Physical Description

Type Information

Syntype for Callinectes nitidus Milne-Edwards, 1879
Catalog Number: USNM 20269
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Dry
Locality: Tanesco, Guatemala
  • Syntype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Holotype for Callinectes arcuatus Ordway, 1863
Catalog Number: USNM 61833
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Sex/Stage: male;
Preparation: Alcohol (Ethanol)
Collector(s): J. Xantus
Year Collected: 1911
Locality: Cape San Lucas, Baja California, Mexico, North Pacific Ocean
Vessel: Albatross R/V
  • Holotype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Depth range based on 5 specimens in 1 taxon.

Environmental ranges
  Depth range (m): 1 - 33

Graphical representation

Depth range (m): 1 - 33
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Callinectes arcuatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACACTATATTTTATTTTCGGAGCGTGATCAGGAATAGTGGGAACTTCACTTAGTCTAATTATTCGAGCTGAATTAGGTCAACCAGGAACACTTATTGGAAAC---GACCAAATTTACAATGTAGTTGTCACAGCTCATGCCTTCGTCATGATTTTCTTCATGGTTATACCAATTATAATTGGCGGATTCGGTAATTGACTAGTTCCTCTTATACTAGGAGCTCCTGATATAGCTTTCCCCCGAATGAATAACATAAGGTTTTGACTCCTTCCTCCATCACTTACACTCCTTCTAATAAGAGGTATAGTAGAAAGAGGTGTAGGTACAGGATGAACCGTTTACCCGCCTTTAGCCGCTGCTATTGCTCATGCCGGTGCATCGGTGGATCTTGGTATTTTCTCACTTCATTTGGCGGGTGTCTCATCCATTCTTGGGGCAGTTAATTTCATAACTACAGTTATCAACATGCGATCTTTCGGTATAAGAATGGACCAAATACCTTTATTCGTTTGATCTGTGTTTATTACCGCTATCCTTCTTCTCCTTTCACTGCCTGTTCTAGCTGGAGCTATTACCATGCTGTTAACCGATCGAAACTTGAATACATCATTCTTCGACCCTGCTGGAGGTGGAGACCCTGTATTATATCAACACTTATTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Callinectes arcuatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Callinectes arcuatus

Callinectes arcuatus is a species of swimming crab in the genus Callinectes that lives along the Pacific coast of Central America.

Distribution and ecology[edit]

C. arcuatus is found along the Pacific coast of North and Central America from Mexico southwards.[1] Its diet comprises fish, molluscs, shrimp and plant matter.[2] Occasionally, populations become established in bays in southern California, which are thought to represent single cohorts transported as larvae; these populations typically die out within a few years.[1]

Fishery[edit]

A small fishery for this species is carried out in Costa Rica, run by 10–15 fishermen in the Golfo de Nicoya.[3] The fishery is subject to a maximum of 1600 traps, but the size of caught males was already decreasing in 2009, and the market appeared to be saturated.[3]

Taxonomy[edit]

Callinectes arcuatus was described in 1863 by Albert Ordway in his monograph of the genus Callinectes, using material collected at Cabo San Lucas.[4]

References[edit]

  1. ^ a b Edwin Grosholz (2011). "Crabs". In Daniel Simberloff & Marcel Rejmánek. Encyclopedia of Biological Invasions. Encyclopedias of the Natural World. University of California Press. pp. 125–128. ISBN 978-0-520-26421-2. 
  2. ^ J. R. Cantera & J. F. Blanco (2001). "The estuary ecosystem of Buenaventura Bay, Colombia". In Ulrich Seeliger & Björn Kjerfve. Coastal Marine Ecosystems of Latin America. Ecological Studies: Analysis and Synthesis 144. Springer. pp. 265–280. ISBN 978-3-540-67228-9. 
  3. ^ a b Jorge Cortés & Ingo S. Wehrtmann (2009). "Diversity of marine habitats of the Caribbean and Pacific of Costa Rica". In Ingo S. Wehrtmann & Jorge Cortés. Marine Biodiversity of Costa Rica, Central America. Monographiae Biologicae 86. Springer. pp. 1–45. ISBN 978-1-4020-8277-1. 
  4. ^ Albert Ordway (1863). "Monograph of the genus Callinectes". Boston Journal of Natural History 7: 567–583. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!