Articles on this page are available in 1 other language: Spanish (7) (learn more)

Overview

Comprehensive Description

Description

Among the largest terrestrial salamanders, reaching up to 20 cm in length. Stout-bodied animals with broad heads and small eyes. Adults have a dark brown to grayish black dorsal color overlain with numerous, large, irregular, dirty brown to brownish yellow spots or vertical streaks. The belly is marked with irregular pale yellow blotches on a darker background. Aquatic larvae are olive-green, with large heads and long feathery gills. Gilled adults are rare but can occur in some permanent water bodies.
 
First described by Green (1825). Eastern populations (those east of the Appalachian Mountains and the Apalachicola River Basin) are divergent from western populations and may constitute a distinct species (Church et al. 2003).
  • Petranka, J. W. (1998). Salamanders of the United States and Canada. Smithsonian Institution Press, Washington and London.
  • Blair, A. P. (1951). "Notes on the herpetology of the Elk mountains, Colorado." Copeia, 1951, 239-240.
  • Irschick, D.J. and Shaffer, H.B. (1997). ''The polytypic species revisited: Morphological differentiation among tiger salamanders (Ambystoma tigrinum) (Amphibia: Caudata).'' Herpetologica, 53(1), 30-49.
  • Bolker, B. M., de Castro, F., Storfer, A., Mech, S., Harvey, E., and Collins, J. P. (2008). ''Disease as a selective force precluding widespread cannibalism: A case study of an iridovirus of tiger salamanders, Ambystoma tigrinum .'' Evolutionary Ecology Research, 10, 105-128.
  • Bollinger, T. K., Mao, J., Schock, D., Brigham, R. M., and Chinchar, V. G. (1999). ''Pathology, isolation, and preliminary molecular characterization of a novel Iridovirus from tiger salamanders in Saskatchewan.'' Journal of Wildlife Diseases, 35, 413-429.
  • British Columbia Recovery Strategy Series. 2008. Recovery Strategy for the Tiger Salamander (Ambystoma tigrinum), Southern Mountain Population in British Columbia.
  • Brunner, J. L., Schock, D. M., Davidson, E. W., and Collins, J. P. (2004). ''Intraspecific reservoirs: complex life history and the persistence of a lethal ranavirus.'' Ecology, 85, 560-566.
  • Chen, Y., Znoiko, S., DeGrip, W. J., Crouch, R. K., and Ma, J.-X. (2008). ''Salamander blue-sensitive cones lost during metamorphosis.'' Photochemistry and Photobiology, 84, 855-862.
  • Church, D. R. (2003). Population Ecology of Ambystoma tigrinum (Caudata: Ambystomatidae) and Occupancy Dynamics in an Appalachian Pond-breeding Amphibian Assemblage. Unpublished Ph. D. dissertation, University of Virginia.
  • Clevenger, A. P., McIvor, M., Chruszcz, B., and Gunson, K. (2001). ''Tiger salamander, Ambystoma tigrinum, movements and mortality on the Trans-Canada highway in southwestern Alberta.'' Canadian Field-Naturalist, 115, 199-204.
  • Collins, J. P., Brunner, J. L., Jancovich, J. K., and Schock, D. M. (2004). ''A model host-pathogen system for studying infectious disease dynamics in amphibians: tiger salamanders (Ambystoma tigrinum) and Ambystoma tigrinum virus.'' Herpetological Journal, 14, 195-200.
  • Collins, J. P., Jones, T. R., and Berna, H. J. (1988). ''Conserving genetically distinctive populations: the case of the Huachuca Tiger Salamander (Ambystoma tigrinum stebbinsi Lowe) .'' Management of Amphibians, Reptiles, and Small Mammals in North America. R. L. Szaso, K. C. Stevenson, and D. R. Patton, eds., U. S. Department of Agriculture/Forestry Service General Technical Report RM-166, Rocky Mountain Forest and Range Experiment Station, Fort Collins, CO.
  • Corn, P. S., Jennings, M. L., and Muths, E. (1997). ''Survey and assessment of amphibian populations in Rocky Mountain National Park.'' Northwestern Naturalist, 78, 34-55.
  • Davidson, E. W., Parris, M., Collins, J. P., Longcore, J. E., Pessier, A. P., and Brunner, J. (2003). ''Pathogenicity and transmission of chytridiomycosis in tiger salamanders (Ambystoma tigrinum).'' Copeia, 2003, 601-607.
  • Fitzpatrick, B. M., Johnson, J. R., Kump, D. K., Smith, J. J., Voss, S. R., and Shaffer, H. B. (2010). ''Rapid spread of invasive genes into a threatened native species.'' Proceedings of the National Academy of Sciences of the USA, 107, 3606-3610.
  • Forson, D. D., and Storfer, A. (2006). ''Atrazine increases ranavirus susceptibility in the tiger salamander Ambystoma tigrinum.'' Ecological Applications , 16, 2325-2332.
  • Green, J. (1825). ''Description of a new species of salamander.'' Journal of the Academy of Natural Sciences of Philadelphia, 5, 116-118.
  • Greer, A. L., Brunner, J. L., and Collins, J. P. (2009). ''Spatial and temporal patterns of Ambystoma tigrinum virus (ATV) prevalence in tiger salamanders Ambystoma tigrinum nebulosum.'' Diseases of Aquatic Organisms, 85, 1-6.
  • Hammerson, G., Shaffer, B., Church, D., Parra-Olea, G., and Wake, D. 2008. Ambystoma tigrinum. In: IUCN 2010. IUCN Red List of Threatened Species. Version 2010.4. . Downloaded on 29 December 2010.
  • Jancovich, J. K., Davidson, E. W., Morado, J. F., Jacobs, B. L., and Collins, J. P. (1997). "Isolation of a lethal virus from the endangered tiger salamander Ambystoma tigrinum stebbinsi." Diseases of Aquatic Organisms, 31(3), 161-167.
  • Jancovich, J. K., Davidson, E. W., Parameswaran, N., Mao, J., Chinchar, V. G., Collins, J. P., Jacobs, B. L., and Storfer, A., (2005). ''Evidence for emergence of an amphibian iridoviral disease because of human-enhanced spread.'' Molecular Ecology, 14, 213-224.
  • Kerby, J. L., and Storfer, A. (2009). ''Combined effects of atrazine and chlorpyrifos on susceptibility of the tiger salamander to Ambystoma tigrinum virus.'' Ecohealth, 6, 91-98.
  • Pfennig, D. W., Loeb, M. L. G., and Collins, J. P. (1991). ''Pathogens as a factor limiting the spread of cannibalism in tiger salamanders .'' Oecologia, 88, 161-166.
  • Picco, A.M., Collins, J.P. (2008). ''Amphibian commerce as a likely source of pathogen pollution.'' Conservation Biology, 22(6), 1582-1589.
  • Richardson, J. S., Klenner, W., and Shatford, J. (1998). ''Tiger Salamanders (Ambystoma tigrinum) in the South Okanagan: effects of cattle grazing, range condition and breeding pond characteristics on habitat use and population ecology.'' Annual progress report prepared for the Habitat Conservation Trust Fund.
  • Riley, S. P. D., Shaffer, H. B., Voss, S. R., and Fitzpatrick, B. M. (2003). ''Hybridization between a rare, native tiger salamander (Ambystoma californiense) and its introduced congener.'' Ecological Applications, 13, 1263-1275.
  • Semlitsch, R. D. (1998). '' Biological delineation of terrestrial buffer zones for pond-breeding salamanders.'' Conservation Biology, 12, 1113-1119.
  • Semlitsch, R. D., Scott, D. E., Pechmann, J. H. K. and Gibbons, J. W (1983). ''Structure and dynamics of an amphibian community: evidence from a 16-year study of a natural pond.'' Long Term Studies of Vertebrate Communities. M. L. Cody and J. A. Smallwood, eds., Academic Press, San Diego, 608-616.
  • Storfer, A., Alfaro, M. E., Ridenhour, B. J., Jancovich, J. K., Mech, S. G., Parris, M. J., and Collins, J. P. (2007). ''Phylogenetic concordance analysis shows an emerging pathogen is novel and endemic.'' Ecology Letters, 10, 1075-1083.
  • Storfer, A., Mech, S. G., Reudink, M. W., Ziemba, R. E., Warren, J., and Collins, J. P. (2004). ''Evidence for introgression in the endangered Sonora tiger salamander, A. tigrinum stebbinsi.'' Copeia, 2004, 783-796.
  • Worthylake, K. M., and Hovingh, P. (1989). ''Mass mortality of salamanders (Ambystoma tigrinum) by bacteria (Acinetobacter) in an oligotrophic seepage mountain lake.'' Great Basin Naturalist, 49, 364-372.
  • Zappalorti, R. T. (1994). Results of a 5-year monitoring study and a translocation, repatriation, and conservation project with the tiger salamander (Ambystoma tigrinum) in southern New Jersey. Herpetological Associates File No. 94.03-B
  • Zeiber, R. A., Sutton, T. M., and Fisher, B. E. (2008). ''Western mosquitofish predation on native amphibian eggs and larvae .'' Journal of Freshwater Ecology, 23, 663-671.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Distribution

Range Description

This species can be found throughout much of the USA, southern Canada to northern Mexico in the Sierra Madre Occidental. It is absent from most of the Great Basin, New England, and the Appalachian mountains. From sea level to around 3,660m asl in the Rocky mountains. Introduced populations occur in central California [not mapped here], where they hybridise with A. californiense (Riley et al., 2003); in the western U.S. populations are sometimes moved in association with the fish bait industry. In Mexico, the species apparently has a limited distribution in the northwest, where its interactions with A. velasci require additional investigation.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

This mole salamander is the largest land dwelling salamander in North America. It also has the greatest range of any other North American salamander, spreading in range from southeastern Alaska east to the southern part of Labrador, and south throughout all of the United States down to the southern edge of the Mexican Plateau (Indiviglio 1997).

