Overview

Brief Summary

Description

The Chinese giant salamander is the largest salamander in the world, and is fully aquatic, with many adaptations for this lifestyle. It grows up to 1.8 metres in length, though most individuals found today are considerably smaller (2). The skin is dark brown, black or greenish in colour and irregularly blotched. It is also rough, wrinkled and porous which facilitates respiration through the skin as this large amphibian lacks gills (4). This species has an elongated body, and two pairs of legs which are roughly similar in size. The snout is less rounded than that of the related Japanese giant salamander and the tail is a little longer and broader. Both species have tubercles on the head and throat, though their arrangement is different. The Chinese species has small, paired tubercles arranged in rows parallel with the lower jaw, while the Japanese species' tubercles are mostly single and irregularly scattered (4). The eyes are tiny, with no eyelids, and positioned on top of the broad, flat head, providing the salamander with poor vision (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 2 people

Average rating: 4.0 of 5

Biology

This giant amphibian is generally active at night, when it relies on smell and touch to locate its prey. It lives in muddy, dark rock crevices along riverbanks and feeds on fish, smaller salamanders, worms, insects, crayfish and snails, catching them with a rapid sideways snap of the mouth (2) (5). Like other amphibians, this salamander has smooth skin that lacks scales. The moist skin acts as a respiratory surface, where oxygen enters the body and carbon dioxide is released (4). Mating behaviour has been described for the Japanese giant salamander (Andrias japonicus) and is probably similar for the Chinese giant salamander (4). Reproduction appears to take place from late August to September, when hundreds of individuals congregate at nest sites (4) (6). Males occupy breeding cavities which are aggressively guarded against intruders (6). Males compete viciously, with many dying from injuries (6). Females enter the cavities, lay between 400 and 500 eggs that are held together like a thread of beads and then leave immediately (4) (6). The male fertilises the eggs, and protect them from predators such as fish, until they hatch 12 to 15 weeks later in the early spring (4) (7). The larvae are only three centimetres long and resemble adults in shape. As larvae they do have gills, and though they lose them quite early in life, they never fully lose all larval characteristics. Both the Chinese and Japanese giant salamanders are long lived, with one specimen in captivity living for 52 years (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Description

Heavily built salamander. Head strongly depressed, snout obtusely truncate; nostrils small, rounded, close to the edge of the upper lip and at the corners of the truncated snout, the internasal space less than half of the interorbital space. Eyes small, rounded, dorso-lateral in position, and without eyelid. Top of head more or less flat, with a rounded temporal protuberance above and behind each eye. Vomerine teeth in an arched series starting between the choanae, parallel to the maxillary and premaxillary series. A thin lower labial fold starting about midway between nostril and eye to the angle of the mouth. Trunk less depressed than head, with about fifteen costal grooves, a strong vertebral groove, and strong lateral dermal folds. Legs short and flattened. Tail 59% of the body length, compressed. Dorsal tail fin extending to the trunk. Skin rough and porous, with wrinkles, folds and tubercles. Color of animals is dark brown, black or greenish. Irregularly blotched and marbled with dusky spots. Total length about 100 cm, Chang (1936) quotes a maximum of 180 cm, but most animals found nowadays are considerably smaller (Liu and Liu 1998). Specimens of 115 cm weigh approx. 25 pounds (Liu 1950). Closely related and very similar to A. japonicus. There are no records of geographic variation.

The two species of Andrias - A. davidianus occurring in China and A. japonicus in Japan - are the largest living salamanders, with adults reaching a total length of more than 100 cm. The two species are similar with several features in common. Vomerine teeth located on anterior margin of vomer, parallel with maxillary tooth row; teeth form a long arc. Nasals in contact with maxilla; frontal does not enter external naris. Pterygoid broad, almost in contact with base of maxilla. Hyoid arches cartilaginous. Two pairs of branchial arches. Body large, no spiracle on head; distance between nostrils less than half the distance between the eyes. Tongue large. Tubercles on highly vascular skin. Permanently aquatic.

The Chinese Giant Salamander is very similar to the Japanese Giant Salamander and differs from the latter by the arrangement of tubercles on the head and throat. The tubercles of A. davidianus are mostly in pairs, and much smaller and fewer than those of A. japonicus. The tubercles on the throat are characteristic for each species. In A. davidianus, the very small paired tubercles are arranged in rows parallel with the lower jaw. In A. japonicus they are mostly single and large and irregularly scattered. The snout is less rounded and the tail a little longer in the Chinese species. The colour is darker with large black patches (Chang 1936; Liu 1950; Thorn 1969).

There is a vast body of literature, much of it in Chinese (cf. Ye et al. 1993 and references therein). For this species the name Andrias scheuchzeri (Holl 1831) has been resurrected (Frost, 1999, Amphibian Species of the World, American Museum of Natural History).

See a video of feeding using the gape and suck mechanism (Heiss et al. 2013).

  • Chang, M. L. Y. (1936). Contribution à l'étude morphologique, biologique et systèmatique des amphibiens urodèles de la Chine. Librairie Picart, Paris.
  • Fei, L. (1999). Atlas of Amphibians of China. Henan Publishing House of Science and Technology, Zhengzhou.
  • Haker, K. (1997). "Haltung und Zucht des Chinesischen Riesensalamanders Andrias davidianus." Salamandra, 33, 69-74.
  • Kawamichi, T. and Ueda, H. (1998). ''Spawning at nests of extra-large males in the Giant Salamander Andrias japonicus.'' Journal of Herpetology, 32, 133-136.
  • Liu, C.C. (1950). Amphibians of Western China. Chicago Natural History Museum, Chicago.
  • Liu, G., and Q. Liu (1998). ''Andrias davidianus (Blanchard, 1871).'' China Red Data Book of Endangered Animals. Amphibia and Reptilia. Zhao, E., eds., Science Press, Beijing, China, 30-33.
  • Thorn, R. (1969). Les Salamandres d'Europe, d'Asie, et d'Afrique du Nord. Lechevalier, Paris, France.
  • Ye, C., Fei, L., and Hu, S. Q. (1993). Rare and Economic Amphibians of China. Sichuan Publishing House of Science and Technology, Chengdu.
  • Zhao, E. (1999). ''Distribution patterns of amphibians in temperate East Asia.'' Patterns of Distribution of Amphibians. A Global Perspective. Duellman, W. E., eds., Johns Hopkins University Press, Baltimore, MD, 421-443.
  • Zhao, E. (ed.) (1998). China Red Data Book of Endangered Animals. Amphibia and Reptilia. Science Press, Beijing, China.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

The largest of all amphibian species (sometimes growing to more than one metre in length) this species is widespread in central, south-western and southern China, although its range is now very fragmented. It occurs from 100–1,500 m asl. Records of the species in Taiwan, Province of China, might be the result of introductions.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution and Habitat

The mountain streams of China, from Qinghai to Jiangsu and south to Sichuan, Guanxi and Guangdong. Middle and lower tributaries of the Yangtze river, Huang He (Yellow river) and Zhu Jiang (Pearl river) (Liu and Liu 1998). Finds in Taiwan may be the result of introductions.

