Overview

Brief Summary

Description

The Chinese giant salamander is the largest salamander in the world, and is fully aquatic, with many adaptations for this lifestyle. It grows up to 1.8 metres in length, though most individuals found today are considerably smaller (2). The skin is dark brown, black or greenish in colour and irregularly blotched. It is also rough, wrinkled and porous which facilitates respiration through the skin as this large amphibian lacks gills (4). This species has an elongated body, and two pairs of legs which are roughly similar in size. The snout is less rounded than that of the related Japanese giant salamander and the tail is a little longer and broader. Both species have tubercles on the head and throat, though their arrangement is different. The Chinese species has small, paired tubercles arranged in rows parallel with the lower jaw, while the Japanese species' tubercles are mostly single and irregularly scattered (4). The eyes are tiny, with no eyelids, and positioned on top of the broad, flat head, providing the salamander with poor vision (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 2 people

Average rating: 4.0 of 5

Biology

This giant amphibian is generally active at night, when it relies on smell and touch to locate its prey. It lives in muddy, dark rock crevices along riverbanks and feeds on fish, smaller salamanders, worms, insects, crayfish and snails, catching them with a rapid sideways snap of the mouth (2) (5). Like other amphibians, this salamander has smooth skin that lacks scales. The moist skin acts as a respiratory surface, where oxygen enters the body and carbon dioxide is released (4). Mating behaviour has been described for the Japanese giant salamander (Andrias japonicus) and is probably similar for the Chinese giant salamander (4). Reproduction appears to take place from late August to September, when hundreds of individuals congregate at nest sites (4) (6). Males occupy breeding cavities which are aggressively guarded against intruders (6). Males compete viciously, with many dying from injuries (6). Females enter the cavities, lay between 400 and 500 eggs that are held together like a thread of beads and then leave immediately (4) (6). The male fertilises the eggs, and protect them from predators such as fish, until they hatch 12 to 15 weeks later in the early spring (4) (7). The larvae are only three centimetres long and resemble adults in shape. As larvae they do have gills, and though they lose them quite early in life, they never fully lose all larval characteristics. Both the Chinese and Japanese giant salamanders are long lived, with one specimen in captivity living for 52 years (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Description

Heavily built salamander. Head strongly depressed, snout obtusely truncate; nostrils small, rounded, close to the edge of the upper lip and at the corners of the truncated snout, the internasal space less than half of the interorbital space. Eyes small, rounded, dorso-lateral in position, and without eyelid. Top of head more or less flat, with a rounded temporal protuberance above and behind each eye. Vomerine teeth in an arched series starting between the choanae, parallel to the maxillary and premaxillary series. A thin lower labial fold starting about midway between nostril and eye to the angle of the mouth. Trunk less depressed than head, with about fifteen costal grooves, a strong vertebral groove, and strong lateral dermal folds. Legs short and flattened. Tail 59% of the body length, compressed. Dorsal tail fin extending to the trunk. Skin rough and porous, with wrinkles, folds and tubercles. Color of animals is dark brown, black or greenish. Irregularly blotched and marbled with dusky spots. Total length about 100 cm, Chang (1936) quotes a maximum of 180 cm, but most animals found nowadays are considerably smaller (Liu and Liu 1998). Specimens of 115 cm weigh approx. 25 pounds (Liu 1950). Closely related and very similar to A. japonicus. There are no records of geographic variation.

The two species of Andrias - A. davidianus occurring in China and A. japonicus in Japan - are the largest living salamanders, with adults reaching a total length of more than 100 cm. The two species are similar with several features in common. Vomerine teeth located on anterior margin of vomer, parallel with maxillary tooth row; teeth form a long arc. Nasals in contact with maxilla; frontal does not enter external naris. Pterygoid broad, almost in contact with base of maxilla. Hyoid arches cartilaginous. Two pairs of branchial arches. Body large, no spiracle on head; distance between nostrils less than half the distance between the eyes. Tongue large. Tubercles on highly vascular skin. Permanently aquatic.

The Chinese Giant Salamander is very similar to the Japanese Giant Salamander and differs from the latter by the arrangement of tubercles on the head and throat. The tubercles of A. davidianus are mostly in pairs, and much smaller and fewer than those of A. japonicus. The tubercles on the throat are characteristic for each species. In A. davidianus, the very small paired tubercles are arranged in rows parallel with the lower jaw. In A. japonicus they are mostly single and large and irregularly scattered. The snout is less rounded and the tail a little longer in the Chinese species. The colour is darker with large black patches (Chang 1936; Liu 1950; Thorn 1969).