Biogeographic Regions: nearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Range extends from portions of southern Canada southward through much of the United States and as far south as Puebla, Mexico. Western populations (regarded by some as A. mavortium) and eastern populations (A. tigrinum) meet in the Great Plains region, where their distributions meld. Tiger salamanders are absent from most of the Great Basin, most of the western United States west of the Rocky Mountains, New England, and the Appalachians. They have been introduced in many localities west of the Rocky Mountains. Elevational range extends to about 3,660 meters (12,000 feet).

See Church et al. (2003) for a map of the county distribution of the eastern tiger salamander.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution and Habitat

A. tigrinum is the most widespread salamander species in North America (Lannoo et al. 1995), ranging from Southern Canada down through the United States and into northern Mexico, at elevations up to 3,660 m asl (Hammerson et al. 2008). Introduced in central California (Riley et al. 2003). Not found in most of the Great Basin, New England, or the Appalachians (Hammerson et al. 2008). Habitat includes bottom land deciduous forests, coniferous forests and woodlands, open fields and bushy areas, alpine and subalpine meadow, grasslands, semideserts and deserts, and (rarely) in streams. Tiger salamanders prefer sandy or friable soils for good breeding ground (Semlitsch 1998).
  • Petranka, J. W. (1998). Salamanders of the United States and Canada. Smithsonian Institution Press, Washington and London.
  • Blair, A. P. (1951). "Notes on the herpetology of the Elk mountains, Colorado." Copeia, 1951, 239-240.
  • Irschick, D.J. and Shaffer, H.B. (1997). ''The polytypic species revisited: Morphological differentiation among tiger salamanders (Ambystoma tigrinum) (Amphibia: Caudata).'' Herpetologica, 53(1), 30-49.
  • Bolker, B. M., de Castro, F., Storfer, A., Mech, S., Harvey, E., and Collins, J. P. (2008). ''Disease as a selective force precluding widespread cannibalism: A case study of an iridovirus of tiger salamanders, Ambystoma tigrinum .'' Evolutionary Ecology Research, 10, 105-128.
  • Bollinger, T. K., Mao, J., Schock, D., Brigham, R. M., and Chinchar, V. G. (1999). ''Pathology, isolation, and preliminary molecular characterization of a novel Iridovirus from tiger salamanders in Saskatchewan.'' Journal of Wildlife Diseases, 35, 413-429.
  • British Columbia Recovery Strategy Series. 2008. Recovery Strategy for the Tiger Salamander (Ambystoma tigrinum), Southern Mountain Population in British Columbia.
  • Brunner, J. L., Schock, D. M., Davidson, E. W., and Collins, J. P. (2004). ''Intraspecific reservoirs: complex life history and the persistence of a lethal ranavirus.'' Ecology, 85, 560-566.
  • Chen, Y., Znoiko, S., DeGrip, W. J., Crouch, R. K., and Ma, J.-X. (2008). ''Salamander blue-sensitive cones lost during metamorphosis.'' Photochemistry and Photobiology, 84, 855-862.
  • Church, D. R. (2003). Population Ecology of Ambystoma tigrinum (Caudata: Ambystomatidae) and Occupancy Dynamics in an Appalachian Pond-breeding Amphibian Assemblage. Unpublished Ph. D. dissertation, University of Virginia.
  • Clevenger, A. P., McIvor, M., Chruszcz, B., and Gunson, K. (2001). ''Tiger salamander, Ambystoma tigrinum, movements and mortality on the Trans-Canada highway in southwestern Alberta.'' Canadian Field-Naturalist, 115, 199-204.
  • Collins, J. P., Brunner, J. L., Jancovich, J. K., and Schock, D. M. (2004). ''A model host-pathogen system for studying infectious disease dynamics in amphibians: tiger salamanders (Ambystoma tigrinum) and Ambystoma tigrinum virus.'' Herpetological Journal, 14, 195-200.
  • Collins, J. P., Jones, T. R., and Berna, H. J. (1988). ''Conserving genetically distinctive populations: the case of the Huachuca Tiger Salamander (Ambystoma tigrinum stebbinsi Lowe) .'' Management of Amphibians, Reptiles, and Small Mammals in North America. R. L. Szaso, K. C. Stevenson, and D. R. Patton, eds., U. S. Department of Agriculture/Forestry Service General Technical Report RM-166, Rocky Mountain Forest and Range Experiment Station, Fort Collins, CO.
  • Corn, P. S., Jennings, M. L., and Muths, E. (1997). ''Survey and assessment of amphibian populations in Rocky Mountain National Park.'' Northwestern Naturalist, 78, 34-55.
  • Davidson, E. W., Parris, M., Collins, J. P., Longcore, J. E., Pessier, A. P., and Brunner, J. (2003). ''Pathogenicity and transmission of chytridiomycosis in tiger salamanders (Ambystoma tigrinum).'' Copeia, 2003, 601-607.
  • Fitzpatrick, B. M., Johnson, J. R., Kump, D. K., Smith, J. J., Voss, S. R., and Shaffer, H. B. (2010). ''Rapid spread of invasive genes into a threatened native species.'' Proceedings of the National Academy of Sciences of the USA, 107, 3606-3610.
  • Forson, D. D., and Storfer, A. (2006). ''Atrazine increases ranavirus susceptibility in the tiger salamander Ambystoma tigrinum.'' Ecological Applications , 16, 2325-2332.
  • Green, J. (1825). ''Description of a new species of salamander.'' Journal of the Academy of Natural Sciences of Philadelphia, 5, 116-118.
  • Greer, A. L., Brunner, J. L., and Collins, J. P. (2009). ''Spatial and temporal patterns of Ambystoma tigrinum virus (ATV) prevalence in tiger salamanders Ambystoma tigrinum nebulosum.'' Diseases of Aquatic Organisms, 85, 1-6.
  • Hammerson, G., Shaffer, B., Church, D., Parra-Olea, G., and Wake, D. 2008. Ambystoma tigrinum. In: IUCN 2010. IUCN Red List of Threatened Species. Version 2010.4. . Downloaded on 29 December 2010.
  • Jancovich, J. K., Davidson, E. W., Morado, J. F., Jacobs, B. L., and Collins, J. P. (1997). "Isolation of a lethal virus from the endangered tiger salamander Ambystoma tigrinum stebbinsi." Diseases of Aquatic Organisms, 31(3), 161-167.
  • Jancovich, J. K., Davidson, E. W., Parameswaran, N., Mao, J., Chinchar, V. G., Collins, J. P., Jacobs, B. L., and Storfer, A., (2005). ''Evidence for emergence of an amphibian iridoviral disease because of human-enhanced spread.'' Molecular Ecology, 14, 213-224.
  • Kerby, J. L., and Storfer, A. (2009). ''Combined effects of atrazine and chlorpyrifos on susceptibility of the tiger salamander to Ambystoma tigrinum virus.'' Ecohealth, 6, 91-98.
  • Pfennig, D. W., Loeb, M. L. G., and Collins, J. P. (1991). ''Pathogens as a factor limiting the spread of cannibalism in tiger salamanders .'' Oecologia, 88, 161-166.
  • Picco, A.M., Collins, J.P. (2008). ''Amphibian commerce as a likely source of pathogen pollution.'' Conservation Biology, 22(6), 1582-1589.
  • Richardson, J. S., Klenner, W., and Shatford, J. (1998). ''Tiger Salamanders (Ambystoma tigrinum) in the South Okanagan: effects of cattle grazing, range condition and breeding pond characteristics on habitat use and population ecology.'' Annual progress report prepared for the Habitat Conservation Trust Fund.
  • Riley, S. P. D., Shaffer, H. B., Voss, S. R., and Fitzpatrick, B. M. (2003). ''Hybridization between a rare, native tiger salamander (Ambystoma californiense) and its introduced congener.'' Ecological Applications, 13, 1263-1275.
  • Semlitsch, R. D. (1998). '' Biological delineation of terrestrial buffer zones for pond-breeding salamanders.'' Conservation Biology, 12, 1113-1119.
  • Semlitsch, R. D., Scott, D. E., Pechmann, J. H. K. and Gibbons, J. W (1983). ''Structure and dynamics of an amphibian community: evidence from a 16-year study of a natural pond.'' Long Term Studies of Vertebrate Communities. M. L. Cody and J. A. Smallwood, eds., Academic Press, San Diego, 608-616.
  • Storfer, A., Alfaro, M. E., Ridenhour, B. J., Jancovich, J. K., Mech, S. G., Parris, M. J., and Collins, J. P. (2007). ''Phylogenetic concordance analysis shows an emerging pathogen is novel and endemic.'' Ecology Letters, 10, 1075-1083.
  • Storfer, A., Mech, S. G., Reudink, M. W., Ziemba, R. E., Warren, J., and Collins, J. P. (2004). ''Evidence for introgression in the endangered Sonora tiger salamander, A. tigrinum stebbinsi.'' Copeia, 2004, 783-796.
  • Worthylake, K. M., and Hovingh, P. (1989). ''Mass mortality of salamanders (Ambystoma tigrinum) by bacteria (Acinetobacter) in an oligotrophic seepage mountain lake.'' Great Basin Naturalist, 49, 364-372.
  • Zappalorti, R. T. (1994). Results of a 5-year monitoring study and a translocation, repatriation, and conservation project with the tiger salamander (Ambystoma tigrinum) in southern New Jersey. Herpetological Associates File No. 94.03-B
  • Zeiber, R. A., Sutton, T. M., and Fisher, B. E. (2008). ''Western mosquitofish predation on native amphibian eggs and larvae .'' Journal of Freshwater Ecology, 23, 663-671.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Adult Length 17-33 cm.