The habitat consists of rocky mountain streams and lakes with clear, running water, at moderate altitudes (below 1500 m, especially between 300 and 800 m), where the animals occupy hollows and cavities under water. The salamanders spend their whole lives in water.

  • Chang, M. L. Y. (1936). Contribution à l'étude morphologique, biologique et systèmatique des amphibiens urodèles de la Chine. Librairie Picart, Paris.
  • Fei, L. (1999). Atlas of Amphibians of China. Henan Publishing House of Science and Technology, Zhengzhou.
  • Haker, K. (1997). "Haltung und Zucht des Chinesischen Riesensalamanders Andrias davidianus." Salamandra, 33, 69-74.
  • Kawamichi, T. and Ueda, H. (1998). ''Spawning at nests of extra-large males in the Giant Salamander Andrias japonicus.'' Journal of Herpetology, 32, 133-136.
  • Liu, C.C. (1950). Amphibians of Western China. Chicago Natural History Museum, Chicago.
  • Liu, G., and Q. Liu (1998). ''Andrias davidianus (Blanchard, 1871).'' China Red Data Book of Endangered Animals. Amphibia and Reptilia. Zhao, E., eds., Science Press, Beijing, China, 30-33.
  • Thorn, R. (1969). Les Salamandres d'Europe, d'Asie, et d'Afrique du Nord. Lechevalier, Paris, France.
  • Ye, C., Fei, L., and Hu, S. Q. (1993). Rare and Economic Amphibians of China. Sichuan Publishing House of Science and Technology, Chengdu.
  • Zhao, E. (1999). ''Distribution patterns of amphibians in temperate East Asia.'' Patterns of Distribution of Amphibians. A Global Perspective. Duellman, W. E., eds., Johns Hopkins University Press, Baltimore, MD, 421-443.
  • Zhao, E. (ed.) (1998). China Red Data Book of Endangered Animals. Amphibia and Reptilia. Science Press, Beijing, China.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Central China, the lower reaches of the Yangtze River, the Yellow River and the Pearl River.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Sparreboom, Max; Wu, Yunke

Source: Salamanders of China

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

This species occurs in the mountain streams of China, below 1,500 metres above sea level in the tributaries of the Pearl, Yellow and Yangtze Rivers (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

A large, stout and flat salamander. Head is wide and flat, reaching 1/5–1/4 of the snout-vent length. Paired tubercles are arranged in rows on the head and neck. Snout is rounded with small nostrils near the snout tip. Eyes are small and without eyelid. Mouth is very big. Labial fold is prominent at the posterior of the upper jaw. Tongue adheres to the mouth floor with free lateral margins. Gular fold is present. Thick skin folds are present at the lateral side of the body. There are 12–15 costal grooves. All four limbs are short and stout with skin folds. The salamander has four fingers and five toes with not very prominent interdigital webbing. Tail length is between 59 and 80% of the snout-vent length (Liu, 1950). Dorsal fin of the tail is prominent, whereas ventral fin is only conspicuous near the vent. Females have smooth, non-swollen vent and males have tubercles around their swollen vent (Fei et al., 2006).

Coloration exhibits great variation. Most specimens are dark brown, but individuals can be black, dark red, light brown or earth-toned. There are large irregular dark flecks or blotches on the dorsal and ventral side. Juveniles often have lighter coloration with small black flecks. Albinos (white or golden) have been recorded (Fei et al., 2006).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Sparreboom, Max; Wu, Yunke

Source: Salamanders of China

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

All measurements are from Fei et al. (2006).

Male (2 specimens). Total length: 760–900 mm; snout-vent length: 480–585 mm; Head length: 125–158 mm; Head width: 112–146 mm; forelimb length: 81–93 mm; hind-limb length: 100–125 mm; weight: 2600–4100 g.

Female (8 specimens). Total length: 470–875 mm; snout-vent length: 310–585 mm; Head length: 72–125 mm; Head width: 58–118 mm; forelimb length: 49–85 mm; hind-limb length: 62–113 mm; weight: 400–2800 g.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Sparreboom, Max; Wu, Yunke

Source: Salamanders of China

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Adult total length exceeds 100 cm. Head and body are flat. Tail is laterally compressed. Eyes are very small, on the dorsolateral side of the head. Eyelid is absent. Thick skin folds are present at the lateral side of the body. Tubercles are in pairs and arranged in rows.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Sparreboom, Max; Wu, Yunke

Source: Salamanders of China

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Look Alikes

The Chinese giant salamander is morphologically similar to its sister species, the Japanese giant salamander. The Chinese species has paired tubercles on its head and throat, which are arranged in rows. The Japanese species has single and scattered tubercles.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Sparreboom, Max; Wu, Yunke

Source: Salamanders of China

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
It lives and breeds in large hill streams, usually in forested areas. Females lay approximately 500 eggs in a string in an underwater burrow or cavity that is occupied by a male. Eggs are fertilized externally and are guarded by the male until they hatch after 50-60 days. Larvae then develop in the streams, taking food after about 30 days (Haker 1997).

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Chinese giant salamanders live in cool (under 23 °C) and rapid streams at elevations of 100–1,200 m, but have been found at 4,200 m altitude in Qinghai. They prefer cavities along the riverbanks or under water. Adults live individually in deep water; larvae stay together in crevices at shallower depths. They are mostly nocturnal and feed on aquatic invertebrates (such as crawfish and crabs), fish and frogs (Fei et al., 2006).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Sparreboom, Max; Wu, Yunke

Source: Salamanders of China

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The Chinese giant salamander inhabits cold, fast running mountain streams and lakes, occupying hollows and cavities under water (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 19.9 years (captivity) Observations: Considering the longevity of similar species, it is possible that the maximum lifespan of these animals is considerably underestimated.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Reproductive season is from May to September. Eggs are laid from July to September. After mating, the male cleans the nest in the underwater cavity and the female follows and lays the eggs, which are individually enclosed in the capsule. The egg sac is like a slender string. Egg diameter is 5–8 mm and capsule diameter is 15–17 mm. Clutch size depends on body weight. Females that weigh 0.5–3 kg can lay 300–600 eggs or more. The male guards the eggs until they hatch. Incubation takes 38–40 days under water temperatures of 14–21°C. Hatchlings are 25–31.5 mm in length. External gills disappear when total length reaches 170–220 mm (Fei et al., 2006).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Sparreboom, Max; Wu, Yunke

Source: Salamanders of China

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Evolution and Systematics

Evolution

Cryptobranchid salamanders and the hynobiids form the sister clade (Cryptobranchoidea) to all other extant salamanders excluding the Sirenidae based on complete mitochondrial genome data (Zhang & Wake, 2009).