There is a vast body of literature, much of it in Chinese (cf. Ye et al. 1993 and references therein). For this species the name Andrias scheuchzeri (Holl 1831) has been resurrected (Frost, 1999, Amphibian Species of the World, American Museum of Natural History).

See a video of feeding using the gape and suck mechanism (Heiss et al. 2013).

  • Fei, L. (1999). Atlas of Amphibians of China. Henan Publishing House of Science and Technology, Zhengzhou.
  • Haker, K. (1997). "Haltung und Zucht des Chinesischen Riesensalamanders Andrias davidianus." Salamandra, 33, 69-74.
  • Kawamichi, T. and Ueda, H. (1998). ''Spawning at nests of extra-large males in the Giant Salamander Andrias japonicus.'' Journal of Herpetology, 32, 133-136.
  • Liu, C.C. (1950). Amphibians of Western China. Chicago Natural History Museum, Chicago.
  • Liu, G., and Q. Liu (1998). ''Andrias davidianus (Blanchard, 1871).'' China Red Data Book of Endangered Animals. Amphibia and Reptilia. Zhao, E., eds., Science Press, Beijing, China, 30-33.
  • Thorn, R. (1969). Les Salamandres d'Europe, d'Asie, et d'Afrique du Nord. Lechevalier, Paris, France.
  • Ye, C., Fei, L., and Hu, S. Q. (1993). Rare and Economic Amphibians of China. Sichuan Publishing House of Science and Technology, Chengdu.
  • Zhao, E. (1999). ''Distribution patterns of amphibians in temperate East Asia.'' Patterns of Distribution of Amphibians. A Global Perspective. Duellman, W. E., eds., Johns Hopkins University Press, Baltimore, MD, 421-443.
  • Zhao, E. (ed.) (1998). China Red Data Book of Endangered Animals. Amphibia and Reptilia. Science Press, Beijing, China.
  • Chang, M. L. Y. (1936). Contribution à l'étude morphologique, biologique et systèmatique des amphibiens urodèles de la Chine. Librairie Picart, Paris.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

The largest of all amphibian species (sometimes growing to more than one metre in length) this species is widespread in central, south-western and southern China, although its range is now very fragmented. It occurs from 100–1,500 m asl. Records of the species in Taiwan, Province of China, might be the result of introductions.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution and Habitat

The mountain streams of China, from Qinghai to Jiangsu and south to Sichuan, Guanxi and Guangdong. Middle and lower tributaries of the Yangtze river, Huang He (Yellow river) and Zhu Jiang (Pearl river) (Liu and Liu 1998). Finds in Taiwan may be the result of introductions.

The habitat consists of rocky mountain streams and lakes with clear, running water, at moderate altitudes (below 1500 m, especially between 300 and 800 m), where the animals occupy hollows and cavities under water. The salamanders spend their whole lives in water.

  • Fei, L. (1999). Atlas of Amphibians of China. Henan Publishing House of Science and Technology, Zhengzhou.
  • Haker, K. (1997). "Haltung und Zucht des Chinesischen Riesensalamanders Andrias davidianus." Salamandra, 33, 69-74.
  • Kawamichi, T. and Ueda, H. (1998). ''Spawning at nests of extra-large males in the Giant Salamander Andrias japonicus.'' Journal of Herpetology, 32, 133-136.
  • Liu, C.C. (1950). Amphibians of Western China. Chicago Natural History Museum, Chicago.
  • Liu, G., and Q. Liu (1998). ''Andrias davidianus (Blanchard, 1871).'' China Red Data Book of Endangered Animals. Amphibia and Reptilia. Zhao, E., eds., Science Press, Beijing, China, 30-33.
  • Thorn, R. (1969). Les Salamandres d'Europe, d'Asie, et d'Afrique du Nord. Lechevalier, Paris, France.
  • Ye, C., Fei, L., and Hu, S. Q. (1993). Rare and Economic Amphibians of China. Sichuan Publishing House of Science and Technology, Chengdu.
  • Zhao, E. (1999). ''Distribution patterns of amphibians in temperate East Asia.'' Patterns of Distribution of Amphibians. A Global Perspective. Duellman, W. E., eds., Johns Hopkins University Press, Baltimore, MD, 421-443.
  • Zhao, E. (ed.) (1998). China Red Data Book of Endangered Animals. Amphibia and Reptilia. Science Press, Beijing, China.
  • Chang, M. L. Y. (1936). Contribution à l'étude morphologique, biologique et systèmatique des amphibiens urodèles de la Chine. Librairie Picart, Paris.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Central China, the lower reaches of the Yangtze River, the Yellow River and the Pearl River.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Sparreboom, Max; Wu, Yunke

