Overview

Brief Summary

The Four-Toed Salamander is a small salamander measuring only two to four inches in length. It has dark rust to gray-brown coloring, with gray sides and a white belly sprinkled with black dots. It is recognizable from other species due to its four-toed back feet and constricted ring around the base of the tail. Four-toed salamanders have short snouts and prominent eyes. Sexual dimorphism is observed; the female has a rounded snout while the male snout is a bit longer and square-shaped. Females may also be slightly larger than males. The tails of adults are quite long, longer in fact than the rest of the body, may be more brightly colored than the rest of the body, and are easily detachable in case it needs to escape. If it does detach, the tail will continue to wiggle for several minutes so that the rest of the salamander can get away. This process is called autotomy. Four-toed salamanders are plethodontids. They lack lungs and absorb all of their oxygen through their skin in a process called cutaneous respiration. Because of this it is critical they remain wet at all times as the moisture on their skin helps the gaseous exchange with the air. Four-toed salamanders' adult diet consists of insects and small invertebrates such as ticks, beetles, spiders, and worms. During the larval stage they eat the zooplankton found in the water.

  • MA Division of Fish and Wildlife - Natural Heritage and Endangered Species Program - Four-toed Salamander
Public Domain

National Biological Information Infrastructure (NBII) at http://www.nbii.gov

Supplier: Bob Corrigan

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (200,000-2,500,000 square km (about 80,000-1,000,000 square miles)) Discontinuously distributed from Nova Scotia (Friet and MacDonald 1995), New Brunswick, southern Quebec (e.g., Sharbel 1990), southern Ontario, Michigan, Wisconsin (Vogt 1981), and Minnesota (Dorff 1995, Hall et al. 2000) south to southeastern Oklahoma, Louisiana (Dundee and Rossman 1989), Mississippi, Alabama (Mount 1975), Florida panhandle, and Georgia (Conant and Collins 1991). Distribution is fairly continuous in the northeastern part of the range, spotty in the southwestern part.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

This species is discontinuously distributed in the US and Canada from Nova Scotia (Friet and MacDonald 1995), New Brunswick, southern Quebec (e.g., Sharbel 1990), southern Ontario, Michigan, Wisconsin (Vogt 1981), and Minnesota (Dorff 1995, Hall et al. 2000) south to southeastern Oklahoma, Louisiana (Dundee and Rossman 1989), Mississippi, Alabama (Mount 1975), Florida panhandle, and Georgia (Conant and Collins 1991). Distribution is fairly continuous in the northeastern part of the range, spotty in the southwestern part.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Hemidactylium_scutatum, the four-toed salamander, occurs from Nova Scotia to northern Minnesota, and south to the Gulf of Mexico. It has a scattered range and occurs only in small isolated populations in the southern and midwestern states. Its range is more continuous in states along the Appalachian Mountain Range, New England and west to northeastern Minnesota. (Behler and King 1979, Conant and Collins 1998, Lannoo 1998). It can be found all over Michigan except in the eastern thumb area.