The adult tiger salamander is a thick-bodied creature generally with yellow blotches or spots against a black background. Once in a while there will be one with blotches that are tan or olive green in color. The spots or blotches are never in any set shape, size or position. Actually you may even be able to tell its origin by the color and pattern of the background and/or spots (Indiviglio 1997). A. tigrinum has a rather large head and a broad rounded snout. Their eyes are round. The belly is usually yellowish or olive with invading dark pigment. It has about 12-13 coastal grooves (Harding 1997). Males tend to be proportionally longer, with a more compressed tail and longer stalkier hind legs than the females. During the breeding season the males have a swollen vent area. The larvae have a yellowish green or olive body with the dark blotches and a stripe along each side. They also have a whitish belly. As they grow, specimens tend to be grayish or greenish in color, and within a few weeks they start to show yellow or tan spots and gradually merge into the patterns of the adult bodies (Harding 1997).

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Average mass: 9.402 g.

Average basal metabolic rate: 0.00196 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 35 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

The following pertains to metamorphosed adults. Differs from A. MACRODACTYLUM in lacking a distinct dorsal stripe or stripelike row of spots. Differs from A. GRACILE in having distinct dorsal markings and tubercles on the underside of the feet and by lacking parotoid glands and a glandular ridge on the tail. Differs from A. ANNULATUM in lacking a light grayish stripe along the lower side of the body and generally lacking narrow light bands across the body. Differs from A. MACULATUM and A. OPACUM in having large light blotches on the sides. Differs from A. TALPOIDEUM in having sharply defined spots and usually more than 11 costal grooves (vs. 10-11). Differs from all other North American Ambystoma in having tubercles on the soles of the feet. Differs from plethodontid salamanders in lacking a nasolabial groove.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Holotype for Ambystoma tigrinum
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Locality: Detroit, Wayne, Michigan, United States, North America
  • Holotype: Sager, A. 1839. American Journal of Science and Arts. 36: 323.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Holotype for Ambystoma tigrinum
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Locality: Columbus, Franklin, Ohio, United States, North America
  • Holotype: Cope, E. D. 1868. Proc. Acad. Nat. Sci. Philadelphia. 19: 192.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Ambystoma tigrinum
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Locality: Detroit, Wayne, Michigan, United States, North America
  • Paratype: Sager, A. 1839. American Journal of Science and Arts. 36: 323.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Holotype for Ambystoma tigrinum
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Year Collected: 1885
Locality: Irvington, Marion, Indiana, United States, North America
  • Holotype: Hay, O. P. 1885. Proc. U. S. Nat. Mus. 8 (14): 209.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Holotype for Ambystoma tigrinum
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Locality: Des Moines, Polk, Iowa, United States, North America
  • Holotype: Baird, S. F. 1868. Proc. Acad. Nat. Sci. Philadelphia. 19: 192.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
It can be found in virtually any habitat, providing there is a terrestrial substrate suitable for burrowing and a body of water nearby suitable for breeding. Terrestrial adults usually are underground, in self-made burrows or in those made by rodents, shrews, or other animals. In New York, adults on land used wooded areas and avoided grassy areas (Madison and Farrand 1998). At high elevations in the Rocky Mountains, metamorphosed adults commonly occur in ponds throughout the summer. Eggs are attached to submerged objects or pond bottom. Breeds in a wide range of environments, ranging from clear mountain ponds to temporary, manure-polluted pools in the lowlands. Always breeds in sites where predatory fishes are absent. In the mountains of western Colorado, associated with ponds that have silty bottoms, low alkalinity, and no fishes (Geraghty and Willey 1992). In the southeastern U.S., requires relatively flatwoods ponds that do not contain fishes.

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Fully metamorphosed adults lead a terrestrial existance and, depending upon where in the country they are found, some may inhabit forests, grasslands, or marshy areas (Petranka 1998). Tiger salamanders are less dependent on the forest than most other Ambystomids. One general requirement seems to be soil in which they are able to burrow or in which the burrow of other species of other animals might be utilized (Petranka1998). While they are well suited for terrestrial existence in terms of their skin consistency and thickness, they do need to be able to burrow underground in order to seek the proper humidity levels. Another requirement is that they live close enough for permanent access to ponds and othe small waters for their breeding. During dry periods, large numbers of tiger salamanders have been found lying in piles beneath suitable cover or underground (Indiviglio 1997).

Terrestrial Biomes: forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Tiger salamanders can be found in virtually any habitat, providing there is a terrestrial substrate suitable for burrowing and a body of water nearby suitable for breeding. Terrestrial adults usually are underground, in self-made burrows or in those made by rodents, shrews, or other animals. In New York, adults on land used wooded areas and avoided grassy areas (Madison and Farrand 1998). At high elevations in the Rocky Mountains, metamorphosed adults commonly occur in ponds throughout the summer. Breeding occurs in a wide range of environments, ranging from clear mountain ponds to temporary, manure-polluted pools in the lowlands, generally in sites where predatory fishes are absent. In the mountains of western Colorado, tiger salamanders are associated with ponds that have silty bottoms, low alkalinity, and no fishes (Geraghty and Willey 1992). In the southeastern U.S., this species breeds in open, grassy, usually temporary, ponds (Jensen et al. 2008). Eggs are attached to submerged objects or pond bottoms.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

May migrate up to at least a few hundred meters between breeding and nonbreeding habitats. In New York, all movements occurred in areas within 300 m of the nearest breeding pond (Madison and Farrand 1998). Migrations often coincide with rainfall. Migrations in New York were facultative; some did not emigrate from ponds during the year of breeding (Madison and Farrand 1998).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

The tiger salamander's food source consists of worms, snails, insects, and slugs in the wild; while captive specimens rely on smaller salamanders, frogs, newborn mice, and baby snakes. Tiger salamanders in the wild also tend to eat the same thing as captives, if opportunity presents itself (Indviviglio 1997). The larvae begin feeding on small crustaceans and insect larvae and once grown, they will feast on tadpoles and smaller salamander larvae and even small fish (Harding 1997).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Adults eat any small animal that can be captured and swallowed. Larvae eat aquatic invertebrates and vertebrates (especially amphibian larvae) as available.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

They are efficient predators in their aqautic and subterranean environment, and their prey includes some insect pests.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Tiger salamanders are eaten by badgers, snakes, bobcats, and owls. Larvae are eaten by aquatic insects, the larvae of other salamanders, and snakes.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Ambystoma tigrinum preys on:
Rana sylvatica
Gastropoda
Bivalvia
Ambystoma maculatum
Ambystoma laterale
Ambystoma tremblayi
Dytiscus

Based on studies in:
USA: Michigan (Lake or pond)

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known predators

Ambystoma tigrinum is prey of:
Batracobdella picta

Based on studies in:
USA: Michigan (Lake or pond)

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: > 300

Comments: Many occurrences.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Abundance

>1,000,000 individuals

Comments: Total adult population size is unknown but surely exceeds 1,000,000.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Drying of breeding pond may result in total reproductive failure in some years (Semlitsch 1983). May incur heavy egg predation by eastern newt in some areas. See Worthylake and Hovingh (1989) for information on recurrent mass mortality associated with bacterial infection in mountains of Utah; it was suggested that nitrogen augmentation due in part to sheep grazing may be involved.