Source: Salamanders of China

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

This species occurs in the mountain streams of China, below 1,500 metres above sea level in the tributaries of the Pearl, Yellow and Yangtze Rivers (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

A large, stout and flat salamander. Head is wide and flat, reaching 1/5–1/4 of the snout-vent length. Paired tubercles are arranged in rows on the head and neck. Snout is rounded with small nostrils near the snout tip. Eyes are small and without eyelid. Mouth is very big. Labial fold is prominent at the posterior of the upper jaw. Tongue adheres to the mouth floor with free lateral margins. Gular fold is present. Thick skin folds are present at the lateral side of the body. There are 12–15 costal grooves. All four limbs are short and stout with skin folds. The salamander has four fingers and five toes with not very prominent interdigital webbing. Tail length is between 59 and 80% of the snout-vent length (Liu, 1950). Dorsal fin of the tail is prominent, whereas ventral fin is only conspicuous near the vent. Females have smooth, non-swollen vent and males have tubercles around their swollen vent (Fei et al., 2006).

Coloration exhibits great variation. Most specimens are dark brown, but individuals can be black, dark red, light brown or earth-toned. There are large irregular dark flecks or blotches on the dorsal and ventral side. Juveniles often have lighter coloration with small black flecks. Albinos (white or golden) have been recorded (Fei et al., 2006).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Sparreboom, Max; Wu, Yunke

Source: Salamanders of China

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

All measurements are from Fei et al. (2006).

Male (2 specimens). Total length: 760–900 mm; snout-vent length: 480–585 mm; Head length: 125–158 mm; Head width: 112–146 mm; forelimb length: 81–93 mm; hind-limb length: 100–125 mm; weight: 2600–4100 g.

Female (8 specimens). Total length: 470–875 mm; snout-vent length: 310–585 mm; Head length: 72–125 mm; Head width: 58–118 mm; forelimb length: 49–85 mm; hind-limb length: 62–113 mm; weight: 400–2800 g.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Sparreboom, Max; Wu, Yunke

Source: Salamanders of China

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Adult total length exceeds 100 cm. Head and body are flat. Tail is laterally compressed. Eyes are very small, on the dorsolateral side of the head. Eyelid is absent. Thick skin folds are present at the lateral side of the body. Tubercles are in pairs and arranged in rows.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Sparreboom, Max; Wu, Yunke

Source: Salamanders of China

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Look Alikes

The Chinese giant salamander is morphologically similar to its sister species, the Japanese giant salamander. The Chinese species has paired tubercles on its head and throat, which are arranged in rows. The Japanese species has single and scattered tubercles.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Sparreboom, Max; Wu, Yunke

Source: Salamanders of China

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
It lives and breeds in large hill streams, usually in forested areas. Females lay approximately 500 eggs in a string in an underwater burrow or cavity that is occupied by a male. Eggs are fertilized externally and are guarded by the male until they hatch after 50-60 days. Larvae then develop in the streams, taking food after about 30 days (Haker 1997).

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Chinese giant salamanders live in cool (under 23 °C) and rapid streams at elevations of 100–1,200 m, but have been found at 4,200 m altitude in Qinghai. They prefer cavities along the riverbanks or under water. Adults live individually in deep water; larvae stay together in crevices at shallower depths. They are mostly nocturnal and feed on aquatic invertebrates (such as crawfish and crabs), fish and frogs (Fei et al., 2006).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Sparreboom, Max; Wu, Yunke

Source: Salamanders of China

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The Chinese giant salamander inhabits cold, fast running mountain streams and lakes, occupying hollows and cavities under water (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 19.9 years (captivity) Observations: Considering the longevity of similar species, it is possible that the maximum lifespan of these animals is considerably underestimated.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Reproductive season is from May to September. Eggs are laid from July to September. After mating, the male cleans the nest in the underwater cavity and the female follows and lays the eggs, which are individually enclosed in the capsule. The egg sac is like a slender string. Egg diameter is 5–8 mm and capsule diameter is 15–17 mm. Clutch size depends on body weight. Females that weigh 0.5–3 kg can lay 300–600 eggs or more. The male guards the eggs until they hatch. Incubation takes 38–40 days under water temperatures of 14–21°C. Hatchlings are 25–31.5 mm in length. External gills disappear when total length reaches 170–220 mm (Fei et al., 2006).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Sparreboom, Max; Wu, Yunke

Source: Salamanders of China

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Evolution and Systematics

Evolution

Cryptobranchid salamanders and the hynobiids form the sister clade (Cryptobranchoidea) to all other extant salamanders excluding the Sirenidae based on complete mitochondrial genome data (Zhang & Wake, 2009).

