, the Spring Salamander's tail has a prominent, knife-like keel on the top that enables it to swim in swift-moving water (Conn. Dep., 2000). Adults also have toxic, cutaneous secretions and red coloration that mimics more toxic species, for protection from terrestrial predators (Environment Canada, 2000).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 22 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Paratype for Gyrinophilus porphyriticus
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Sex/Stage: Female;
Preparation: Ethanol
Year Collected: 1975
Locality: Alderson, a few km NE of, General Davis Cave, Greenbrier, West Virginia, United States, North America
  • Paratype: Besharse, J. C. & Holsinger, J. R. 1977. Copeia. 1977 (4): 626, figure 1.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Gyrinophilus porphyriticus
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Sex/Stage: Male; Larva
Preparation: Ethanol
Year Collected: 1975
Locality: Alderson, a few km NE of, General Davis Cave, Greenbrier, West Virginia, United States, North America
  • Paratype: Besharse, J. C. & Holsinger, J. R. 1977. Copeia. 1977 (4): 626, figure 1.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Gyrinophilus porphyriticus
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Sex/Stage: Male;
Preparation: Ethanol
Year Collected: 1974
Locality: Alderson, a few km NE of, General Davis Cave, Greenbrier, West Virginia, United States, North America
  • Paratype: Besharse, J. C. & Holsinger, J. R. 1977. Copeia. 1977 (4): 626, figure 1.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Gyrinophilus porphyriticus
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Sex/Stage: ; Larva
Preparation: Ethanol
Year Collected: 1974
Locality: Alderson, a few km NE of, General Davis Cave, Greenbrier, West Virginia, United States, North America
  • Paratype: Besharse, J. C. & Holsinger, J. R. 1977. Copeia. 1977 (4): 626, figure 1.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Gyrinophilus porphyriticus
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Sex/Stage: ; Larva
Preparation: Ethanol
Year Collected: 1974
Locality: Alderson, a few km NE of, General Davis Cave, Greenbrier, West Virginia, United States, North America
  • Paratype: Besharse, J. C. & Holsinger, J. R. 1977. Copeia. 1977 (4): 626, figure 1.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Gyrinophilus porphyriticus
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Sex/Stage: Female; Larva
Preparation: Ethanol
Year Collected: 1974
Locality: Alderson, a few km NE of, General Davis Cave, Greenbrier, West Virginia, United States, North America
  • Paratype: Besharse, J. C. & Holsinger, J. R. 1977. Copeia. 1977 (4): 626, figure 1.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Gyrinophilus porphyriticus
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Sex/Stage: Male; Larva
Preparation: Ethanol
Year Collected: 1974
Locality: Alderson, a few km NE of, General Davis Cave, Greenbrier, West Virginia, United States, North America
  • Paratype: Besharse, J. C. & Holsinger, J. R. 1977. Copeia. 1977 (4): 626, figure 1.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Gyrinophilus porphyriticus
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Sex/Stage: Female; Larva
Preparation: Ethanol
Year Collected: 1973
Locality: Alderson, a few km NE of, General Davis Cave, Greenbrier, West Virginia, United States, North America
  • Paratype: Besharse, J. C. & Holsinger, J. R. 1977. Copeia. 1977 (4): 626, figure 1.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Holotype for Gyrinophilus porphyriticus
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Sex/Stage: Female;
Preparation: Ethanol
Year Collected: 1973
Locality: Alderson, a few km NE of, General Davis Cave, Greenbrier, West Virginia, United States, North America
  • Holotype: Besharse, J. C. & Holsinger, J. R. 1977. Copeia. 1977 (4): 626, figure 1.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Small, clear upland streams; clear springs; caves; shaded seepages; occasionally in swamps and lake margins. Sometimes also in forested wet areas away from streams, especially during rainy periods. Often under rocks, logs, leaves, or moss in or near water. Eggs usually are attached to undersides of rocks in running water.

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Spring Salamanders are semi-aquatic, spending a majority of their time in springs, wet caves, and cool, clear mountain brooks (Tenn. Aquarium, 1998). Spring Salamanders can also be found under stones and logs near stream edges (Wild Portraits, 2000). Because they are lungless, and must obtain oxygen through their skin, Spring Salamanders are limited to areas where there is adequate oxygen and moisture. The Northern Spring Salamander is not confined to the water, however, and has been noted to, in a nighttime downpour, leave their aquatic habitats and venture onto land in search of food (Tenn. Aquarium, 1998). During the winter, Spring Salamanders spend their time in wet soil close to a source of water where they remain somewhat active in burrows. The Spring Salamander can also be found among leaf litter in forests surrounding a brook or stream (Conn. Dept., 2000).