Murphy et al. (2000) sampled 19 Chinese giant salamanders across their distribution range and found moderate divergence among populations using isozyme electrophoresis and mitochondrial DNA sequences. They did not find phylogeographic patterns that correspond to the three Chinese major river systems.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Sparreboom, Max; Wu, Yunke

Source: Salamanders of China

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physiology and Cell Biology

Physiology

Electrical stimulation of the midbrain evokes calls and secretion of skin glands, which produce milky white, foul-smelling mucus. Other responses include gaping, locomotion and tail lashing (Lan et al., 1990).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Sparreboom, Max; Wu, Yunke

Source: Salamanders of China

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Genetics

Karyotype:

2n=60, 1M, 2M, 3M, 4T, 5T, 6T, 7T, 8T, 9SM, 10T, 11SM, 12ST, 13T, 14T, 15T, 16T, 17M, m (18–30), from Moreacalchi et al. (1982)

2n=60, 1M, 2M, 3M, 4T, 5T, 6T, 7T, 8T, 9M, 10M, 11T, 12ST, 13T, 14T/ST, 15T, 16T, 17M, m (18–30), from Sessions et al. (1982).

M: metacentric; SM: submetacentric; T: telocentric; ST: subtelocentric

The mitochondrial genome has been sequenced by Zhang et al. (2003).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Sparreboom, Max; Wu, Yunke

Source: Salamanders of China

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology

Barcode data: Andrias davidianus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGATAATTACTCGATGATTATTTTCAACAAATCATAAAGATATTGGCACCCTATATTTAGTATTCGGTGCTTGAGCTGGAATAGTTGGTACTGCCTTAAGTCTATTAATTCGAGCAGAATTAAGTCAGCCTGGGACTTTACTTGGTGATGATCAAATTTATAATGTTATCGTAACAGCCCATGCCTTTGTGATAATTTTTTTTATGGTAATGCCAATTATAATCGGCGGCTTTGGCAATTGGCTCGTTCCATTAATAATTGGCGCCCCAGATATGGCCTTTCCTCGTATAAATAATATAAGCTTTTGATTACTTCCTCCATCCTTTTTATTATTACTGGCGTCCTCCGGTATTGAAGCAGGTGCCGGGACCGGATGAACAGTTTACCCGCCTCTGGCTAGTAATTTAGCCCACGCAGGAGCTTCTGTTGATCTTACAATTTTTTCACTTCACCTAGCTGGTGTTTCATCAATTCTTGGGGCAATTAATTTTATTACTACTTCAATTAATATAAAACCTCCAGCTATGACACAATATCAGACCCCTTTGTTTGTCTGATCCGTATTAATTACAGCAATTTTGCTATTGTTATCTCTCCCAGTACTAGCTGCTGGTATTACTATGCTATTAACAGACCGTAATCTTAATACAACTTTCTTTGATCCATCTGGAGGAGGTGACCCTGTCTTATATCAACACCTTTTCTGATTTTTTGGACATCCTGAGGTGTATATTTTAATTCTCCCAGGTTTTGGTATAATTTCGCATATTGTCACATATTATTCTGCCAAAAAAGAACCATTCGGCTATATAGGAATGGTGTGAGCAATAATATCTATTGGTTTATTAGGCTTTATTGTATGAGCACATCATATGTTTACAGTTGACCTTAATGTAGATACTCGAGCCTACTTTACATCAGCTACAATAATTATTGCAATTCCAACCGGTGTTAAAGTATTCAGCTGATTAGCAACAATGCACGGCGGATCTATTAAATGAGACGCCGCAATACTTTGGGCTTTAGGATTTATTTTCCTATTCACTGTTGGCGGACTCACAGGAATTGTATTAGCAAATTCATCATTAGACATTGTATTACATGATACGTATTATGTTGTAGCCCATTTCCACTATGTTTTATCAATAGGAGCTGTATTTGCCATCATAGGCGGATTTGTACATTGATTCCCTCTTTTTTCAGGCTATACACTTCATGCTACGTGGTCAAAAATTCATTTTGGAGTAATATTTCTAGGAGTTAATTTAACATTCTTCCCTCAACATTTTCTAGGCTTGGCCGGCATACCACGTCGCTATTCAGACTACCCAGATGCCTATACCTTATGAAACACTGTCTCATCAATCGGATCCTTAATTTCCATAATTGCCGTGGTAATAATTATATTTATTATCTGAGAAGCATTTTCAGCTAAACGTGAGATCTCCACAACTGATTTAAGCTCTACAAATGTTGAATGACTACACGGCTGCCCCCCTCCACATCATACATATGAAGAGCCTTCATATGTTCAAACACGCGCAAACTAA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Andrias davidianus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
CR
Critically Endangered

Red List Criteria
A2ad

Version
3.1

Year Assessed
2004

Assessor/s
Liang Gang, Geng Baorong, Zhao Ermi

Reviewer/s
Global Amphibian Assessment Coordinating Team (Simon Stuart, Janice Chanson and Neil Cox)

Contributor/s

Justification
Listed as Critically Endangered because of an observed drastic population decline, estimated to be more than 80% over the last three generations, due to over-exploitation. The generation length is estimated to be 15 years.