Murphy et al. (2000) sampled 19 Chinese giant salamanders across their distribution range and found moderate divergence among populations using isozyme electrophoresis and mitochondrial DNA sequences. They did not find phylogeographic patterns that correspond to the three Chinese major river systems.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Sparreboom, Max; Wu, Yunke

Source: Salamanders of China

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physiology and Cell Biology

Physiology

Electrical stimulation of the midbrain evokes calls and secretion of skin glands, which produce milky white, foul-smelling mucus. Other responses include gaping, locomotion and tail lashing (Lan et al., 1990).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Sparreboom, Max; Wu, Yunke

Source: Salamanders of China

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Genetics

Karyotype:

2n=60, 1M, 2M, 3M, 4T, 5T, 6T, 7T, 8T, 9SM, 10T, 11SM, 12ST, 13T, 14T, 15T, 16T, 17M, m (18–30), from Moreacalchi et al. (1982)

2n=60, 1M, 2M, 3M, 4T, 5T, 6T, 7T, 8T, 9M, 10M, 11T, 12ST, 13T, 14T/ST, 15T, 16T, 17M, m (18–30), from Sessions et al. (1982).

M: metacentric; SM: submetacentric; T: telocentric; ST: subtelocentric

The mitochondrial genome has been sequenced by Zhang et al. (2003).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Sparreboom, Max; Wu, Yunke

Source: Salamanders of China

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology

Barcode data: Andrias davidianus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGATAATTACTCGATGATTATTTTCAACAAATCATAAAGATATTGGCACCCTATATTTAGTATTCGGTGCTTGAGCTGGAATAGTTGGTACTGCCTTAAGTCTATTAATTCGAGCAGAATTAAGTCAGCCTGGGACTTTACTTGGTGATGATCAAATTTATAATGTTATCGTAACAGCCCATGCCTTTGTGATAATTTTTTTTATGGTAATGCCAATTATAATCGGCGGCTTTGGCAATTGGCTCGTTCCATTAATAATTGGCGCCCCAGATATGGCCTTTCCTCGTATAAATAATATAAGCTTTTGATTACTTCCTCCATCCTTTTTATTATTACTGGCGTCCTCCGGTATTGAAGCAGGTGCCGGGACCGGATGAACAGTTTACCCGCCTCTGGCTAGTAATTTAGCCCACGCAGGAGCTTCTGTTGATCTTACAATTTTTTCACTTCACCTAGCTGGTGTTTCATCAATTCTTGGGGCAATTAATTTTATTACTACTTCAATTAATATAAAACCTCCAGCTATGACACAATATCAGACCCCTTTGTTTGTCTGATCCGTATTAATTACAGCAATTTTGCTATTGTTATCTCTCCCAGTACTAGCTGCTGGTATTACTATGCTATTAACAGACCGTAATCTTAATACAACTTTCTTTGATCCATCTGGAGGAGGTGACCCTGTCTTATATCAACACCTTTTCTGATTTTTTGGACATCCTGAGGTGTATATTTTAATTCTCCCAGGTTTTGGTATAATTTCGCATATTGTCACATATTATTCTGCCAAAAAAGAACCATTCGGCTATATAGGAATGGTGTGAGCAATAATATCTATTGGTTTATTAGGCTTTATTGTATGAGCACATCATATGTTTACAGTTGACCTTAATGTAGATACTCGAGCCTACTTTACATCAGCTACAATAATTATTGCAATTCCAACCGGTGTTAAAGTATTCAGCTGATTAGCAACAATGCACGGCGGATCTATTAAATGAGACGCCGCAATACTTTGGGCTTTAGGATTTATTTTCCTATTCACTGTTGGCGGACTCACAGGAATTGTATTAGCAAATTCATCATTAGACATTGTATTACATGATACGTATTATGTTGTAGCCCATTTCCACTATGTTTTATCAATAGGAGCTGTATTTGCCATCATAGGCGGATTTGTACATTGATTCCCTCTTTTTTCAGGCTATACACTTCATGCTACGTGGTCAAAAATTCATTTTGGAGTAATATTTCTAGGAGTTAATTTAACATTCTTCCCTCAACATTTTCTAGGCTTGGCCGGCATACCACGTCGCTATTCAGACTACCCAGATGCCTATACCTTATGAAACACTGTCTCATCAATCGGATCCTTAATTTCCATAATTGCCGTGGTAATAATTATATTTATTATCTGAGAAGCATTTTCAGCTAAACGTGAGATCTCCACAACTGATTTAAGCTCTACAAATGTTGAATGACTACACGGCTGCCCCCCTCCACATCATACATATGAAGAGCCTTCATATGTTCAAACACGCGCAAACTAA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Andrias davidianus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
CR
Critically Endangered