In New York, frequent predation occurred in small mammal runways, probably by short-tailed shrews (Madison and Farrand 1998).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Cyclicity

Comments: As in most other land-dwelling amphibians, most terrestrial activity occurs during and after rains; freezing weather and drought inhibit activity.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

Development

Eggs are laid in small pools and hatch within a time period of 19 to 50 days. The larvae remain in the pond until they turn into adults at 2.5 to 5 months of age. Sometimes, adult tiger salamanders remain in the aquatic larval form for their entire lives.

Development - Life Cycle: metamorphosis

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Aquatic adult tiger salamanders live up to 25 years in captivity. Normal adults have reached ages of 16 years.

Range lifespan

Status: captivity:
25 (high) years.

Average lifespan

Status: captivity:
25.0 years.

Average lifespan

Status: captivity:
10.3 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 25 years (captivity) Observations: Age-related changes have been described in the retina of these animals (Townes-Anderson et al. 1998). On average, they may live 12-15 years in the wild (http://www.dec.state.ny.us/).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Ambystoma tigrinum migrates to the breeding ponds in late winter or early spring, usually after a warm rain that thaws out the ground's surface. Males tend to arrive earlier than the females, probably due to the fact that they live closer to the ponds during the winter months. Courtship happens during the night where the males nudge and bump other salamanders. Upon coming across a female, the male will nudge her with his snout to get her away from the other males (Harding 1997). Once away from the other males, the male walks under the females chin, leading her forward and then she nudges his tail and vent area. This behavior stimulates the male to deposit a spermatophore. The female moves her body so that the spermatophore contacts her vent, thus allowing her to take sperm into her cloaca. This behavioral movement continues and produces more spermatophores. The competition for breeding is great in this species and sometimes other males may interupt the courting pairs and replaces the spermatophores with its own. The laying of eggs occurs a night, usually 24-48 hours after the courtship and insemination. They lay the eggs and attach them with twigs, grass stems and leaves that have decayed on the bottom floor of the pond. Each mass can obtain up to 100 eggs (Harding 1997). When large enough, the masses can resemble that of a spotted salamander but the mass of a tiger salamander is less firm and is very fragile if handled. Each female produces anything from 100 to 1000 eggs per season (Harding 1997).

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (Internal ); oviparous

Average time to hatching: 28 days.

Average number of offspring: 37.

Average age at sexual or reproductive maturity (male)

Sex: male:
1460 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
1460 days.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

In general, breeding occurs in spring in the north and at high elevations, in winter in the southern U.S., in late winter/spring and/or summer in the Southwest, and in late winter-early spring in the mid-Atlantic states. Typically the female oviposits within two days after picking up a spermatophore. Individual female deposit up to 1,000 eggs. Eggs hatch in about 2-5 weeks, depending on the temperature. Larvae metamorphose in their first or second summer, or they may not metamorphose at all (become sexually mature as gilled larvae). Reproductive success may be highly dependent on seasonal patterns of rainfall and temperature (Mitchell 1991). In South Carolina, reproductive success varied greatly in different years; little or no recruitment occurred during drought periods (Pechmann et al. 1991). Breeding aggregations may include a few or up to several hundred adults.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Ambystoma tigrinum

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBAP0444-06|NC_006887|Ambystoma tigrinum| ACTCGATGACTATTTTCTACGAATCATAAAGATATTGGTACCCTTTATTTAGTATTTGGTGCTTGAGCCGGAATAGTTGGCACTGCATTA---AGCCTATTAATCCGAGCAGAATTAAGCCAGCCAGGAGCCCTACTAGGGGAC---GATCAGATCTATAATGTTATTGTTACAGCACACGCATTTGTAATAATTTTTTTTATAGTTATGCCTGTAATGATTGGGGGATTTGGAAACTGATTAGTGCCATTAATA---ATTGGCGCACCAGATATAGCCTTCCCCCGTATAAACAATATAAGCTTTTGGCTTCTTCCACCTTCATTCCTCCTTCTATTAGCATCCTCTGGAGTCGAAGCAGGAGCTGGAACGGGATGAACTGTATATCCCCCACTTGCAGGTAACCTAGCCCATGCCGGAGCTTCAGTTGATTTA---ACAATTTTTTCACTTCATTTAGCAGGTGTTTCATCTATCCTAGGTGCAATTAATTTTATTACGACCTCAATTAACATAAAACCTGCATCAATATCACAATATCAAACCCCTTTATTTGTTTGATCAGTATTAATTACAGCAGTTCTTCTGTTACTTTCTCTTCCAGTTTTAGCAGCA---GGAATTACAATACTGCTGACAGATCGAAACTTAAACACAACATTCTTTGATCCTGCTGGAGGAGGTGACCCTGTACTTTATCAACACCTATTTTGATTTTTTGGGCACCCAGAGGTATATATCTTAATTTTACCCGGGTTCGGAATAATTTCACATATTGTAACTTATTATTCTGCAAAAAAA---GAACCATTTGGTTATATAGGAATAGTATGAGCTATAATATCTATTGGCCTATTAGGGTTTATTGTATGAGCACATCATATATTTACAGTAGATTTAA 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Ambystoma tigrinum

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Species: 8
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2004

Assessor/s
Geoffrey Hammerson, Brad Shaffer, Don Church, Gabriela Parra-Olea, David Wake

Reviewer/s
Global Amphibian Assessment Coordinating Team (Simon Stuart, Janice Chanson, Neil Cox and Bruce Young)

Contributor/s

Justification
Listed as Least Concern in view of its wide distribution, tolerance of a broad range of habitats, presumed large population, and because it is unlikely to be declining fast enough to qualify for listing in a more threatened category.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Populations in the southeastern U.S. have been affected by deforestation and loss of wetland habitats and appear to be declining in many areas. According to studies in the Colorado Rockies done by Harte and Hoffman, acid rain may be responsible for this. Other studies indicate that it might not have anything to do with it (Petranka 1998). Other threats for these salamanders are being hit by cars and polluting of their ponds and habitats.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: T5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Intrinsic Vulnerability: Moderately vulnerable

Comments: Populations can recover from drastic declines over a period of a few years, with high recruitment of juveniles. Given normal dispersal distances (see occurrence specifications), recolonization of habitats from which extirpated may be slow to absent if nearby populations within about 0.5-1 km are also extirpated.

Environmental Specificity: Narrow to moderate.

Comments: Species is a generalist with respect to terrestrial habitats, but reproduction is largely dependent on fishless bodies of water.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
This is one of the most abundant Ambystoma species. The total adult population size is unknown but surely exceeds 1,000,000. Tiger salamanders occur throughout their historical range in the Rocky Mountains and Great Plains of Colorado and adjacent states. They remain easy to find and locally abundant in suitable habitat statewide. Ponds often contain up to several thousand larvae. Recent surveys found no evidence of significant declines in distribution or abundance (Corn, Stoltzberg, and Bury 1989; Hammerson 1989a, 1992; Corn, Jennings, and Muths 1997). In the Rocky Mountains, a local decline in numbers over several years, reported by Harte and Hoffman (1989), turned out to be a temporary fluctuation from which the population subsequently recovered (Wissinger and Whiteman 1992). Hovingh (1986) reported that tiger salamanders remain quite common in aquatic systems in glaciated portions of the Uinta Mountains in northeastern Utah. The widespread creation of small, fishless artificial bodies of water has provided much suitable habitat where previously there were little, and these salamanders have been quick to colonize it (Norris 1973; pers. obs.). Populations east of the Appalachians are highly patchy in distribution with several local extirpations having been documented over the past 20 years. Remaining eastern populations are small in size and several are in decline (Church 2003, Semlitsch et al. 1996, Zappalorti 1994). In Mexico this species is generally not uncommon.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Short Term Trend: Relatively stable to decline of 30%

Comments: Populations in the southeastern United States appear to be declining as a result of deforestation and loss of wetland habitats (Petranka 1998), though quantitative information on recent trends is unavailable. See Collins et al. (1988) for information on status of the subspecies STEBBINSI.

Global Long Term Trend: Increase of 10-25% to decline of 50%

Comments: Quantitative information is not available for most areas, but the long-term trend in most areas likely is of relative stability in population attributes. Significant declines likely have occurred mostly in the extensively cultivated regions of the Great Plains and in the southeastern United States where intensive deforestation and drainage of wetlands have occurred.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History, Abundance, Activity, and Special Behaviors

This species tends to breed from November to May, and migrates to breeding ponds on rainy nights. Breeding ponds range from vernal pools to clear montane water bodies to temporary, manure-laden lowland pools. Eggs are deposited en masse and are attached to the pond bottom or to submerged objects. Larvae hatch in 10-21 days. Adults can live up to 20 years in captivity but are thought to survive only 1-3 years in the wild (BCRS 2008).

A cannibalistic larval morph exists but is rare and appears to be constrained by pathogen density; cannibalistic larvae prey on sick conspecifics and thus appear to have an enhanced risk of disease in lakes with periodic bacterial blooms (Pfennig et al. 1991; Bolker et al. 2008).