History
  • 1996
    Data Deficient
    (Baillie and Groombridge 1996)
  • 1996
    Data Deficient
  • 1994
    Indeterminate
    (Groombridge 1994)
  • 1990
    Indeterminate
    (IUCN 1990)
  • 1988
    Indeterminate
    (IUCN Conservation Monitoring Centre 1988)
  • 1986
    Indeterminate
    (IUCN Conservation Monitoring Centre 1986)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Current Listing Status Summary

Status: Endangered
Date Listed: 06/14/1976
Lead Region: Foreign (Region 10) 
Where Listed: Entire


Population detail:

Population location: Entire
Listing status: E

For most current information and documents related to the conservation status and management of Andrias davidianus, see its USFWS Species Profile

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Listed on CITES Appendix I. Class II state major protected wildlife species in China. Critically endangered under IUCN (2010). The wild populations were harvested heavily in the 1980s for their meat, which is considered a valuable delicacy. Deforestation also destroyed natural habitat at the upper reaches of rivers. Population size in the wild shrinks tremendously. Although many natural reserves have been established to protect this species, wild animals are rarely seen now. On the other hand, salamander farms are increasing in numbers and succeed in artificial breeding. But the purpose of farming is to supply the market and not to restock wild populations.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Sparreboom, Max; Wu, Yunke

Source: Salamanders of China

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

Classified as Critically Endangered (CR) on the IUCN Red List 2007 (1), and listed on Appendix I of CITES (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
This species was once reasonably common but has declined catastrophically over the last 30 years, principally due to over-exploitation, and it is now very rare, with few surviving populations known.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History, Abundance, Activity, and Special Behaviors

The female lays approximately 500 eggs in a string in an underwater cavity, occupied by a male. The eggs measure on average 22 mm by 19.2 mm; the diameter of the embryo is 8-9 mm. Eggs are fertilized externally and are guarded by the male, until they hatch after 50-60 days at a length of 30 mm. Larvae start eating after 30 days; reduction of gills begins when the larvae are 200-250 mm total length (Haker 1997). The larvae have longer gills than those of A. japonicus, fingers and toes are more pointed and the colour is darker. The larva resembles the adult in shape.

Mating behavior has been described for A. japonicus (Kawamichi and Ueda 1998) and probably is similar for A. davidianus. In the reproductive season, which appears to fall in August-September, the male occupies a breeding cavity, which he aggressively guards against intruders. Females enter the cavity and leave it directly after spawning. The male fertilizes the eggs and guards them until they hatch after about 50-60 days.

  • Chang, M. L. Y. (1936). Contribution à l'étude morphologique, biologique et systèmatique des amphibiens urodèles de la Chine. Librairie Picart, Paris.
  • Fei, L. (1999). Atlas of Amphibians of China. Henan Publishing House of Science and Technology, Zhengzhou.
  • Haker, K. (1997). "Haltung und Zucht des Chinesischen Riesensalamanders Andrias davidianus." Salamandra, 33, 69-74.
  • Kawamichi, T. and Ueda, H. (1998). ''Spawning at nests of extra-large males in the Giant Salamander Andrias japonicus.'' Journal of Herpetology, 32, 133-136.
  • Liu, C.C. (1950). Amphibians of Western China. Chicago Natural History Museum, Chicago.
  • Liu, G., and Q. Liu (1998). ''Andrias davidianus (Blanchard, 1871).'' China Red Data Book of Endangered Animals. Amphibia and Reptilia. Zhao, E., eds., Science Press, Beijing, China, 30-33.
  • Thorn, R. (1969). Les Salamandres d'Europe, d'Asie, et d'Afrique du Nord. Lechevalier, Paris, France.
  • Ye, C., Fei, L., and Hu, S. Q. (1993). Rare and Economic Amphibians of China. Sichuan Publishing House of Science and Technology, Chengdu.
  • Zhao, E. (1999). ''Distribution patterns of amphibians in temperate East Asia.'' Patterns of Distribution of Amphibians. A Global Perspective. Duellman, W. E., eds., Johns Hopkins University Press, Baltimore, MD, 421-443.
  • Zhao, E. (ed.) (1998). China Red Data Book of Endangered Animals. Amphibia and Reptilia. Science Press, Beijing, China.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Commercial over-exploitation for human consumption is the main threat to this species. It has also suffered from habitat destruction (e.g., from the construction of dams) and habitat degradation (e.g., water pollution from mines). Although there is commercial farming of this species, the vast majority of Chinese Giant Salamanders being traded are believed to originate from the wild.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History, Abundance, Activity, and Special Behaviors

Not only have populations become smaller and fragmented, the individuals captured are smaller than they used to be, most probably as a result of over-collecting (Liu and Liu 1998). There are no data on abundance in English.

  • Chang, M. L. Y. (1936). Contribution à l'étude morphologique, biologique et systèmatique des amphibiens urodèles de la Chine. Librairie Picart, Paris.
  • Fei, L. (1999). Atlas of Amphibians of China. Henan Publishing House of Science and Technology, Zhengzhou.
  • Haker, K. (1997). "Haltung und Zucht des Chinesischen Riesensalamanders Andrias davidianus." Salamandra, 33, 69-74.
  • Kawamichi, T. and Ueda, H. (1998). ''Spawning at nests of extra-large males in the Giant Salamander Andrias japonicus.'' Journal of Herpetology, 32, 133-136.
  • Liu, C.C. (1950). Amphibians of Western China. Chicago Natural History Museum, Chicago.
  • Liu, G., and Q. Liu (1998). ''Andrias davidianus (Blanchard, 1871).'' China Red Data Book of Endangered Animals. Amphibia and Reptilia. Zhao, E., eds., Science Press, Beijing, China, 30-33.
  • Thorn, R. (1969). Les Salamandres d'Europe, d'Asie, et d'Afrique du Nord. Lechevalier, Paris, France.
  • Ye, C., Fei, L., and Hu, S. Q. (1993). Rare and Economic Amphibians of China. Sichuan Publishing House of Science and Technology, Chengdu.
  • Zhao, E. (1999). ''Distribution patterns of amphibians in temperate East Asia.'' Patterns of Distribution of Amphibians. A Global Perspective. Duellman, W. E., eds., Johns Hopkins University Press, Baltimore, MD, 421-443.
  • Zhao, E. (ed.) (1998). China Red Data Book of Endangered Animals. Amphibia and Reptilia. Science Press, Beijing, China.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

This species is threatened by hunting, as its flesh is considered a delicacy in Asia. Other threats include habitat alteration and loss; deforestation causes soil erosion and increased runoff and silting in rivers. The building of dams in China over the years has also changed the natural river flow in some areas where the Chinese giant salamander is found. Local pesticides, fertilizers and pollutants are also thought to affect the health of this amphibian, though little research has been conducted. Symptoms of these recent threats include the lower numbers of Chinese giant salamander recorded, smaller populations and also smaller individuals (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
In China, this species is listed as a Class II state major protected wildlife species. It occurs, or at least used to occur, in many nature reserves within its range, and some nature reserves even use the species as their main conservation target, such as Zhangjiajie Giant Salamander Nature Reserve. Captive rearing of animals has achieved some success, but these projects are mainly to meet the market demand. It is not clear whether or not animals are actually being bred in captivity. It is listed on CITES Appendix I.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