Biogeographic Regions: nearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Four-toed salamanders occur in the eastern United States and southeastern Canada. Their distribution extends from Nova Scotia east through southern Ontario and Wisconsin to eastern Minnesota and south through Missouri, Oklahoma, and Arkansas [32,52,88,90] to Louisiana, Mississippi, and northwestern Florida [32,59]. They occur in isolated populations that are especially scattered in the western and southern portions of their range [3,32,36,52,59,88,92,96]. States with isolated populations include Indiana, Kentucky, Illinois, Missouri, Arkansas, Oklahoma, Louisiana, and northwestern Florida [3,32,59]. Isolated populations also occur in Nova Scotia and New Brunswick [32,59]. NatureServe provides a distributional map of four-toed salamanders.
  • 3. Anton, Thomas G.; Mauger, David; Brandon, Ronald A.; Ballard, Scott R.; Stillwaugh, Donald M., Jr. 1998. Distribution, habitats, and status of four-toed salamanders in Illinois. In: Lannoo, Michael J., ed. Status and conservation of midwestern amphibians. Iowa City, IA: University of Iowa Press: 45-48. [69113]
  • 32. Daniel, Paul M. 1989. Hemidactylium scutatum (Schlegel): Four-toed salamander. In: Pfingsten, Ralph A.; Downs, Floyd L., eds. Salamanders of Ohio. Columbus, OH: Ohio State University, College of Biological Sciences: 223-228. [70424]
  • 36. Easterla, David A. 1971. A breeding concentration of four-toed salamanders, Hemidactylium scutatum in southeastern Missouri. Journal of Herpetology. 5(3-4): 194-195. [69152]
  • 52. Herman, T. B.; Scott, F. W. 1994. Protected areas and global climate change: assessing the regional or local vulnerability of vertebrate species. In: Pernetta, John; Leemans, Rik; Elder, Danny; Humphrey, Sarah, eds. Impacts of climate change on ecosystems and species: implications for protected areas. Gland, Switzerland: International Union for Conservation of Nature and Natural Resources: 13-27. [69124]
  • 88. Thurow, Gordon R. 1997. Observations on Hemidactylium scutatum habitat and distribution. Bulletin of the Chicago Herpetological Society. 32(1): 1-6. [69130]
  • 90. Wallace, Robert S. 1984. Use of sphagnum moss for nesting by the four-toed salamander, Hemidactylium scutatum Schlegl. (Plethodontidae). Proceedings of the Pennsylvania Academy of Science. 58(2): 237-238. [69138]
  • 96. Wyman, Richard L. 1988. Soil acidity and moisture and the distribution of amphibians in five forests of southcentral New York. Copeia. 1988(2): 394-399. [69163]
  • 59. Johnson, Tom R. 2000. Four-toed salamander--Hemidactylium scutatum (Schlegel). In: Davit, Carol, ed. The amphibians and reptiles of Missouri. 2nd ed. Jefferson City, MO: Missouri Department of Conservation: [pages unknown]. [70426]
  • 92. Whitaker, John O., Jr.; Minton, Sherman A., Jr. 1988. Reptiles and amphibians. In: Whitaker, John O., Jr.; Gammon, James R., [eds.]. Endangered and threatened vertebrate animals of Indiana their distribution and abundance. Monograph No. 5. Indianapolis, IN: Indiana Academy of Science: 67-86. [69139]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Hemidactylium scutatum, the four-toed salamander, occurs from Nova Scotia to northern Minnesota, and south to the Gulf of Mexico. It has a discontinuous range and occurs only in small isolated populations in the southern and midwestern states. Its range is more continuous in states along the Appalachian Mountain Range, New England and west to northeastern Minnesota. (Behler and King 1979, Conant and Collins 1998, Lannoo 1998).

Biogeographic Regions: nearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Physical Description

The four-toed salamander is a small, lungless salamander only 5 to 10.2 cm (2 to 4 in) in length. It is a rusty brown color or gray-brown color with grayish sides. It is often speckled with black and bluish spots. Unique four-toed hind feet and a constricted ring around the base of its tail easily identify it. The tail makes up about 57 percent of its total body length (Petranka 1998).

Hatchlings are only 11 to 15 mm total body length. They are usually born with toes or toe buds. The larvae are aquatic and a yellowish brown color. A dorsal fin runs from the length of the tail to near the back of the head. Some hatchlings look more like adults but have shorter tails (Petranka 1998).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

The four-toed salamander is a small plethodontid (lungless) salamander only 5 to 10.2 cm (2 to 4 in) in length. It is a rusty brown color or gray-brown color with grayish sides. It is often speckled with black and bluish spots. Unique four-toed hind feet and a constricted ring around the base of its tail easily identify it. They have nasolabial grooves and 13 to 14 coastal grooves (Harding 1997). The tail makes up about 57 percent of its total body length (Petranka 1998).

Female four-toed salamanders have rounded snouts, while sexually active males have more squared (truncated) snouts. Enlarged premaxillary teeth are also evident in sexually active males and can be seen with a closed mouth. The snout-to-vent length (SVL) is approximately 15 percent longer in females than males (Petranka 1998).

Hatchlings are only 11 to 15 mm total body length. They are usually born with toes or toe buds. The larvae are aquatic and a yellowish brown color. A dorsal fin runs from the length of the tail to near the back of the head. Some hatchlings look more like adults but have shorter tails (Petranka 1998).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 10 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Comments: Adults live under objects or among mosses in swamps, boggy streams, and wet, wooded or open areas near ponds or quiet, mossy or grassy/sedgy pools (the larval habitat). Sphagnum moss is commonly abundant in suitable habitat.