Aquatic larvae live in shallow water, with bright light, while terrestrial adults usually shelter underground in burrows, either self-constructed or made by rodents or other burrowing animals. Larvae have five different types of photoreceptors (two rod types and three cone types, with cones being sensitive to red, blue or UV light); blue cone photoreceptors are lost during metamorphosis, probably an adaptation to the dim light experienced in the terrestrial phase (Chen et al. 2008).

A. tigrinum has been introduced to central California, where it has been found to hybridize with native A. californiense (Riley et al. 2003; Storfer et al. 2004; Fitpatrick et al. 2010).

  • Petranka, J. W. (1998). Salamanders of the United States and Canada. Smithsonian Institution Press, Washington and London.
  • Blair, A. P. (1951). "Notes on the herpetology of the Elk mountains, Colorado." Copeia, 1951, 239-240.
  • Irschick, D.J. and Shaffer, H.B. (1997). ''The polytypic species revisited: Morphological differentiation among tiger salamanders (Ambystoma tigrinum) (Amphibia: Caudata).'' Herpetologica, 53(1), 30-49.
  • Bolker, B. M., de Castro, F., Storfer, A., Mech, S., Harvey, E., and Collins, J. P. (2008). ''Disease as a selective force precluding widespread cannibalism: A case study of an iridovirus of tiger salamanders, Ambystoma tigrinum .'' Evolutionary Ecology Research, 10, 105-128.
  • Bollinger, T. K., Mao, J., Schock, D., Brigham, R. M., and Chinchar, V. G. (1999). ''Pathology, isolation, and preliminary molecular characterization of a novel Iridovirus from tiger salamanders in Saskatchewan.'' Journal of Wildlife Diseases, 35, 413-429.
  • British Columbia Recovery Strategy Series. 2008. Recovery Strategy for the Tiger Salamander (Ambystoma tigrinum), Southern Mountain Population in British Columbia.
  • Brunner, J. L., Schock, D. M., Davidson, E. W., and Collins, J. P. (2004). ''Intraspecific reservoirs: complex life history and the persistence of a lethal ranavirus.'' Ecology, 85, 560-566.
  • Chen, Y., Znoiko, S., DeGrip, W. J., Crouch, R. K., and Ma, J.-X. (2008). ''Salamander blue-sensitive cones lost during metamorphosis.'' Photochemistry and Photobiology, 84, 855-862.
  • Church, D. R. (2003). Population Ecology of Ambystoma tigrinum (Caudata: Ambystomatidae) and Occupancy Dynamics in an Appalachian Pond-breeding Amphibian Assemblage. Unpublished Ph. D. dissertation, University of Virginia.
  • Clevenger, A. P., McIvor, M., Chruszcz, B., and Gunson, K. (2001). ''Tiger salamander, Ambystoma tigrinum, movements and mortality on the Trans-Canada highway in southwestern Alberta.'' Canadian Field-Naturalist, 115, 199-204.
  • Collins, J. P., Brunner, J. L., Jancovich, J. K., and Schock, D. M. (2004). ''A model host-pathogen system for studying infectious disease dynamics in amphibians: tiger salamanders (Ambystoma tigrinum) and Ambystoma tigrinum virus.'' Herpetological Journal, 14, 195-200.
  • Collins, J. P., Jones, T. R., and Berna, H. J. (1988). ''Conserving genetically distinctive populations: the case of the Huachuca Tiger Salamander (Ambystoma tigrinum stebbinsi Lowe) .'' Management of Amphibians, Reptiles, and Small Mammals in North America. R. L. Szaso, K. C. Stevenson, and D. R. Patton, eds., U. S. Department of Agriculture/Forestry Service General Technical Report RM-166, Rocky Mountain Forest and Range Experiment Station, Fort Collins, CO.
  • Corn, P. S., Jennings, M. L., and Muths, E. (1997). ''Survey and assessment of amphibian populations in Rocky Mountain National Park.'' Northwestern Naturalist, 78, 34-55.
  • Davidson, E. W., Parris, M., Collins, J. P., Longcore, J. E., Pessier, A. P., and Brunner, J. (2003). ''Pathogenicity and transmission of chytridiomycosis in tiger salamanders (Ambystoma tigrinum).'' Copeia, 2003, 601-607.
  • Fitzpatrick, B. M., Johnson, J. R., Kump, D. K., Smith, J. J., Voss, S. R., and Shaffer, H. B. (2010). ''Rapid spread of invasive genes into a threatened native species.'' Proceedings of the National Academy of Sciences of the USA, 107, 3606-3610.
  • Forson, D. D., and Storfer, A. (2006). ''Atrazine increases ranavirus susceptibility in the tiger salamander Ambystoma tigrinum.'' Ecological Applications , 16, 2325-2332.
  • Green, J. (1825). ''Description of a new species of salamander.'' Journal of the Academy of Natural Sciences of Philadelphia, 5, 116-118.
  • Greer, A. L., Brunner, J. L., and Collins, J. P. (2009). ''Spatial and temporal patterns of Ambystoma tigrinum virus (ATV) prevalence in tiger salamanders Ambystoma tigrinum nebulosum.'' Diseases of Aquatic Organisms, 85, 1-6.
  • Hammerson, G., Shaffer, B., Church, D., Parra-Olea, G., and Wake, D. 2008. Ambystoma tigrinum. In: IUCN 2010. IUCN Red List of Threatened Species. Version 2010.4. . Downloaded on 29 December 2010.
  • Jancovich, J. K., Davidson, E. W., Morado, J. F., Jacobs, B. L., and Collins, J. P. (1997). "Isolation of a lethal virus from the endangered tiger salamander Ambystoma tigrinum stebbinsi." Diseases of Aquatic Organisms, 31(3), 161-167.
  • Jancovich, J. K., Davidson, E. W., Parameswaran, N., Mao, J., Chinchar, V. G., Collins, J. P., Jacobs, B. L., and Storfer, A., (2005). ''Evidence for emergence of an amphibian iridoviral disease because of human-enhanced spread.'' Molecular Ecology, 14, 213-224.
  • Kerby, J. L., and Storfer, A. (2009). ''Combined effects of atrazine and chlorpyrifos on susceptibility of the tiger salamander to Ambystoma tigrinum virus.'' Ecohealth, 6, 91-98.
  • Pfennig, D. W., Loeb, M. L. G., and Collins, J. P. (1991). ''Pathogens as a factor limiting the spread of cannibalism in tiger salamanders .'' Oecologia, 88, 161-166.
  • Picco, A.M., Collins, J.P. (2008). ''Amphibian commerce as a likely source of pathogen pollution.'' Conservation Biology, 22(6), 1582-1589.
  • Richardson, J. S., Klenner, W., and Shatford, J. (1998). ''Tiger Salamanders (Ambystoma tigrinum) in the South Okanagan: effects of cattle grazing, range condition and breeding pond characteristics on habitat use and population ecology.'' Annual progress report prepared for the Habitat Conservation Trust Fund.
  • Riley, S. P. D., Shaffer, H. B., Voss, S. R., and Fitzpatrick, B. M. (2003). ''Hybridization between a rare, native tiger salamander (Ambystoma californiense) and its introduced congener.'' Ecological Applications, 13, 1263-1275.
  • Semlitsch, R. D. (1998). '' Biological delineation of terrestrial buffer zones for pond-breeding salamanders.'' Conservation Biology, 12, 1113-1119.
  • Semlitsch, R. D., Scott, D. E., Pechmann, J. H. K. and Gibbons, J. W (1983). ''Structure and dynamics of an amphibian community: evidence from a 16-year study of a natural pond.'' Long Term Studies of Vertebrate Communities. M. L. Cody and J. A. Smallwood, eds., Academic Press, San Diego, 608-616.
  • Storfer, A., Alfaro, M. E., Ridenhour, B. J., Jancovich, J. K., Mech, S. G., Parris, M. J., and Collins, J. P. (2007). ''Phylogenetic concordance analysis shows an emerging pathogen is novel and endemic.'' Ecology Letters, 10, 1075-1083.
  • Storfer, A., Mech, S. G., Reudink, M. W., Ziemba, R. E., Warren, J., and Collins, J. P. (2004). ''Evidence for introgression in the endangered Sonora tiger salamander, A. tigrinum stebbinsi.'' Copeia, 2004, 783-796.
  • Worthylake, K. M., and Hovingh, P. (1989). ''Mass mortality of salamanders (Ambystoma tigrinum) by bacteria (Acinetobacter) in an oligotrophic seepage mountain lake.'' Great Basin Naturalist, 49, 364-372.
  • Zappalorti, R. T. (1994). Results of a 5-year monitoring study and a translocation, repatriation, and conservation project with the tiger salamander (Ambystoma tigrinum) in southern New Jersey. Herpetological Associates File No. 94.03-B
  • Zeiber, R. A., Sutton, T. M., and Fisher, B. E. (2008). ''Western mosquitofish predation on native amphibian eggs and larvae .'' Journal of Freshwater Ecology, 23, 663-671.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
In Mexico it has been observed that in some localities this species can resist conditions of pollution and other kinds of alteration of the environment. Many mountain lakes formerly inhabited by tiger salamanders now have few or none of these amphibians due to the stocking of trout, which easily consume and deplete the larval populations (e.g., Blair 1951; pers. obs.). Geraghty and Willey (1992) found that fish absence was the most important factor influencing tiger salamander presence in Gunnison County and vicinity, and Corn, Jennings, and Muths (1997) reported that trout and tiger salamanders rarely occur together in Rocky Mountain National Park. Trout and tiger salamanders do occasionally coexist in some lakes (Dartt 1879; Blair 1951), but only where vegetated shallows provide habitat not easily accessible to the fishes. Some have suggested that breeding-pond acidification related to atmospheric pollution might cause periodic failure of tiger salamander reproduction in the mountains of Colorado (Harte and Hoffman 1989, 1994). Low pH, even if not fatal to salamander larvae, might result in reduced growth rates and ultimately could diminish salamander populations through decreased survival or feeding success (Kiesecker 1996). However, recent water chemistry data, together with information on acid tolerances of salamander larvae, suggest that eggs and embryos in the wild do not experience harmful levels of acidification (Corn, Stoltzenburg, and Bury 1989; Corn and Vertucci 1992; Wissinger and Whiteman 1992; Vertucci and Corn 1994). Under certain conditions, larval populations might be vulnerable to bacterial infections associated with livestock grazing. In the mountains of Utah, Worthylake and Hovingh (1989) observed recurrent mass mortality of larvae associated a bacterial infection and suggested that increased nitrogen levels due in part to sheep grazing might have been involved. Bryant (1995) observed a mass mortality event in the summer of 1993 that appeared to be associated with an opportunistically pathogenic bacterium. In Arizona, similar die-offs, apparently associated with bacterial pathogens, have been reported (Pfennig, Loeb, and Collins 1991). Cannibal morphs seemed particularly vulnerable, probably due to their feeding on diseased larvae. Again, fecal contamination of ponds by introduced livestock was suggested as a possible cause of the fatal outbreaks. In contrast to these reports, larvae sometimes do thrive in large numbers in manure-laden ponds in Colorado (Hammerson 1999). Nevertheless, die-offs of larvae, apparently associated with pathogenic bacteria, have been observed in Colorado (Hammerson 1999). Populations in the southeastern USA have been detrimentally affected by deforestation and loss of wetland habitats and appear to be declining (Petranka 1998). Population viability analyses of populations in the eastern USA have shown that demographically isolated populations are highly susceptible to extinction, particularly under conditions of high weather variability (Church 2003).
This species is sometimes found in the international pet trade but at levels that do not currently constitute a major threat.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Most remaining populations are exposed to low level threats from habitat loss and degradation, though quantitative information is lacking.