The Chinese giant salamander is now protected from international trade by its listing on Appendix I of the Convention of International Trade of Endangered Species (CITES) (3). Since the 1980s, 14 nature reserves, with a total area of more than 355,000 hectares, have been established for the conservation of the Chinese giant salamander (7). This includes the a huge 99,975 hectare area of Mount Wuyi, China was designated as a World Heritage Site in 1999, dedicated to conserving this biodiverse region, including the habitat of this salamander (8). The surrounding area has a growing population and the establishment of this reserve will protect many species. However, there are still concerns that development around the reserve, and tourism plans within the reserve will place pressure on Mount Wuyi's rich resources, healthy rivers and habitats. Conservation efforts to protect this habitat and other areas where the ancient Chinese giant salamander is found are essential for the survival of this species and many others (8).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Uses

The meat is considered a delicacy and is sold for high prices. It is used as a traditional Chinese medicine and supposedly helps to reduce anemia. The skin can be tanned to leather (Fei et al., 2006).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Sparreboom, Max; Wu, Yunke

Source: Salamanders of China

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Risks

Relation to Humans

The Giant Salamander is considered to be a delicacy and collected for culinary and commercial purposes. Captive breeding has proved to be possible. Breeding farms were established in Hunan, Shaanxi, Jiangxi and other provinces since the early 1970s (Liu and Liu 1998) but there are insufficient data about the results. It is doubtful if commercial farming will be able to alleviate the pressure on natural populations. Breeding has been achieved in Europe (Haker 1997). The European experience and the Japanese results with Andrias japonicus could help Chinese farms to improve their results.

  • Chang, M. L. Y. (1936). Contribution à l'étude morphologique, biologique et systèmatique des amphibiens urodèles de la Chine. Librairie Picart, Paris.
  • Fei, L. (1999). Atlas of Amphibians of China. Henan Publishing House of Science and Technology, Zhengzhou.
  • Haker, K. (1997). "Haltung und Zucht des Chinesischen Riesensalamanders Andrias davidianus." Salamandra, 33, 69-74.
  • Kawamichi, T. and Ueda, H. (1998). ''Spawning at nests of extra-large males in the Giant Salamander Andrias japonicus.'' Journal of Herpetology, 32, 133-136.
  • Liu, C.C. (1950). Amphibians of Western China. Chicago Natural History Museum, Chicago.
  • Liu, G., and Q. Liu (1998). ''Andrias davidianus (Blanchard, 1871).'' China Red Data Book of Endangered Animals. Amphibia and Reptilia. Zhao, E., eds., Science Press, Beijing, China, 30-33.
  • Thorn, R. (1969). Les Salamandres d'Europe, d'Asie, et d'Afrique du Nord. Lechevalier, Paris, France.
  • Ye, C., Fei, L., and Hu, S. Q. (1993). Rare and Economic Amphibians of China. Sichuan Publishing House of Science and Technology, Chengdu.
  • Zhao, E. (1999). ''Distribution patterns of amphibians in temperate East Asia.'' Patterns of Distribution of Amphibians. A Global Perspective. Duellman, W. E., eds., Johns Hopkins University Press, Baltimore, MD, 421-443.
  • Zhao, E. (ed.) (1998). China Red Data Book of Endangered Animals. Amphibia and Reptilia. Science Press, Beijing, China.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Chinese giant salamander

The Chinese giant salamander (Andrias davidianus) is the largest salamander and largest amphibian in the world, reaching a length of 180 cm (6 ft), although it rarely—if ever—reaches that size today. It is endemic to rocky, mountain streams and lakes in China. It also occurs in Taiwan, probably as a result of introduction.[3] It is considered critically endangered due to habitat loss, pollution, and overcollection, as it is considered a delicacy and used in traditional Chinese medicine. It has been listed as one of the top 10 "focal species" in 2008 by the Evolutionarily Distinct and Globally Endangered (EDGE) project. The Chinese giant salamander is considered to be a “living fossil.”[4] This species is classified as critically endangered in the IUCN Red List because of a massive population decline of more than 80% since the 1950s.[5]

Taxonomy[edit]

The correct scientific name of this species has been argued to be Andrias scheuchzeri (in which case Andrias davidianus would be a junior synonym) – a name otherwise restricted to an extinct species described from Swiss fossils.[6] It has also been given the moniker of “living fossil” for being part of the Cryptobranchidae family which dates back 170 million years.[4] It is one of only three extant species of the family, the others being the slightly smaller, but otherwise very similar Japanese giant salamander (Andrias japonicus), and the far smaller North American hellbender (Cryptobranchus alleganiensis).

Description[edit]

Portrait of a 30-year-old animal

It has a large head, small eyes, and dark and wrinkly skin. Its flat, broad head has a wide mouth, round, lidless eyes and the dark wrinkly skin has blotchy spots, and a line of pair tubercles that run around its head and throat.[7] Their color ranges from dark brown to light orange.

The average adult salamander weighs 25–30 kg (55–66 lb) and is 115 cm (3.77 ft) in length.[8] It can reach up to 50 kg (110 lb) in weight and 180 cm (5.9 ft) in length, making it the largest amphibian species.[3][9]

Behavior[edit]

The Chinese giant salamander feeds on insects, frogs, crabs, shrimp, and fish. It has very poor eyesight, so it depends on special sensory nodes that run in a line on the body from head to tail. They are capable of sensing the slightest vibrations around them with the help of these nodes.[10] The female lays 400–500 eggs in an underwater breeding cavity, which is guarded by the male until the eggs hatch after 50–60 days.[3] Mating occurs between July and September.[11]

The giant salamander is known to vocalize, making barking, whining, hissing, or crying sounds.[12] Some of these vocalizations bear a striking resemblance to the crying of a young human child, and as such it is known in the Chinese language as the "infant fish" (娃娃鱼 / 鲵).[13]

Distribution and habitat[edit]

The Chinese giant salamander was widespread in central, south-western and southern China, but its range is now highly fragmented.[1] Its range spans the area from Qinghai east to Jiangsu and south to Sichuan, Guangxi and Guangdong; notably in the basins of the Yangtze, Yellow and Pearl Rivers.[3] Finds in Taiwan may be the result of introduction.[1]