Eggs are laid in moss or other protected sites immediately above or next to a pool, into which the larvae drop or wriggle after hatching.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Adults live under objects or among mosses in swamps, boggy streams, and wet, wooded or open areas near ponds or quiet, mossy or grassy/sedgy pools (the larval habitat). Sphagnum moss is commonly abundant in suitable habitat. Eggs are laid in moss or other protected sites immediately above or next to a pool, into which the larvae drop or wriggle after hatching. Does not require pristine habitat; Phillips et al. (1999) noted that in Illinois "several localities are second-growth woods in soggy soils below dams of man-made lakes."

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Four-toed salamanders have specialized habitat requirements which require suitable breeding wetlands within or near mature forests. They prefer mature forests with dense canopy cover to preserve body moisture, lots of downed woody debris for cover and foraging opportunities, and vernal pools, ponds, bogs, shallow marshes, or other fishless bodies of water for breeding and nesting. Wooded wetlands such as swamps or swamps with lots of moss are ideal. Male adults can be located under leaves, bark, and logs in the upland forest, while females are most often found during the breeding season nesting in moss mats which overhang pools of water. (Harding 1997, Petranka 1998).

Terrestrial Biomes: forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Four-toed salamanders have specialized habitat requirements which require suitable breeding wetlands within or adjacent to mature forests. They prefer mature, mesic forests with dense canopy cover to preserve body moisture, an abundance of downed woody debris for cover and foraging opportunities, and vernal pools, ponds, bogs, shallow marshes, or other fishless bodies of water for nesting and larval success. Wooded wetlands such as seepage swamps or cedar swamps with many moss mats are ideal. Male adults can be located under leaves, bark, and logs in the upland forest, while females are most often found during the breeding season nesting in moss mats which overhang pools of water. (Harding 1997, Petranka 1998).

Terrestrial Biomes: forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Relatively sedentary; may move short distances between breeding sites and nonbreeding habitat.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: Adults eat a variety of small terrestrial invertebrates. Larvae eat small aquatic invertebrates.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

Few studies have been conducted on the feeding habits of the four-toed salamander, but it is believed their diet consists mainly of insects and their larvae (beetles, flies, ants, bristletails), spiders, mites, worms, and snails (Harding 1997, Petranka 1998).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

Few studies have been conducted on the feeding habits of the four-toed salamander, but it is believed their diet consists mainly of insects and their larvae (beetles, flies, ants, bristletails), spiders, mites, worms, and snails (Harding 1997, Petranka 1998).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 to >300

Comments: Hundreds of known occurrences. Many new ones are being discovered. As an indication of this, 18 new county records were published in Herpetological Review during the period 1995-2000; these included several for Minnesota, where the species had not been previously documented. In southern New England, where the species had been regarded as rare, Klemens (1993) found that H. SCUTATUM was widely distributed and secure. Most state distribution maps do not distinguish between old and recent records. Gilhen (1984) mapped a dozen locations in Nova Scotia. Klemens (1993) mapped dozens of occurrences (many previously unreported) in Connecticut. Redmond and Scott (1996) mapped 25 locations in Tennessee but stated that the distribution is poorly known. Pfingsten and Downs (1989) mapped 47 post-1950 locations in Ohio. Vogt (1981) mapped 25 locations in Wisconsin. Phillips et al. (1999) mapped pre-1980 records for 7 counties and 4 more recent county occurrences. Tobey (1985) mapped about 55 locations in Virginia. Green and Pauley (1987) mapped occurrences in about 20 counties in West Virginia; they stated that the species probably occurs throughout the state. Johnson (1987) mapped 12 locations in 12 counties in Missouri. Minton (1972) mentioned that some of the 10 populations he mapped in Indiana may no longer exist. At the southern limit of the range in the Florida panhandle, Means (1992) stated that the half-dozen localities have produced fewer than 10 specimens from the state. Dundee and Rossman (1989) recorded two occurrences in Louisiana.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

10,000 to >1,000,000 individuals

Comments: Total adult population size is unknown but surely exceeds 10,000 and may exceed 100,000. Species is more abundant than available records indicate (relatively difficult to find).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

May aggregate in favorable hibernation areas.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat-related Fire Effects

More info for the terms: association, bog, cover, density, duff, fire regime, hardwood, litter, mesic, prescribed fire, presence, severity, shrubs, succession, tree, wildfire

Four-toed salamander larvae may be impacted by changes to stream pool and woodland pond habitats following fire. Alterations to adult habitat that are likely to have the largest impact on four-toed salamanders are changes to canopy cover and ground cover including mosses, leaf litter, and coarse woody debris. Other changes that could impact four-toed salamanders are changes in landscape-level habitat configuration and declines in prey availability.