Tiger salamanders occur throughout their historical range in the Rocky Mountains and Great Plains of Colorado and adjacent states. They remain easy to find and locally abundant in suitable habitat statewide. Ponds often contain up to several thousand larvae. Recent surveys found no evidence of significant declines in distribution or abundance (Corn, Stoltzberg, and Bury 1989; Hammerson 1989a, 1992; Corn, Jennings, and Muths 1997). In the Rocky Mountains, a local decline in numbers over several years, reported by Harte and Hoffman (1989), turned out to be a temporary fluctuation from which the population subsequently recovered (Wissinger and Whiteman 1992). Hovingh (1986) reported that tiger salamanders remain quite common in aquatic systems in glaciated portions of the Uinta Mountains in northeastern Utah. The widespread creation of small, fishless artificial bodies of water has provided much suitable habitat where previously there was little, and these salamanders have been quick to colonize it (Norris 1973; pers. obs.).

Many mountain lakes formerly inhabited by tiger salamanders now have few or none of these amphibians due to the stocking of trout, which easily consume and deplete the larval populations (e.g., Blair 1951; pers. obs.). Geraghty and Willey (1992) found that fish absence was the most important factor influencing tiger salamander presence in Gunnison County and vicinity, and Corn, Jennings, and Muths (1997) reported that trout and tiger salamanders rarely occur together in Rocky Mountain National Park. Trout and tiger salamanders do coexist in some lakes (Dartt 1879; Blair 1951), especially where vegetated shallows provide habitat not easily accessible to the fishes. Levi and Levi (1955) surmised that trout may conflict with paedomorphic salamanders but not with metamorphosing populations.

Some have suggested that breeding-pond acidification related to atmospheric pollution may cause periodic failure of tiger salamander reproduction in the mountains of Colorado (Harte and Hoffman 1989, 1994). Low pH, even if not fatal to salamander larvae, may result in reduced growth rates and ultimately could diminish salamander populations through decreased survival or feeding success (Kiesecker 1996). However, recent water chemistry data, together with information on acid tolerances of salamander larvae, suggest that eggs and embryos in the wild do not experience harmful levels of acidification (Corn, Stoltzenburg, and Bury 1989; Corn and Vertucci 1992; Wissinger and Whiteman 1992; Vertucci and Corn 1994).

Under certain conditions, larval populations may be vulnerable to bacterial infections associated with livestock grazing. In the mountains of Utah, Worthylake and Hovingh (1989) observed recurrent mass mortality of larvae associated a bacterial infection and suggested that increased nitrogen levels due in part to sheep grazing may have been involved. Bryant (1995) observed a mass mortality event in the summer of 1993 that appeared to be associated with an opportunistically pathogenic bacterium. In Arizona, similar die-offs, apparently associated with bacterial pathogens, have been reported (Pfennig, Loeb, and Collins 1991). Cannibal morphs seemed particularly vulnerable, probably due to their feeding on diseased larvae. Again, fecal contamination of ponds by introduced livestock was suggested as a possible cause of the fatal outbreaks. In contrast to these reports, larvae sometimes do thrive in large numbers in manure-laden ponds in Colorado (Hammerson 1999). Nevertheless, die-offs of larvae, apparently associated with pathogenic bacteria, have been observed in Colorado (Hammerson 1999).

Infection by chytrid fungus, which has been associated with amphibian declines in several areas, has been observed in southern Arizona. Observations and experiments with salamanders and frogs indicated that chytridiomycosis does not always lead to mortality, individuals within a species vary in susceptibility to infection, animals appear to recover from the infection, and syntopic salamanders and frogs may act as reciprocal pathogen reservoirs for chytrid infections (Davidson et al. 2003).

Populations in the southeastern United States have been detrimentally affected by deforestation and loss of wetland habitats (Petranka 1998). Similarly, populations in the Great Plains have declined in the extensively cultivated portions of the Great Plains.

Local populations commonly incur massive mortality of adults on roads near breeding sites (Clevenger et al. 2001).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History, Abundance, Activity, and Special Behaviors

This species appears to be relatively stable in numbers. A. tigrinum is an adaptable species and can be found in many different habitat types so long as there is a suitable body of water for breeding and a terrestrial substrate that lends itself to burrowing (Hammerson et al. 2008).

Disease is a threat, with salamanders serving as both hosts and reservoirs of pathogens. Recent research has focused on transmission of Bd and ranaviruses (family Iridoviridae) via movement of Ambystoma tigrinum captured for the bait trade (Jancovich et al. 2005; Picco and Collins 2008). A. tigrinum appears to be a carrier of the amphibian fungal pathogen Batrachochytrium dendrobatidis (Bd), as it can be infected by Bd but does not appear to suffer mortality (Davidson et al. 2003).

The ranavirus ATV has been shown to be responsible for epizootics in tiger salamanders in the western cordillera of North America, from Canada (Saskatchewan and Manitoba) to North Dakota, Utah Colorado, and Arizona in the United States (Jancovich et al. 1997, 2005; for map see Storfer et al. 2007). In Canada, mass mortality events in both larval and adult A. tigrinum were observed in four separate ponds in Regina, southern Saskatchewan, in 1997; these die-offs were shown to be due to a highly infectious and virulent iridovirus (Bollinger et al. 1999). Concurrently a die-off at a more distant site 200 km north of Regina was also shown to be due to an iridovirus (Bollinger et al. 1999). In the United States,A. tigrinum die-offs were observed in Utah, Arizona, and Colorado populations, and these die-offs were initially thought to be due to bacterial infections (Worthylake and Hovingh 1989; Pfennig et al. 1991; Hammerson 1999). Arizona populations of A. tigrinum stebbinsi periodically suffered mass mortality events, beginning in 1985, which were also initially ascribed to bacterial infections (Collins et al. 1998). However, examination of dead and dying individuals from an Arizona die-off in 1995 found that a new, highly virulent iridovirus was the cause, and it was named ATV (for "Ambystoma tigrinum virus") (Jancovich et al. 1997). Phylogenetic analysis suggests that the ATV virus is endemic to Arizona populations of A. tigrinum, with strains of higher virulence present in commercially available bait shop larval salamander populations and then transferred into wild salamander populations as infected animals are moved and released (Storfer et al. 2007). Although larvae suffer the greatest mortality, metamorphosed individuals are also susceptible to infection, with juveniles and adults harboring sublethal infections for five months or more and thus capable of transmitting the virus to uninfected salamanders (Brunner et al. 2004; Collins et al. 2004). Exposure to pesticide can increase susceptibility to iridovirus infection in A. tigrinum larvae; the herbicide atrazine both significantly reduced the number of peripheral leukocytes and significantly increased infection rates (Forson and Storfer 2006; Kerby and Storfer 2009). Recent surveys of Arizona populations (Kaibab Plateau) of A. tigrinum found high prevalence of ATV (up to 57% of individuals were infected). The high prevalence of infection without corresponding disease symptoms suggests that either survivors may have evolved tolerance or the virus may have been reduced in virulence (Greer et al. 2009).