Red List Criteria
A2ad

Version
3.1

Year Assessed
2004

Assessor/s
Liang Gang, Geng Baorong, Zhao Ermi

Reviewer/s
Global Amphibian Assessment Coordinating Team (Simon Stuart, Janice Chanson and Neil Cox)

Contributor/s

Justification
Listed as Critically Endangered because of an observed drastic population decline, estimated to be more than 80% over the last three generations, due to over-exploitation. The generation length is estimated to be 15 years.

History
  • 1996
    Data Deficient
    (Baillie and Groombridge 1996)
  • 1996
    Data Deficient
  • 1994
    Indeterminate
    (Groombridge 1994)
  • 1990
    Indeterminate
    (IUCN 1990)
  • 1988
    Indeterminate
    (IUCN Conservation Monitoring Centre 1988)
  • 1986
    Indeterminate
    (IUCN Conservation Monitoring Centre 1986)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Current Listing Status Summary

Status: Endangered
Date Listed: 06/14/1976
Lead Region: Foreign (Region 10) 
Where Listed: Entire


Population detail:

Population location: Entire
Listing status: E

For most current information and documents related to the conservation status and management of Andrias davidianus, see its USFWS Species Profile

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Listed on CITES Appendix I. Class II state major protected wildlife species in China. Critically endangered under IUCN (2010). The wild populations were harvested heavily in the 1980s for their meat, which is considered a valuable delicacy. Deforestation also destroyed natural habitat at the upper reaches of rivers. Population size in the wild shrinks tremendously. Although many natural reserves have been established to protect this species, wild animals are rarely seen now. On the other hand, salamander farms are increasing in numbers and succeed in artificial breeding. But the purpose of farming is to supply the market and not to restock wild populations.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Sparreboom, Max; Wu, Yunke

Source: Salamanders of China

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

Classified as Critically Endangered (CR) on the IUCN Red List 2007 (1), and listed on Appendix I of CITES (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
This species was once reasonably common but has declined catastrophically over the last 30 years, principally due to over-exploitation, and it is now very rare, with few surviving populations known.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History, Abundance, Activity, and Special Behaviors

The female lays approximately 500 eggs in a string in an underwater cavity, occupied by a male. The eggs measure on average 22 mm by 19.2 mm; the diameter of the embryo is 8-9 mm. Eggs are fertilized externally and are guarded by the male, until they hatch after 50-60 days at a length of 30 mm. Larvae start eating after 30 days; reduction of gills begins when the larvae are 200-250 mm total length (Haker 1997). The larvae have longer gills than those of A. japonicus, fingers and toes are more pointed and the colour is darker. The larva resembles the adult in shape.

Mating behavior has been described for A. japonicus (Kawamichi and Ueda 1998) and probably is similar for A. davidianus. In the reproductive season, which appears to fall in August-September, the male occupies a breeding cavity, which he aggressively guards against intruders. Females enter the cavity and leave it directly after spawning. The male fertilizes the eggs and guards them until they hatch after about 50-60 days.