Effects on aquatic habitat: Fire can have beneficial or detrimental impacts on the availability of nesting sites and larval pools, wetlands, and ponds. According to a review, fires can prevent succession of aquatic habitats such as bogs to hardwood forest; succession would reduce water levels and, presumably, available larval habitat [82]. Reduction in vegetation also reduces evapotranspiration, raising water levels and providing more potential larval habitat [77]. Woody debris that falls following fire can create new pools for nesting and larval habitat [56]. However, consumption of nesting vegetation and other substrates by fire would likely negatively impact habitat, particularly because of four-toed salamander's apparent fidelity to nesting ponds [50].

If erosion and sedimentation occur following fire, availability of breeding sites may be reduced temporarily. The California newt (Taricha torosa), a species that nests in deep, slow-moving water, laid fewer egg masses following a chaparral wildfire that reduced the number of runs and pools in a nesting stream [41]. A review suggests that impacts of sedimentation on nesting habitat may be greater in streams with low gradients [34], such as those used by four-toed salamander larvae [88]. According to a review, sediment in streams can reach 100 times typical levels and persist for over 10 years following severe fires. Nevertheless, effects of fire and the resulting sedimentation on pond-breeding amphibians could be negligible in most circumstances [77].

Characteristics of larval habitats that may be impacted by fire include temperature, nutrient input, productivity, pH, evaporation rate, morphology, and water-holding capacity [34,74,77]. Reviews suggest that fire typically results in a temporary increase in pH [64,72]. This could potentially benefit acid-sensitive species [84]. Although four-toed salamanders can occur in acidic water, they may be sensitive to low pH (see Aquatic habitats). Characteristics of temporary ponds, including pH, were not significantly altered by prescribed fire on low-elevation sites of South Carolina [84].

Effects on terrestrial habitat Effects on ground cover: Given the importance of the litter layer in providing cover for four-toed salamanders, fire-caused alterations are likely detrimental [77,82] because soil temperature fluctuations can increase [84], moisture in the leaf litter can decline [4,5,38], and soil moisture may decline (Barnes and Van Lear 1998, cited in [38]). McLeod and Gates [69] suggest that four-toed salamander absence from a repeatedly burned loblolly pine stand and presence in the unburned stand were related to the cooler, moister microenvironment provided by leaf litter, canopy cover, and dense hardwood trees.

Fire often reduces leaf litter and other ground cover in salamander habitat [43,61,62,69,71,84]. A mixed pine-hardwood site occupied by four-toed salamander had significantly greater litter depth than an unoccupied burned site on the Atlantic coast plain of Maryland [69]. Similar changes have been observed following fire in other areas within the four-toed salamander's distribution. In south-central Pennsylvania, average litter cover the spring following a fall fire was 52.3%, and the litter layer averaged 0.5 inch (1.15 cm) deep, compared to 76.8% average litter cover and an average litter depth of 2.8 inches (7.15 cm) on an adjacent unburned site. Living ground cover was also reduced, with the unburned site having 13.7% cover of shrubs and mosses and the burned site lacking living ground cover. On the burned site cover of mineral soil was 27.6%, while on the unburned site it was only 0.1% [62]. In bottomland hardwood forests in Georgia, litter was significantly deeper (P<0.025) and percent cover of bare ground was significantly smaller (P<0.003) on unburned plots compared to burned plots [71]. Prescribed fires and understory removal followed by prescribed fires resulted in significantly (P<0.0001) reduced leaf litter compared to untreated plots in southern Appalachian upland hardwood forest in North Carolina [43].

Loss of leaf litter may also affect four-toed salamanders by reducing the availability of prey. If four-toed salamanders feed only in wet litter, as is the case with eastern red-backed salamanders [58], reduction of leaf litter likely reduces foraging habitat. Reductions in leaf litter associated with timber harvesting resulted in a decline in the abundance of macroarthropods in the leaf litter in the southern Appalachians [85]. See Food Habits for a discussion of the possible repercussions of reduced food availability on four-toed salamanders.