Terrestrial Biomes: forest

Aquatic Biomes: lakes and ponds; rivers and streams

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Small, clear upland streams; clear springs; caves; shaded seepages; occasionally in swamps and lake margins. Sometimes also in forested wet areas away from streams, especially during rainy periods. Often under rocks, logs, leaves, or moss in or near water. Eggs usually are attached to undersides of rocks in running water.

Adams and Beachy (2001) documented morphological variation among populations in the southern Appalachian Mountains and found patterns "consistent with the hypothesis that large rivers restrict sizable gene flow."

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

The Spring Salamander consumes a wide variety of food consisting of insects, crustaceans, centipedes, millipedes, earthworms, snails, spiders, and occasionally small frogs and salamanders, including those of their own species (Conn. Dept., 2000).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Eats a wide variety of small invertebrates; large ones also eat small amphibians.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 to >300

Comments: Many occurrences.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Abundance

10,000 - 100,000 individuals

Comments: Total adult population size is unknown but surely exceeds 10,000.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

In experimental stream communities, Resetarits (1991) found that brook trout negatively affected both growth and survival of the salamander Gyrinophilus porphyriticus; the presence of Gyrinophilus had no affect on relative condition or fecundity of Salvelinus. Salvelinus and Gyrinophilus affected the growth of the two-lined salamander Eurycea and the crayfish Cambarus bartonii. Salvelinus caused Cambarus and Eurycea to alter their activity levels and habitat; Eurycea and Cambarus were able to avoid predation by Salvelinus and Gyrinophilus but at a significant cost to growth.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: captivity:
18.5 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 18.5 years (captivity) Observations: At higher elevations maturity is reached about one year later (http://www.pwrc.usgs.gov/neparc/). They become sexual mature soon after metamorphosing (http://amphibiaweb.org/).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Unlike many of the other larger salamander species that breed in the spring, the Spring Salamander breeds from mid-October through the winter months. During this time of courtship, the male and female push each other and roll around in the water. The male deposits sperm which is then picked up and stored by the female until the eggs are laid in the spring of the following year (Conn. Dept., 2000). The female salamander lays 11-100 eggs and attaches each one individually under stones in cool, clear water. The 19 mm long aquatic larvae hatch during the late summer and are often found in the water carefully hidden among the rocks. The larvae can grow to be 10.2 cm long before it transforms into an adult, which may take two to three years (Behler, 1996).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Eggs laid in spring, summer, or fall, depending on local conditions. Clutch size often 20-60, up to 100+. Female stays with eggs until hatching (about 3 months). Aquatic larvae metamorphose after about 2-4 years; sexually mature probably within 1 year after metamorphosis.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Gyrinophilus porphyriticus

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBAP0427-06|NC_006341|Gyrinophilus porphyriticus| ACTCGATGACTATTCTCGACAAACCATAAAGATATTGGCACCCTATACCTTATATTCGGAGCCTGAGCCGGCATAGTTGGCACAGCCTTA---AGTCTGCTTATCCGAGCCGAACTAAGCCAACCGGGTGCCCTCCTTGGAGAC---GACCAGATTTATAATGTGATTGTTACCGCTCACGCCTTTGTTATGATTTTTTTTATAGTTATACCAATTATAATTGGAGGTTTTGGTAATTGATTACTACCTTTAATA---ATTGGGGCCCCAGATATGGCCTTTCCCCGAATAAATAATATAAGCTTCTGACTACTACCTCCATCACTTCTCCTACTCTTAGCCTCCTCCGGAGTTGAAGCGGGGGCGGGAACCGGATGAACAGTATACCCCCCCCTTGCAGGAAATATAGCCCATGCTGGAGCCTCTGTAGACTTA---ACCATTTTTTCCCTTCACTTAGCCGGCGTCTCTTCTATCCTCGGAGCTATTAATTTTATTACAACCTCTATTAATATAAAACCCCCTGCAATATCACAATACCAAACACCCTTATTTGTATGATCTGTTTTAATTACAGCTATTTTACTATTATTATCCCTACCTGTACTCGCTGCT---GGAATTACAATACTGCTTACAGACCGTAATTTAAACACCACATTTTTTGACCCTGCGGGAGGTGGAGACCCAGTACTCTATCAACACCTGTTCTGATTCTTTGGCCACCCAGAAGTCTACATTCTTATTCTTCCGGGCTTCGGAATAATCTCTCACATCGTTACATACTATTCAGCTAAAAAA---GAACCTTTCGGATATATAGGCATGGTCTGAGCAATAATGTCAATCGGCCTACTCGGCTTCATTGTATGAGCCCATCATATGTTTACAGTTGATCTTA 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Gyrinophilus porphyriticus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Species: 2
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2004

Assessor/s
Geoffrey Hammerson

Reviewer/s
Global Amphibian Assessment Coordinating Team (Simon Stuart, Janice Chanson, Neil Cox and Bruce Young)

Justification
Listed as Least Concern in view of its wide distribution, presumed large population, and because it is unlikely to be declining fast enough to qualify for listing in a more threatened category.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

The Spring Salamander is listed as a threatened species in the state of Connecticut (Conn. Dept., 2000). Threats to the Spring Salamander include pollution in the streams due to deforestation, agriculture, and the introduction of predatory fish such as trout (Environment Canada, 2000). Habitat modification and sedimentation in streams, because of stream bed and shore band alteration during road construction and canalization, is also a problem. In order to help save the habitat of the Spring Salamander, people can become involved in projects to restore shade trees and shrubs along stream banks that will help maintain water temperatures that are suitable for the salamander (Conn. Dept., 2000).