The Chinese giant salamander is entirely aquatic and lives in rocky hill streams and lakes with clear water.[3] It typically lives in dark muddy or rocky crevices along the banks.[14] It is usually found in forested regions at altitudes of 100 to 1,500 m (300 to 4,900 ft),[1] with most records between 300 and 800 m (1,000 and 2,600 ft).[3] The salamanders also prefer to live in streams of small width (on average, 6.39 m or 21 ft across), quick flow, and little depth (on average, 1.07 m or 3 ft 6 in deep).[15] Although they prefer to have quick flow in the stream, the burrows in which they lay their eggs often have much slower flow. Furthermore, their habitat often possesses very rocky, irregular stream beds with a lot of gravel and small rocks as well as some vegetation.[15]

In captivity[edit]

As of early 2008, ISIS records only show five individuals held in US zoos (Zoo Atlanta, Cincinnati Zoo, and Saint Louis Zoological Park), and an additional four in European zoos (Zoo Dresden and Rotterdam Zoo).[16] A medium-sized specimen, approximately 3 ft (0.9 m) long, was kept for several years at the Steinhart Aquarium in San Francisco, California, and is now on display again in the "Water Planet" section of the new California Academy of Sciences building.[17] There are also two in residence at the Los Angeles Zoo. Additional individuals are likely kept in non-ISIS zoos and animals parks in its native China, such as Shanghai Zoo. Several of them are kept in the aquaria of Shanghai and Xian. It has been bred in captivity, but whether this can be achieved to an extent where the pressure on the wild populations is reduced is doubtful.[3] The Osaka Aquarium Kaiyukan in Japan has both a Chinese and a Japanese giant salamander on display.

Since May 2014 thirty-three Chinese giant salamanders including three adults have been held in Prague Zoo. The main attraction is the largest specimen in Europe.[18]

Decline in population[edit]

Chinese giant salamanders for sale in a restaurant in Hongqiao Town (虹桥镇) in Zhejiang, China: The price was 880 CNY/jin, or about 215 EUR/kg or US $280/kg. This places Chinese giant salamanders firmly in the luxury food segment and makes them an attractive target for poaching.

In the past, the Chinese giant salamander was fairly common and widespread in China.[1] Since the 1950s, the population has declined rapidly due to habitat destruction and overhunting. It has been listed as Critically Endangered in the Chinese Red Book of Amphibians and Reptiles. Despite the Chinese Government listing the salamander as a Class II Protected Species, 100 salamanders are hunted illegally every year in the Hupingshan Natural Nature Reserve alone. Since the 1980s, 14 nature reserves have been established as an effort to conserve the species. Despite this, the population continues to decline with the salamanders becoming increasingly difficult to find. In a recent survey of the species in the Qinghai Province, none were found indicating the population size is at a significantly low number or the species is locally extinct in the province. This is believed to be due to the increased mining in the region.[19]

In recent years populations have also declined with an epizootic Ranavirus infection. The disease causes severe hemorrhaging in both juveniles and adult salamanders. The virus was named the Chinese giant salamander iridovirus (GSIV).[20]

Its natural range has suffered in the past few decades due to habitat loss and overharvesting. Consequently, many salamanders are now farmed in mesocosms across China. Furthermore, previously built concrete dams that destroyed the salamander’s habitat are now fitted with stairs so that the animal can easily navigate the dam and make it back to its niche.[citation needed]

The Chinese giant salamander is listed as a critically endangered species. It has experienced a drastic population decline, which is estimated to be more than 80% in the last 3 generations due to human causes. Human consumption is the main threat to the Chinese giant salamander. They are considered to be a luxury food item, as well as an important source of traditional medicines in China. They are easy to hunt, so catching them is not a problem. Breeding Chinese giant salamanders is a large industry with thousands of breeding[clarification needed] and many enterprises.[21] Hunters can sell their flesh for $100 American dollars per kg. There is also commercial farming of these species, but it is believed to originate from the wild. In the 1960s, more than 15,000 kg of Chinese giant salamander meat was harvested each year from a single Prefecture in Hunan province. Habitat destruction including deforestation and pollution by humans is another reason for extinction. Water pollution from mines is an example of habitat degradation. The generation length of the Chinese giant salamander is estimated to be about 15 years. Since the 1980s, 14 nature reserves have been established for the conservation of the Chinese giant salamander.[citation needed]

Habitat destruction[edit]

According to a recent study, 90% of the Chinese giant salamanders’ habitat was destroyed by the year 2000,[7] and there are many human-related causes of such massive destruction. Because the salamander dwells in free-flowing streams, industrialization is a large problem for many stream-dwelling species. The construction of dams greatly disturbs their habitat by either causing these streams to dry up or to stand still, thusly making it uninhabitable by the salamanders.[7] Siltation also contributes to the degradation of their habitats by soiling the water.[7] Deforestation in areas near the streams can worsen soil erosion and create runoff into the streams as well, which reduces the water quality to a great extent.[7] The reduced water quality makes it much more difficult for the salamanders to absorb oxygen through their skin and can often bring death to those within the species.[7]

Water pollution is also a great factor in the habitat destruction of the Chinese giant salamander; the immense decline in their population can be traced to, among the other major problems of over-hunting and failed conservation efforts, the tainting of the water that they live in. Mining activity in particular in areas near their streams often causes runoff that sullies the water, and farming—and all of the pesticides and chemicals that affect the soil that come with it—has a vastly negative effect on the areas near the streams as well.[22] The presence of macronutrients in the streams can also cause algal blooms, which cloud the water and force the temperature to rise.[22] The salamanders reside primarily in very cold underwater cavities and follow a specific nesting requirement, which means that they will only reproduce and care for their eggs in areas such as these, so changes in temperature are incredibly detrimental to their health and well-being as well as to their perpetuation as a species.[22] These algal blooms also deplete the levels of oxygen in the water, and a lesser supply of oxygen can quite easily hold the potential to kill off many members of the dwindling species.[22]

Many efforts have been undertaken to create reserves and faux habitats for the Chinese giant salamander so that they can reproduce without worry of soiled water, but many of these reserves have failed in having a great impact overall due to the massive overhunting of the species. No matter how many members of the species they manage to save through the reserves, the poachers still manage to capture and kill that many more. Although habitat destruction is certainly not assisting in the perpetuation of the species, it is certainly not the biggest obstacle that the Chinese giant salamander faces in its quest to avoid extinction.[7]

Climate change[edit]

The Chinese giant salamander is native to China, as the name suggests. It is found in Central China as well as South and Southwest China. However, its range has become fragmented as a result of a decline in total population. The Chinese giant salamander inhabits lakes with fast-running water and rocky mountain streams. These creatures spend their entire lives in water and prefer altitudes between 300m and 800m above sea level. Many can be found in the tributaries of the Pearl, Yellow and Yangtze rivers.