Threats other than disease include deforestation and habitat loss and fragmentation in wetland and other areas, as well as pollution of breeding habitat, introduction of predatory fish, and road mortality from vehicles. Habitat loss may cause local extirpations, particularly in eastern populations, which are patchily distributed, small in size, and variably declining (Zappalorti 1994; Semlitsch et al. 1996; Petranka 1998; Church 2003; Hammerson et al. 2008). Threats to aquatic habitat include draining and infilling of ponds and wetlands and water level reduction due to diversion for irrigation, and pollution from pesticides (BCRS 2008). Wetland desiccation, likely due to climate change, has led to decline of this species and other amphibians in Yellowstone National Park (McMenamin et al. 2008). Introduction of predatory fish can be an important cause of declines (see Blair 1951; Corn et al. 1997; Zeiber et al. 2008); trout and tiger salamanders generally do not co-exist unless there are well-vegetated shallows providing refuge from fish, and mosquitofish prey on tiger salamander larvae. Road mortality is a seasonal threat in localities where salamanders must cross busy roads to reach breeding habitat. Mortality may be moderate to severe (Richardson et al. 1998; Clevenger et al. 2001).

Although A. tigrinum is sometimes found in the international pet trade, current pet trade levels do not appear to pose a major threat (Hammerson et al. 2008).

In British Columbia, Canada, its range overlaps with at least two protected areas: South Okanagan Grasslands Provincial Park, White Lake Grasslands Provincial Park (BCRS 2008).

  • Petranka, J. W. (1998). Salamanders of the United States and Canada. Smithsonian Institution Press, Washington and London.
  • Blair, A. P. (1951). "Notes on the herpetology of the Elk mountains, Colorado." Copeia, 1951, 239-240.
  • Irschick, D.J. and Shaffer, H.B. (1997). ''The polytypic species revisited: Morphological differentiation among tiger salamanders (Ambystoma tigrinum) (Amphibia: Caudata).'' Herpetologica, 53(1), 30-49.
  • Bolker, B. M., de Castro, F., Storfer, A., Mech, S., Harvey, E., and Collins, J. P. (2008). ''Disease as a selective force precluding widespread cannibalism: A case study of an iridovirus of tiger salamanders, Ambystoma tigrinum .'' Evolutionary Ecology Research, 10, 105-128.
  • Bollinger, T. K., Mao, J., Schock, D., Brigham, R. M., and Chinchar, V. G. (1999). ''Pathology, isolation, and preliminary molecular characterization of a novel Iridovirus from tiger salamanders in Saskatchewan.'' Journal of Wildlife Diseases, 35, 413-429.
  • British Columbia Recovery Strategy Series. 2008. Recovery Strategy for the Tiger Salamander (Ambystoma tigrinum), Southern Mountain Population in British Columbia.
  • Brunner, J. L., Schock, D. M., Davidson, E. W., and Collins, J. P. (2004). ''Intraspecific reservoirs: complex life history and the persistence of a lethal ranavirus.'' Ecology, 85, 560-566.
  • Chen, Y., Znoiko, S., DeGrip, W. J., Crouch, R. K., and Ma, J.-X. (2008). ''Salamander blue-sensitive cones lost during metamorphosis.'' Photochemistry and Photobiology, 84, 855-862.
  • Church, D. R. (2003). Population Ecology of Ambystoma tigrinum (Caudata: Ambystomatidae) and Occupancy Dynamics in an Appalachian Pond-breeding Amphibian Assemblage. Unpublished Ph. D. dissertation, University of Virginia.
  • Clevenger, A. P., McIvor, M., Chruszcz, B., and Gunson, K. (2001). ''Tiger salamander, Ambystoma tigrinum, movements and mortality on the Trans-Canada highway in southwestern Alberta.'' Canadian Field-Naturalist, 115, 199-204.
  • Collins, J. P., Brunner, J. L., Jancovich, J. K., and Schock, D. M. (2004). ''A model host-pathogen system for studying infectious disease dynamics in amphibians: tiger salamanders (Ambystoma tigrinum) and Ambystoma tigrinum virus.'' Herpetological Journal, 14, 195-200.
  • Collins, J. P., Jones, T. R., and Berna, H. J. (1988). ''Conserving genetically distinctive populations: the case of the Huachuca Tiger Salamander (Ambystoma tigrinum stebbinsi Lowe) .'' Management of Amphibians, Reptiles, and Small Mammals in North America. R. L. Szaso, K. C. Stevenson, and D. R. Patton, eds., U. S. Department of Agriculture/Forestry Service General Technical Report RM-166, Rocky Mountain Forest and Range Experiment Station, Fort Collins, CO.
  • Corn, P. S., Jennings, M. L., and Muths, E. (1997). ''Survey and assessment of amphibian populations in Rocky Mountain National Park.'' Northwestern Naturalist, 78, 34-55.
  • Davidson, E. W., Parris, M., Collins, J. P., Longcore, J. E., Pessier, A. P., and Brunner, J. (2003). ''Pathogenicity and transmission of chytridiomycosis in tiger salamanders (Ambystoma tigrinum).'' Copeia, 2003, 601-607.
  • Fitzpatrick, B. M., Johnson, J. R., Kump, D. K., Smith, J. J., Voss, S. R., and Shaffer, H. B. (2010). ''Rapid spread of invasive genes into a threatened native species.'' Proceedings of the National Academy of Sciences of the USA, 107, 3606-3610.
  • Forson, D. D., and Storfer, A. (2006). ''Atrazine increases ranavirus susceptibility in the tiger salamander Ambystoma tigrinum.'' Ecological Applications , 16, 2325-2332.
  • Green, J. (1825). ''Description of a new species of salamander.'' Journal of the Academy of Natural Sciences of Philadelphia, 5, 116-118.
  • Greer, A. L., Brunner, J. L., and Collins, J. P. (2009). ''Spatial and temporal patterns of Ambystoma tigrinum virus (ATV) prevalence in tiger salamanders Ambystoma tigrinum nebulosum.'' Diseases of Aquatic Organisms, 85, 1-6.
  • Hammerson, G., Shaffer, B., Church, D., Parra-Olea, G., and Wake, D. 2008. Ambystoma tigrinum. In: IUCN 2010. IUCN Red List of Threatened Species. Version 2010.4. . Downloaded on 29 December 2010.
  • Jancovich, J. K., Davidson, E. W., Morado, J. F., Jacobs, B. L., and Collins, J. P. (1997). "Isolation of a lethal virus from the endangered tiger salamander Ambystoma tigrinum stebbinsi." Diseases of Aquatic Organisms, 31(3), 161-167.
  • Jancovich, J. K., Davidson, E. W., Parameswaran, N., Mao, J., Chinchar, V. G., Collins, J. P., Jacobs, B. L., and Storfer, A., (2005). ''Evidence for emergence of an amphibian iridoviral disease because of human-enhanced spread.'' Molecular Ecology, 14, 213-224.
  • Kerby, J. L., and Storfer, A. (2009). ''Combined effects of atrazine and chlorpyrifos on susceptibility of the tiger salamander to Ambystoma tigrinum virus.'' Ecohealth, 6, 91-98.
  • Pfennig, D. W., Loeb, M. L. G., and Collins, J. P. (1991). ''Pathogens as a factor limiting the spread of cannibalism in tiger salamanders .'' Oecologia, 88, 161-166.
  • Picco, A.M., Collins, J.P. (2008). ''Amphibian commerce as a likely source of pathogen pollution.'' Conservation Biology, 22(6), 1582-1589.
  • Richardson, J. S., Klenner, W., and Shatford, J. (1998). ''Tiger Salamanders (Ambystoma tigrinum) in the South Okanagan: effects of cattle grazing, range condition and breeding pond characteristics on habitat use and population ecology.'' Annual progress report prepared for the Habitat Conservation Trust Fund.
  • Riley, S. P. D., Shaffer, H. B., Voss, S. R., and Fitzpatrick, B. M. (2003). ''Hybridization between a rare, native tiger salamander (Ambystoma californiense) and its introduced congener.'' Ecological Applications, 13, 1263-1275.
  • Semlitsch, R. D. (1998). '' Biological delineation of terrestrial buffer zones for pond-breeding salamanders.'' Conservation Biology, 12, 1113-1119.
  • Semlitsch, R. D., Scott, D. E., Pechmann, J. H. K. and Gibbons, J. W (1983). ''Structure and dynamics of an amphibian community: evidence from a 16-year study of a natural pond.'' Long Term Studies of Vertebrate Communities. M. L. Cody and J. A. Smallwood, eds., Academic Press, San Diego, 608-616.
  • Storfer, A., Alfaro, M. E., Ridenhour, B. J., Jancovich, J. K., Mech, S. G., Parris, M. J., and Collins, J. P. (2007). ''Phylogenetic concordance analysis shows an emerging pathogen is novel and endemic.'' Ecology Letters, 10, 1075-1083.
  • Storfer, A., Mech, S. G., Reudink, M. W., Ziemba, R. E., Warren, J., and Collins, J. P. (2004). ''Evidence for introgression in the endangered Sonora tiger salamander, A. tigrinum stebbinsi.'' Copeia, 2004, 783-796.
  • Worthylake, K. M., and Hovingh, P. (1989). ''Mass mortality of salamanders (Ambystoma tigrinum) by bacteria (Acinetobacter) in an oligotrophic seepage mountain lake.'' Great Basin Naturalist, 49, 364-372.
  • Zappalorti, R. T. (1994). Results of a 5-year monitoring study and a translocation, repatriation, and conservation project with the tiger salamander (Ambystoma tigrinum) in southern New Jersey. Herpetological Associates File No. 94.03-B
  • Zeiber, R. A., Sutton, T. M., and Fisher, B. E. (2008). ''Western mosquitofish predation on native amphibian eggs and larvae .'' Journal of Freshwater Ecology, 23, 663-671.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Needed measures include basic habitat protection and policies/regulations that discourage/prohibit the introduction of predatory fishes into habitats where they are not native. Further research on phylogeographic patterns and taxonomic status of major population segments is needed. This species is protected under the category Pr (Special protection) by the Government of Mexico.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Preserve Selection and Design Considerations: Effective protection of breeding populations should include the aquatic fishless breeding site and a terrestrial buffer of at least a couple hundred meters.