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N3 - Vulnerable

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Intrinsic Vulnerability: Highly to moderately vulnerable.

Environmental Specificity: Very narrow. Specialist or community with key requirements scarce.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Total adult population size is unknown but surely exceeds 10,000.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Short Term Trend: Relatively stable (=10% change)

Comments: No data but likely stable in extent of occurrence and probably stable to slightly declining in population size, area of occupancy, and number/condition of occurrences.

Global Long Term Trend: Increase of 10-25% to decline of 30%

Comments: Likely stable in extent of occurrence, probably less than 25% decline in population size, area of occurrence, and number/condition of occurrences, but data are scant.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
Deforestation and its impacts on stream conditions are the primary potential threats, but in general this species is secure throughout most of its range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Deforestation and its impacts on stream conditions are the primary potential threats, but in general this species is secure throughout most of its range.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
No conservation measures are needed. It occurs in many protected areas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

None.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

None.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Spring Salamander

The Spring Salamander (Gyrinophilus porphyriticus) is a species of salamander in the Plethodontidae family. The specific name is Latin from Greek, meaning the color of porphyry, a purple stone[1], and this salamander has also been called the purple salamander[2]. It is found in Canada and the United States. Its natural habitats are temperate forests, rivers, swamps, freshwater marshes, freshwater springs, inland karsts, and caves. Although deforestation is a potential threat, it occurs in many protected areas and is not listed as threatened in the IUCN Red List.[3]

Contents

Description

Like all members of the family Plethodontidae these salamanders have a nasolabial groove. The subspecies G. p. porphyriticus and G. p. duryi are salamanders that can be 4.75–7.5 in (12.1–19 cm) long. The record length is 9.125 in (23.18 cm). The light line from eye to nostril is bordered below by gray pigment, but the markings are not always conspicuous. The dorsal coloration varies from salmon or light brownish to pink or reddish. The ground color has a cloudy appearance, and the darker markings are vague. The subspecies G. p. danielsi and G. p. dunni are salamanders that can be 5–7.5 in (13–19 cm). The record length is 8.06 in (20.5 cm). The white line from eye to nostril, bordered below by a conspicuous black or dark brown line, is distinctive. There also may be a dark line above the white line, often conspicuous. The dorsal coloration can be clear reddish, salmon, or orange-yellow marked with black or brown spots or flecks.

Habitat

This species is found in cool springs and mountain springs, but is also likely to be found in any wet depression beneath logs, stones, or leaves in the surrounding forest.

Geographic range

Its distribution ranges from southern Quebec to northern Alabama and extremely northeast Mississippi. There is also an isolated colony in Hamilton County, Ohio. G. p. duryi is present in southern Ohio, eastern Kentucky, West Virginia, and western Virginia. The distribution range of G. p. danielsi is the southern Appalachian Mountains and the adjacent Piedmont from North Carolina to Alabama. G. p. dunni is distributed through the southern portion of the Blue Ridge Province and the Piedmont from southwest North Carolina to eastern to central Alabama. The nominate subspecies, G. p. porphyriticus, occupies the remainder of the geographical range of this species.

Subspecies

References

  1. ^ Mish, F.C., Editor in Chief. 2004. Merriam-Webster's Collegiate Dictionary, 11th Edition. Merriam-Webster. Springfield, Massachusetts.
  2. ^ Conant, Roger. 1975. A Field Guide to Reptiles and Amphibians of Eastern and Central North America, 2nd Edition. Houghton Mifflin. Boston.
  3. ^ Hammerson, Geoffrey (2004). "Gyrinophilus porphyriticus (Spring Salamander)". IUCN Red List of Threatened Species. Version 2011.1.. http://www.iucnredlist.org/apps/redlist/details/59282/0. Retrieved October 16, 2011. 
  • Green, Jacob. 1827. An account of some new species of salamanders. Contributions of the Maclurian Lyceum to the Arts & Sciences, vol. 1, pp. 3-8.
  • Conant, Roger and Joseph T. Collins. A Field Guide to Reptiles and Amphibians of Eastern and Central North America. Third Edition, Expanded. Boston: Houghton Mifflin Company, 1998.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Some authors include G. subterraneus in this species (Blaney and Blaney 1978).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!