The Chinese giant salamander is declining in population. This is believed to be the result of a few major factors. The primary reason for their decreasing numbers is the catch rates of these creatures. Populations are not only fragmented but generally smaller in size because of the over-collecting the larger salamanders.

Like other amphibians, the Chinese giant salamander is cold-blooded. Because of their geography, there is no evidence supporting that the climate has had an impact on their decline in numbers. The majority of southern China falls into the humid subtropical climate category. As a result, torpor has never been an issue for these creatures. The only thing severely threatening their existence is humans. Other amphibians who are endangered are experiencing such rapid declines in population due to a result of habitat destruction, over-harvesting and other mysterious reasons.[23] Chytridiomycosis, a fungal disease, is one of these mysterious threats to the Chinese giant salamander. This disease is more common in cooler habitats usually undergoing a drought.[23]

Overhunting[edit]

Many different amphibian species in China have been placed under threat by the International Union for Conservation of Nature or the IUCN. One of the main reasons that the Chinese giant salamander, Andrias davidianus, has been placed under the critically endangered list is due to overhunting of the amphibian. In 1989, legal protection by the Chinese government was placed on the salamander, but for the next 15 years it continued to decline. Overall, amphibians worldwide are declining in population for many reasons, especially in China, where 84% of species of amphibians are being affected in some way by overhunting even while attempts to conserve them are being made. The Chinese giant salamander is a main example of one of these amphibians that have been in this type of decline primarily due to over-harvesting, which has great effects on the species' diversity and the conversation efforts. Overhunting overall in China is a major threat to all species in the country. In China specifically, 75% of native species in China are harvested for food. The salamander is also used for its traditional use for medicinal purposes. The demand for the use for these creatures as food in China greatly exceeds the demand for them, and this amount over-exceeds the number of them can be harvested from the wild. Commercial captive breeding is looking to be the future for providing this demand to the Chinese people, but this will also have little impact on the over-harvesting threat. The profits made from the hunting and selling of the Salamander will keep it as a lucrative business venture for poachers. The Chinese giant salamander also has a great value for scientists due to research possibilities for phylogenetic and physiological aspects.

China’s penalty for illegally hunting these creatures is also very low and only comes to 50 Yuan, which translates to US$6. The value of these salamanders is much more than that. Salamanders are worth $100 to $150 per kg. Illegally caught salamanders are then distributed and sold to establishments such as restaurants which then charge $250–$400 per kg. These only encourage the hunting of these endangered salamanders and is the primary reason why stopping the hunting of these creatures is so challenging. A hunting tool known as a bow hook is one of the preferred methods used by hunters to catch the salamander. This hunting tool is made with a combination of bamboo and sharp hooks baited with frogs or smaller fish. This is used to capture the salamander and keep it alive. Some hunters use pesticides to kill the salamander. The population has since been assigned category II due to its population decline by The Wild Animal Protection Law of China and Appendix I in the Convention of Endangered Species of Wild Fauna.[24][25][26]

Conservation efforts[edit]

To understand the conservation efforts in China, it is important to know something about the events of the several past hundred years of China’s history relating to social attitudes, pressures on natures and natural resources, and the political ambition to safeguard the natural environment. Each of these are significant factors are determinants of conservation efforts. Up until the year 1700 in China, China was a country that was rampant with land reclamations, growing land exploitation, and wars. These series of events led to a huge upsurge in the diminishing of the natural bio mass and as well as a reduction in spatial distribution of biotic resources. The significance of this situation, was that this drastic dwindling of resources made the people of this region aware of the relationship between utilization and conservation. They now understood that there were going to be environmental consequences for their actions. Yet the nation continued on their destructive path even up to the year 1910. By then many more species had gone extinct, such as the Crocodile (Crocodilus porosus Schneider) and the Wild Camel (Camelus bactianus Linnaeus). From 1911 to 1949, China began to move into the direction of the modern industry, urbanization, civil wars, and agriculture. This transition period brought with it the depletion and disappearance of various renewable resources, as well as the pollution of various biotopes. This lack of conservation eventually led to a deteriorating environment, which meant lower standards of living for the Chinese human population. This is the point when both the government and the people of China came to the epiphany that the environment matters. It was not until 1956 that modern nature conservation efforts begin to develop.

The Chinese reforms that preceded this new Chinese perspective on conservation was not only beneficial to the Chinese giant salamander, but all organisms that occupied the natural environment of China. There was a formation of a new administrative system for nature conservation, which came together in the late 1950s. This new structure was able to establish new regulations that aimed at being successful in educating the masses about the value and significance of nature conservation, promoting awareness on the present status of various species, as well as prohibiting anti-conservation efforts such as hunting and trading of protected species- such as the Chinese giant salamander. Some examples would be the Environmental Protection Law of 1979, Regulation of water and soil conservation of 1982, Forestry Law of 1985, as well as the Wildlife Conservation Law of 1988. It was during this time period that the Chinese giant salamander was categorized as a category II species. All species that are endangered because their population is declining or their geographic distribution is becoming restricted.

In the mist of all these conservation efforts being conducted, in the late 1970s, a programme network of nature reserves was established in China. These reserves were established to uphold four major principles. First, is to conserve typical ecosystems and to represent the biotic communities. Second, the reserves are meant to secure rare, endemic and valuable species, as well as their habitats or breading locations. Third, these reserves were developed to rescue and regenerate deteriorated or damaged natural ecosystems and habitats of special significance. Finally, the reserves would be created in order to have sanctuaries in areas of special importance, such as seed forests, geological sections, glacial remains, watershed forest, etc. Many of these reservations were created for the overall protection of all endangered species of China and the conservation of the natural world they occupy. Yet a few reservation were made specifically with the idea preserving Chinese giant salamander populations. Beginning in the 1980s, there have been more than 14 nature reserves established for the conservation of the Chinese giant salamander. Examples would be the Zhangjiaje Giant Salamander Nature Reserve, Lushi Giant Salamander Nature Reserve, Qingyaoshan Giant Salamander Nature Reserve, Youyang Giant Salamander Nature Reserve, and the Taibai Giant Salamander Nature Reserve.