  • Fei, L. (1999). Atlas of Amphibians of China. Henan Publishing House of Science and Technology, Zhengzhou.
  • Haker, K. (1997). "Haltung und Zucht des Chinesischen Riesensalamanders Andrias davidianus." Salamandra, 33, 69-74.
  • Kawamichi, T. and Ueda, H. (1998). ''Spawning at nests of extra-large males in the Giant Salamander Andrias japonicus.'' Journal of Herpetology, 32, 133-136.
  • Liu, C.C. (1950). Amphibians of Western China. Chicago Natural History Museum, Chicago.
  • Liu, G., and Q. Liu (1998). ''Andrias davidianus (Blanchard, 1871).'' China Red Data Book of Endangered Animals. Amphibia and Reptilia. Zhao, E., eds., Science Press, Beijing, China, 30-33.
  • Thorn, R. (1969). Les Salamandres d'Europe, d'Asie, et d'Afrique du Nord. Lechevalier, Paris, France.
  • Ye, C., Fei, L., and Hu, S. Q. (1993). Rare and Economic Amphibians of China. Sichuan Publishing House of Science and Technology, Chengdu.
  • Zhao, E. (1999). ''Distribution patterns of amphibians in temperate East Asia.'' Patterns of Distribution of Amphibians. A Global Perspective. Duellman, W. E., eds., Johns Hopkins University Press, Baltimore, MD, 421-443.
  • Zhao, E. (ed.) (1998). China Red Data Book of Endangered Animals. Amphibia and Reptilia. Science Press, Beijing, China.
  • Chang, M. L. Y. (1936). Contribution à l'étude morphologique, biologique et systèmatique des amphibiens urodèles de la Chine. Librairie Picart, Paris.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Commercial over-exploitation for human consumption is the main threat to this species. It has also suffered from habitat destruction (e.g., from the construction of dams) and habitat degradation (e.g., water pollution from mines). Although there is commercial farming of this species, the vast majority of Chinese Giant Salamanders being traded are believed to originate from the wild.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History, Abundance, Activity, and Special Behaviors

Not only have populations become smaller and fragmented, the individuals captured are smaller than they used to be, most probably as a result of over-collecting (Liu and Liu 1998). There are no data on abundance in English.

  • Fei, L. (1999). Atlas of Amphibians of China. Henan Publishing House of Science and Technology, Zhengzhou.
  • Haker, K. (1997). "Haltung und Zucht des Chinesischen Riesensalamanders Andrias davidianus." Salamandra, 33, 69-74.
  • Kawamichi, T. and Ueda, H. (1998). ''Spawning at nests of extra-large males in the Giant Salamander Andrias japonicus.'' Journal of Herpetology, 32, 133-136.
  • Liu, C.C. (1950). Amphibians of Western China. Chicago Natural History Museum, Chicago.
  • Liu, G., and Q. Liu (1998). ''Andrias davidianus (Blanchard, 1871).'' China Red Data Book of Endangered Animals. Amphibia and Reptilia. Zhao, E., eds., Science Press, Beijing, China, 30-33.
  • Thorn, R. (1969). Les Salamandres d'Europe, d'Asie, et d'Afrique du Nord. Lechevalier, Paris, France.
  • Ye, C., Fei, L., and Hu, S. Q. (1993). Rare and Economic Amphibians of China. Sichuan Publishing House of Science and Technology, Chengdu.
  • Zhao, E. (1999). ''Distribution patterns of amphibians in temperate East Asia.'' Patterns of Distribution of Amphibians. A Global Perspective. Duellman, W. E., eds., Johns Hopkins University Press, Baltimore, MD, 421-443.
  • Zhao, E. (ed.) (1998). China Red Data Book of Endangered Animals. Amphibia and Reptilia. Science Press, Beijing, China.
  • Chang, M. L. Y. (1936). Contribution à l'étude morphologique, biologique et systèmatique des amphibiens urodèles de la Chine. Librairie Picart, Paris.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

This species is threatened by hunting, as its flesh is considered a delicacy in Asia. Other threats include habitat alteration and loss; deforestation causes soil erosion and increased runoff and silting in rivers. The building of dams in China over the years has also changed the natural river flow in some areas where the Chinese giant salamander is found. Local pesticides, fertilizers and pollutants are also thought to affect the health of this amphibian, though little research has been conducted. Symptoms of these recent threats include the lower numbers of Chinese giant salamander recorded, smaller populations and also smaller individuals (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
In China, this species is listed as a Class II state major protected wildlife species. It occurs, or at least used to occur, in many nature reserves within its range, and some nature reserves even use the species as their main conservation target, such as Zhangjiajie Giant Salamander Nature Reserve. Captive rearing of animals has achieved some success, but these projects are mainly to meet the market demand. It is not clear whether or not animals are actually being bred in captivity. It is listed on CITES Appendix I.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

The Chinese giant salamander is now protected from international trade by its listing on Appendix I of the Convention of International Trade of Endangered Species (CITES) (3). Since the 1980s, 14 nature reserves, with a total area of more than 355,000 hectares, have been established for the conservation of the Chinese giant salamander (7). This includes the a huge 99,975 hectare area of Mount Wuyi, China was designated as a World Heritage Site in 1999, dedicated to conserving this biodiverse region, including the habitat of this salamander (8). The surrounding area has a growing population and the establishment of this reserve will protect many species. However, there are still concerns that development around the reserve, and tourism plans within the reserve will place pressure on Mount Wuyi's rich resources, healthy rivers and habitats. Conservation efforts to protect this habitat and other areas where the ancient Chinese giant salamander is found are essential for the survival of this species and many others (8).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Uses