Management Requirements: Needed measures include basic habitat protection and policies/regulations that discourage/prohibit the introduction of predatory fishes into habitats where they are not native.

Biological Research Needs: Further research on phylogeographic patterns and taxonomic status of major population segments is needed.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Protection: Very many (>40) occurrences appropriately protected and managed

Comments: Many occurrences currently are adequately managed, but long-term protection is not assurred. This species is protected under the category Pr (Special protection) by the Government of Mexico.

Needs: Needed measures include basic habitat protection and policies/regulations that discourage/prohibit the introduction of predatory fishes into habitats where they are not native.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

The larvae are sometimes considered a nuisance in fish hatcheries. Large larvae will feed on very small fish, but their main effect might be to act as competitors with the fish. As the fish grow larger they can turn the tables and feed on the salamander larvae.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

In some places Ambystoma tigrinum are captured and sold for fish bait (Harding 1997).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Tiger Salamander

The Tiger Salamander (Ambystoma tigrinum) is a species of Mole Salamander. The proper common name is the Eastern Tiger Salamander, to differentiate from other closely related species.

Contents

Description

Eastern tiger salamanders grow to a typical length of 6–8 inches (15–20 cm) .They can reach up to 14 inches (36 cm) in length, particularly neotenic individuals. Adults are usually blotchy with grey, green, or black, and have large, lidded eyes. They have short snouts, thick necks, sturdy legs, and long tails. Their diet consists largely of small insects and worms, though it is not rare for an adult to consume small frogs and baby mice.

Adults are rarely seen in the open and often live in burrows that are usually 2 feet from the surface. Tiger salamanders are almost entirely terrestrial as adults, and usually only return to the water to breed. But also they partly live in both land and water. Although Tiger Salamanders are terrestrial, they are good swimmers. Like all ambystomatids, they are extremely loyal to their birthplace, and will travel long distances to reach it. However, a single tiger salamander has only a 50% chance of breeding more than once in its lifetime. Males nudge a willing female to initiate mating, and then deposit a spermatophore on the lake bottom. The female picks up the packet and deposits the now-fertilized eggs on vegetation. Large-scale captive breeding of Tiger salamanders has not been accomplished, for unknown reasons.

The larvae are entirely aquatic, and are characterized by large external gills and a prominent caudal fin that originates just behind the head. Limbs are fully developed within a short time of hatching. Some larvae, especially in seasonal pools and in the north, may metamorphose as soon as feasible. These are known as small morph adults. Other larvae, especially in ancestral pools and warmer climates, may not metamorphose until fully adult size. These large larvae are usually known as waterdogs, and are used extensively in the fishing bait and pet trade. Some populations may not metamorphose at all, and become sexually mature while in their larval form. These are the neotenes, and are particularly common where terrestrial conditions are bad.

Diseases

Although immune themselves, Tiger Salamanders transmit Batrachochytrium dendrobatidis, which is a major world-wide threat to most frog species through the disease Chytridiomycosis.[1] Tiger Salamanders also carry ranaviruses which infect reptiles, amphibians, and fish. Using Tiger Salamander larvae as fishing bait appears to be a major source of exposure and transport to wild populations. Severe mortality of Tiger Salamander larvae sometimes occurs from recurring ranavirus infections.

Relative species

The California Tiger Salamander (Ambystoma californiense) (listed at Vulnerable),[2] the Barred Tiger Salamander (Ambystoma mavortium), and the Plateau Tiger Salamander (Ambystoma velasci), were all once considered subspecies of A. tigrinum, but are now considered separate species. Genetic studies made it necessary to break up the original A. tigrinum population, even though there is some hybridization between groups.

The Axolotl is also a relative of the Tiger Salamander. Axolotls live in a neotenous state, retaining most characteristics of their larval stage for their entire lifespan. While they never metamorphose under natural conditions, metamorphosis can be induced in them, resulting in a form very similar to the Mexican Tiger Salamander. This is not, however, their natural condition, and dramatically shortens their lifespan.

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: MtDNA data indicate that a vicariant event during the Pleistocene separated tiger salamanders to the east and west of the Apalachicola River (Church et al. 2003). East of the Applachians, there appear to be multiple Pleistocene refugia; populations along the Atlantic Coastal Plain likely were isolated in a coastal plain refugium in the Carolinas (Church et al. 2003). A second refugium may have been in the Blue Ridge Mountains in western Virginia; the now disjunct population in that area may be a relict of a warmer, more widespread fauna that is now restricted to the Coastal Plain (Church et al. 2003).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Ambystoma californiense formerly was regarded as a subspecies of A. tigrinum, but most evidence (morphology, allozymes, mtDNA) supports recognition as a distinct species (see Shaffer and McKnight 1996). See Kraus (1988), Shaffer et al. (1991), and Jones et al. (1993) for phylogenetic analyses of North American Ambystoma; californiense was treated as a full species in these analyses.

Pierce and Mitton (1980) reported substantial changes in allelic composition across a contact zone between subspecies mavortium and nebulosum in Colorado. Collins et al. (1980) speculated that A. tigrinum might actually be a multispecies conglomerate. Jones and Collins (1992) examined variation in polymorphic loci and found no obvious impediments to gene flow within a contact zone between these subspecies in west-central New Mexico.

A range-wide phylogenetic analysis of A. tigrinum and Mexican ambystomatids based on mtDNA data by Shaffer and McKnight (1996) revealed eight "reasonably" well-defined clades from the United States and Mexico; their data suggested that "species boundaries for several U.S. and Mexican species need to be altered and that the concept of a continentally distributed, polytypic tiger salamander is not valid." Irschick and Shaffer (1997) examined morphological variation in larvae of 60 populations of four subspecies of A. tigrinum, plus A. californiense
and A. velasci, and tentatively concluded, despite relatively slight phenotypic differentiation among these populations, that subspecies tigrinum may be a valid taxon at the species level (separate from mavortium), though they acknowledged the problem of a broad zone of intergradation between subspecies tigrinum and mavortium, describing the classification of the intergrade populations as a "vexing and largely unresolved issue." Irschick and Shaffer also found that subspecies mavortium, nebulosum, and melanostictum are almost indistinguishable from one another on the basis on larval morphology. Subsequently, mavortium and tigrinum have not gained wide acceptance as distinct species. Petranka (1998), Hammerson (1999), and Crother et al. (2000, 2003) listed mavortium as a subspecies of A. tigrinum. Crother (2008) listed tigrinum and mavortium as distinct species but did not cite any new evidence supporting this and acknowledged that certain other recent publications regarded these taxa as conspecific.

There is good evidence that subspecies stebbinsi is the result of a past "hybridization" event between subspecies mavortium and nebulosum (see Jones et al. 1988, 1995).

See Fernandez and Collins (1988) for information on color pattern variation in subspecies nebulosum. See Kraus (1985) and Kraus et al. (1991) for information on the involvement of tigrinum in hybridization with other Ambystoma in Michigan. See Lowcock et al. (1987) for a discussion of the nomenclature treatment of hybrids.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!