Though many efforts have been put forward, very little regulations have been actually been enforced. Due to lack of strong influential regulations and lack of funding, the conservation of the Chinese giant salamander has all but failed. They continue to have major decline in their populations due to human intervention of many different sorts. Even nature reserves continue to see diminishing to populations. Many of the reserves suffer from the same issues, such as shortage of funding and personnel, poaching, development of tourism, etc. Few believe that even with the major losses already suffered, things can still be turned around through proper protection of the Chinese giant salamander habitats, nesting sites, prevention of pollution from run-off, banning of certain hunting methods, and an assessment of irrigation work with nature reserves. Some believe that there also need to be more surveys carried out that institutes the conservation status and demography of the Salamander, as well as having a holistic view of the life history of this species. Others say that a public information campaign is needed to better educate local inhabitants.[27] [28] [29]

Construction has begun on the largest artificial breeding and protection base for the endangered giant salamander in China. The base in Jing'an County, in the eastern province of Jiangxi, will breed the amphibians for scientific research, the traditional Chinese medicine industry and for exhibition in aquariums. Located in the Sanzhaolun Forest Park, the 10.83 million yuan (1.35 million U.S. dollars) project is intended to breed 60,000 giant salamanders annually when it is completed by the end of next year. The base, covering 10,000 square meters, would boost efforts to save the world's largest amphibian from extinction, said Li Xinfa, head of the Jing'an County Giant Salamander Research Center. The number of wild giant salamanders has declined rapidly due to their value as a source of traditional Chinese medicine ingredients and as food, and due to poaching, loss of habitat and pollution. It has been put on the list of the Convention on International Trade in Endangered Species, and it is under state protection in China. EDGE (Evolutionarily Distinct & Groballly Endangered) aims to ensure the future of this salamander by helping to create an environmental education programme encouraging sustainable management of wild populations.

References[edit]

  1. ^ a b c d e Liang Gang, Geng Baorong, Zhao Ermi (2004). "Andrias davidianus". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 6 April 2014. 
  2. ^ "Amphibian Species of the World – Andrias davidianus (Blanchard, 1871)". Research.amnh.org. Retrieved 2010-02-04. 
  3. ^ a b c d e f g Andrias davidianus -Amphibiaweb
  4. ^ a b "Chinese Giant Salamander Conservation". Chinese Giant Salamander Conservation. 
  5. ^ "Creating a Future for Wild Chinese Salamanders.". Save Our Species. 
  6. ^ Amphibian Species of the World 5.2. Genus Andrias. Retrieved 2008-12-28.
  7. ^ a b c d e f g Krebs, Jessi, ed. "Chinese Giant Salamander (Andrias davidianus)". Wildscreen Arkive. 
  8. ^ Wood, The Guinness Book of Animal Facts and Feats. Sterling Pub Co Inc (1983), ISBN 978-0-85112-235-9
  9. ^ "Chinese Giant Salamander Conservation”. Chinese Giant Salamander Conservation. N.p., 2014. Web. 23 Oct. 2014. http://www.chinesegiantsalamanders.org
  10. ^ "World's Weirdest Creatures". Noeman.org. Retrieved 2010-02-04. 
  11. ^ "EDGE of Existence." EDGE of Existence. N.p., n.d. Web. 23 Oct. 2014.
  12. ^ Stebbins, Robert C.; Cohen, Nathan W. (1997), A Natural History of Amphibians, Princeton University Press, ISBN 978-0-691-10251-1 
  13. ^ Largest Base for Endangered Giant Salamander Underway, Xinhua News Agency, 2006-08-18 
  14. ^ "EDGE of Existence.". EDGE of Existence. 
  15. ^ a b Title: [Habitat characteristics of Andrias davidianus in Zhangjiajie of China]. Source: Qing-Hua, Luo. 应用生态学报 = Chinese Journal Of Applied Ecology Volume: 20 Issue: 7 (2009-07-20) p. 1723-1730. ISSN: 1001-9332
  16. ^ Andrias davidianus in zoos – ISIS[dead link]
  17. ^ "Exhibits of the California Academy of Sciences". Calacademy.org. Retrieved 2010-02-04. 
  18. ^ "Zoo Praha ukáže největšího velemloka v Evropě". 
  19. ^ Pierson, T. W. (2014). "A survey for the Chinese giant salamander". Andrias davidianus. 
  20. ^ Meng, Yan (2014). "Pathological and microbiological findings from mortality of the Chinese giant salamander (Andrias davidianus)". Archives of virology 159 (6): 1403–1412. 
  21. ^ "China's Giant Salamander Striking an Expo Pose." Expo 2010. China Daily, 2 Aug. 2010. Web. 23 Oct. 2014.
  22. ^ a b c d Yan, Fang et al. "Chinese Giant Salamander (Andrias Davidianus)". Edge of Existence. Zoological Society of London. Retrieved 2014-10-21. 
  23. ^ a b 29
  24. ^ Meng, Y., Y. Zhang, H. W. Liang, H. Xaio, and X. Xie. "Genetic Diversity of Chinese Giant Salamander (Andrias Davidianus) Based on the Novel Microsatellite Markers - Springer." Genetic Diversity of Chinese Giant Salamander (Andrias Davidianus) Based on the Novel Microsatellite Markers - Springer. Russian Journal of Genetics, 01 Dec. 2012. Web. 24 Oct. 2014.
  25. ^ Wang, X., Zhang, K., Wang, Z., Ding, Y., Wu, W., & Huang, S. (2004). The decline of the chinese giant salamander andrias davidianus and implications for its conservation. Oryx, 38(2), 197-202.
  26. ^ Science in China Series C: Life Sciences, 2007, Volume 50, Number 2, Page 265 Feng Xie, Michael Wai Neng Lau, Simon N. Stuart, Janice S. Chanson, Neil A. Cox, Debra L. Fischman
  27. ^ Wang, X., Zhang, K., Wang, Z., Ding, Y., Wu, W., & Huang, S. (2004). The decline of the chinese giant salamander andrias davidianus and implications for its conservation. Oryx, 38(2), 197-202. Retrieved from
  28. ^ Zhu. "Nature Conservation in China." Journal of Applied Ecology 26.3 (1989): 825-833. Academic Search Premier. Web. 19 Oct. 2014.c
  29. ^ Meng, Y., et al. "Genetic diversity of Chinese giant salamander (Andrias davidianus) based on the novel microsatellite markers." Russian Journal of Genetics 48.12 (2012): 1227-1231.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!