The litter that accumulates within a few years of a disturbance apparently provides adequate habitat for salamanders, suggesting that impacts to certain four-toed salamander habitat features may be short lived. In northern hardwoods of New Hampshire the amount of leaf litter increased from nearly zero to as much as 20% of precutting levels within 4 years of clearcutting [28]. Plethodontid salamanders in the southern Blue Ridge Mountains of North Carolina were detected in clearcut stands 4 to 6 years after harvesting, which coincided with development of the litter layer [5]. Differences in leaf litter depth between burned and control sites in a southern Appalachian deciduous forest in eastern Tennessee were no longer significant 3 years following fire [40]. Living ground cover was similar in burned and unburned vegetation by the end of the summer following a fall fire in south-central Pennsylvania [62].

Moss provides cover, foraging habitat, and nesting habitat for four-toed salamanders on many sites, so the impact of fire on moss will likely influence four-toed salamanders. Recovery of moss following fire varies with species [2,63]. For instance, juniper haircap moss (Polytrichum juniperinum) can colonize sites within 4 years of fire, while late-successional species such as splendid feather moss (Hylocomium splendens) may take over 50 years to reach prefire levels. A bog in western Canada experienced substantial colonization of upright haircap moss (Polytrichum strictum) within 2 years of fire, with greater colonization in low, wet areas. Colonization of upright haircap moss appeared to facilitate the establishment of sphagnum mosses [7]. Mosses often used by four-toed toed salamander are discussed in Nest sites.

Effects on coarse woody debris: Reduction in coarse woody debris due to fire may negatively impact four-toed salamanders. A loblolly pine stand in Maryland that was repeatedly burned under prescription had significantly (P<0.05) less coarse woody debris and significantly (P<0.01) fewer four-toed salamanders than an unburned mixed pine-hardwood stand [69].

The consistent moisture levels of coarse woody debris may provide refuge for salamanders following fires that consume substantial amounts of leaf litter. Presence of coarse woody debris following disturbance may be especially important on dry sites [71,75]. As of 2008, information on loss of large amounts of coarse woody debris from wildfire in salamander habitats in the eastern United States was lacking; most of the studies described here investigate the impacts of low-severity fires [43,61,71].

Some fires increase coarse woody debris and could increase nesting habitat by blocking streams, forming pools and/or providing substrates where females can lay eggs. Following a mixed-severity wildfire in western Montana, potential long-toed salamander (Ambystoma macrodactylum) breeding sites increased due to fallen trees blocking intermittent streams and creating new pools [56].

Effects on canopy cover: Increases in solar radiation could reduce habitat quality for four-toed salamanders (see Canopy cover). The significant (P<0.05) reductions in canopy cover and deciduous tree density on repeatedly burned loblolly pine sites in Maryland were suggested as possible explanations for four-toed salamander absence from the repeatedly burned sites [69]. Increased light may reduce habitat quality due to higher temperatures, greater UV-B exposure [77], and drier vegetation around ponds. However, increased productivity and longer hydroperiods due to reduced evapotranspiration following reduction in canopy cover could potentially benefit salamanders [87]. For more information, see Aquatic habitats.

Landscape-scale considerations: Reduction in four-toed salamander microhabitats could interfere with successful migration into nesting ponds and/or dispersal between populations. Desiccation and predation likely pose greater risks to salamanders migrating or dispersing through burned habitat than to those in unburned habitat [20,77,84]. The consistent use of the same nesting ponds by four-toed salamanders in northern Virginia [50] and the generally low mobility of salamanders suggest obstructions to movement could compromise the long-term persistence of four-toed salamanders at a given site [69].

Landscape-scale factors such as distance to water and topography may have greater influences on salamanders than fire. Distance to water and mesic aspects were significantly (P≤0.032) associated with eastern red-backed salamander captures in oak-dominated forest in the Virginia Piedmont, while fire treatments were not [61]. Slope location had more impact on salamander abundance in southwestern North Carolina than prescribed fire treatments. This may be partly related to differences in severity on different parts of the slope (see next paragraph) [39].

Fire Characteristics: Although high-severity fires are rare in the moist habitats occupied by four-toed salamanders (see Fire Ecology), they would likely have large, long-term impacts. Little of the current information on salamanders' response to fire is based on high-severity fires [38,71]. Although a fire in southwestern North Carolina was severe in upland areas, in midslope and riparian areas the fire consumed comparatively little vegetation [39]. The most severe fire in a southern Appalachian upland hardwood forest resulted in 25% tree mortality and insignificant impacts on coarse woody debris or duff depths [43]. High-severity fires would be more likely to consume coarse woody debris, burn deep into litter and duff, and reduce canopy cover. Many shelters would likely be consumed, leaving salamanders more vulnerable to overheating or desiccation. After a fire in the Jemez Mountains of New Mexico, 24-hour average daily temperatures in potential salamander shelters were much higher in areas burned in high-severity and moderate-severity fires than those burned in low-severity fires [31]. For a discussion of the effect of canopy removal and ground disturbance on four-toed salamanders, see Forest management.