The meat is considered a delicacy and is sold for high prices. It is used as a traditional Chinese medicine and supposedly helps to reduce anemia. The skin can be tanned to leather (Fei et al., 2006).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Sparreboom, Max; Wu, Yunke

Source: Salamanders of China

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Risks

Relation to Humans

The Giant Salamander is considered to be a delicacy and collected for culinary and commercial purposes. Captive breeding has proved to be possible. Breeding farms were established in Hunan, Shaanxi, Jiangxi and other provinces since the early 1970s (Liu and Liu 1998) but there are insufficient data about the results. It is doubtful if commercial farming will be able to alleviate the pressure on natural populations. Breeding has been achieved in Europe (Haker 1997). The European experience and the Japanese results with Andrias japonicus could help Chinese farms to improve their results.

  • Fei, L. (1999). Atlas of Amphibians of China. Henan Publishing House of Science and Technology, Zhengzhou.
  • Haker, K. (1997). "Haltung und Zucht des Chinesischen Riesensalamanders Andrias davidianus." Salamandra, 33, 69-74.
  • Kawamichi, T. and Ueda, H. (1998). ''Spawning at nests of extra-large males in the Giant Salamander Andrias japonicus.'' Journal of Herpetology, 32, 133-136.
  • Liu, C.C. (1950). Amphibians of Western China. Chicago Natural History Museum, Chicago.
  • Liu, G., and Q. Liu (1998). ''Andrias davidianus (Blanchard, 1871).'' China Red Data Book of Endangered Animals. Amphibia and Reptilia. Zhao, E., eds., Science Press, Beijing, China, 30-33.
  • Thorn, R. (1969). Les Salamandres d'Europe, d'Asie, et d'Afrique du Nord. Lechevalier, Paris, France.
  • Ye, C., Fei, L., and Hu, S. Q. (1993). Rare and Economic Amphibians of China. Sichuan Publishing House of Science and Technology, Chengdu.
  • Zhao, E. (1999). ''Distribution patterns of amphibians in temperate East Asia.'' Patterns of Distribution of Amphibians. A Global Perspective. Duellman, W. E., eds., Johns Hopkins University Press, Baltimore, MD, 421-443.
  • Zhao, E. (ed.) (1998). China Red Data Book of Endangered Animals. Amphibia and Reptilia. Science Press, Beijing, China.
  • Chang, M. L. Y. (1936). Contribution à l'étude morphologique, biologique et systèmatique des amphibiens urodèles de la Chine. Librairie Picart, Paris.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Chinese giant salamander

The Chinese giant salamander (Andrias davidianus) is the largest salamander and largest amphibian in the world, reaching a length of 180 cm (5.9 ft), although it rarely—if ever—reaches that size today. It is endemic to rocky, mountain streams and lakes in China. It also occurs in Taiwan, probably as a result of introduction.[3] It is considered critically endangered due to habitat loss, pollution, and overcollection, as it is considered a delicacy and used in traditional Chinese medicine. It has been listed as one of the top 10 "focal species" in 2008 by the Evolutionarily Distinct and Globally Endangered (EDGE) project.

Description and behavior[edit]

Portrait of a ~30-year-old animal

It has a large head, small eyes, and dark and wrinkly skin. It is one of only two extant species in the genus Andrias, the other being the slightly smaller, but otherwise very similar Japanese giant salamander (Andrias japonicus). The Chinese giant salamander feeds on insects, frogs, crabs, shrimp, and fish. It has very poor eyesight, so depends on special sensory nodes that run in a line on the creature's body, from head to tail. They are capable of sensing the slightest vibrations around them with the help of these nodes.[4] The female lays 400–500 eggs in an underwater breeding cavity, which is guarded by the male until the eggs hatch after 50–60 days.[3] The average adult salamander weighs 25–30 kg (55–66 lb) and is 115 cm (3.77 ft) in length.[5]

The giant salamander is known to vocalize, making barking, whining, hissing, or crying sounds.[6] Some of these vocalizations bear a striking resemblance to the crying of a young human child, and as such it is known in the Chinese language as "infant fish" (娃娃鱼 / 鲵).[7]

The Chinese giant salamander is the largest known amphibian species, reaching lengths of up to 180 cm (5.9 ft), although it rarely—if ever—reaches that size today.[3] It can weigh up to 80 lb.[citation needed] Its natural range has suffered in the past few decades due to habitat loss and overharvesting. Consequently, many salamanders are now farmed in mesocosms across China. Furthermore, previously built concrete dams that destroyed the salamander’s habitat are now fitted with stairs so the animal can easily navigate the dam and make it back to its niche.

Distribution and habitat[edit]

The Chinese giant salamander was widespread in central, south-western and southern China, but its range is now highly fragmented.[1] Its range spans the area from Qinghai east to Jiangsu and south to Sichuan, Guangxi and Guangdong; notably in the basins of the Yangtze, Yellow and Pearl Rivers.[3] Finds in Taiwan may be the result of introduction.[1]

The Chinese giant salamander is entirely aquatic and lives in rocky hill streams and lakes with clear water.[3] It is usually found in forested regions.[1] It is found at altitudes of 100 to 1,500 m (330 to 4,920 ft),[1] with most records between 300 and 800 m (980 and 2,620 ft).[3]

In captivity[edit]

As of early 2008, ISIS records only show five individuals held in US zoos (Zoo Atlanta, Cincinnati Zoo, and Saint Louis Zoological Park), and an additional four in European zoos (Zoo Dresden and Rotterdam Zoo).[8] A medium-sized specimen, approximately 3 ft (0.91 m) long, was kept for several years at the Steinhart Aquarium in San Francisco, California, and now is on display again in the "Water Planet" section of the new California Academy of Sciences building.[9] There are also two in residence at the Los Angeles Zoo. Additional individuals are likely kept in non-ISIS zoos and animals parks in its native China, such as Shanghai Zoo. Several of them are kept in the aquaria of Shanghai and Xian. It has been bred in captivity, but whether this can be achieved to an extent where the pressure on the wild populations is reduced is doubtful.[3]

Since May 2014 thirty-three Chinese giant salamanders including three adults have been held in Prague Zoo. The main attraction is the largest specimen in Europe.[10]

Taxonomy[edit]

The correct scientific name of this species has been argued to be Andrias scheuchzeri (in which case Andrias davidianus would be a junior synonym) – a name otherwise restricted to an extinct species described from Swiss fossils.[11]

Decline in population[edit]

Chinese giant salamanders for sale in a restaurant in Hongqiao Town (虹桥镇) in Zhejiang, China: The price was 880 CNY/jin, or about 215 EUR/kg or $US280/kg. This places Chinese giant salamanders firmly in the luxury food segment and makes them an attractive target for poaching.

In the past, the Chinese giant salamander was fairly common and widespread in China.[1] Since the 1950s, the population has declined rapidly due to habitat destruction and overhunting. It has been listed as Critically Endangered in the Chinese Red Book of Amphibians and Reptiles. Despite the Chinese Government listing the salamander as a Class II Protected Species, 100 salamanders are hunted illegally every year in the Hupingshan Natural Nature Reserve alone. Since the 1980's, 14 nature reserves have been established as an effort to conserve the species. Despite this, the population continues to decline with the salamanders becoming increasingly difficult to find.

References[edit]

  1. ^ a b c d e f Liang Gang, Geng Baorong, Zhao Ermi (2004). "Andrias davidianus". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 6 April 2014. 
  2. ^ "Amphibian Species of the World – Andrias davidianus (Blanchard, 1871)". Research.amnh.org. Retrieved 2010-02-04. 
  3. ^ a b c d e f g Andrias davidianus -Amphibiaweb
  4. ^ "World's Weirdest Creatures". Noeman.org. Retrieved 2010-02-04. 
  5. ^ Wood, The Guinness Book of Animal Facts and Feats. Sterling Pub Co Inc (1983), ISBN 978-0-85112-235-9
  6. ^ Stebbins, Robert C.; Cohen, Nathan W. (1997), A Natural History of Amphibians, Princeton University Press, ISBN 978-0-691-10251-1 
  7. ^ Largest Base for Endangered Giant Salamander Underway, Xinhua News Agency, 2006-08-18 
  8. ^ Andrias davidianus in zoos – ISIS
  9. ^ "Exhibits of the California Academy of Sciences". Calacademy.org. Retrieved 2010-02-04. 
  10. ^ Novinky.cz – Zoo Praha ukáže největšího velemloka v Evropě
  11. ^ Amphibian Species of the World 5.2. Genus Andrias. Retrieved 2008-12-28.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!