It has been suggested that large wildfires that occur during dry periods, when salamanders are generally limited to damp areas or underground burrows, may have less impact on salamanders than prescribed fires that are more likely to occur in moist or humid conditions when salamanders are active [21]. Fire during periods of four-toed salamander activity, such as the spring migratory and nesting and fall breeding seasons, could result in greater mortality due to more individuals being caught in exposed areas or migrating through recently burned areas [77,84]. However, season of burning (spring, winter, or summer) did not influence eastern red-back salamanders or amphibians in general in shelterwood-harvest oak forests of the Virginia Piedmont [61].

Frequent fires are likely to have greater impacts on four-toed salamanders and their habitat than single or infrequent fires [38,69]. A loblolly pine site that burned 5 or 6 times in 11 years had significantly fewer four-toed salamanders than a nearby unburned pine-mixed hardwood site. Repeated burning likely explains the significant (P<0.05) reductions in habitat characteristics important to salamanders such as coarse woody debris and canopy cover [69]. Data from timber harvesting studies suggest that long return-intervals of severe disturbances would minimize impacts on salamanders [55] and the litter layer [1].

Fire Ecology: Four-toed salamanders occur in forests with varied FIRE REGIMES (see the Fire Regime Table of plant communities with four-toed salamanders). Their association with moist areas near pools, streams, and other aquatic habitats suggests that their habitat would generally burn less frequently than upland forest types. Drought likely increases the risk of fire in four-toed salamander habitat. For more information on FIRE REGIMES within the four-toed salamander's range, see the FEIS reviews of the dominant plant species in four-toed salamander habitats, such as pitch pine, eastern white pine, white oak, and sugar maple (Acer saccharum), and the Fire Regime Table.

  • 5. Ash, Andrew N. 1997. Disappearance and return of Plethodontid salamanders to clearcut plots in the southern Blue Ridge Mountains. Conservation Biology. 11(4): 983-989. [70716]
  • 7. Benscoter, Brian W. 2006. Post-fire bryophyte establishment in a continental bog. Journal of Vegetation Science. 17: 647-652. [64980]
  • 20. Bull, Evelyn L.; Wales, Barbara C. 2001. Effects of disturbance on amphibians of conservation concern in eastern Oregon and Washington. Northwest Science. 75: 174-179. [43157]
  • 50. Harris, Reid N.; Ludwig, Patrice M. 2004. Resource level and reproductive frequency in female four-toed salamanders, Hemidactylium scutatum. Ecology. 85(6): 1585-1590. [69155]
  • 55. Hicks, Norman G.; Pearson, Scott M. 2003. Salamander diversity and abundance in forests with alternative land use histories in the southern Blue Ridge Mountains. Forest Ecology and Management. 177: 117-130. [70739]
  • 58. Jaeger, Robert G. 1980. Fluctuations in prey availability and food limitation for a terrestrial salamander. Oecologia. 44: 335-341. [70713]
  • 69. McLeod, Roderick F.; Gates, J. Edward. 1998. Response of herpetofaunal communities to forest cutting and burning at Chesapeake Farms, Maryland. The American Midland Naturalist. 139: 164-177. [27869]
  • 71. Moseley, Kurtis R.; Castleberry, Steven B.; Schweitzer, Sara H. 2003. Effects of prescribed fire on herpetofauna in bottomland hardwood forests. Southeastern Naturalist. 2(4): 475-486. [62076]
  • 74. Paton, Peter; Stevens, Sara; Longo, Linda. 2000. Seasonal phenology of amphibian breeding and recruitment at a pond in Rhode Island. Northeastern Naturalist. 7(3): 255-269. [69159]
  • 75. Petranka, James W.; Brannon, M. Patrick; Hopey, Mark E.; Smith, Charles K. 1994. Effects of timber harvesting on low elevation populations of southern Appalachian salamanders. Forest Ecology and Management. 67: 135-147. [24407]
  • 85. Seastedt, T. R.; Crossley, D. A., Jr. 1981. Microarthropod response following cable logging and clear-cutting in the southern Appalachians. Ecology. 62(1): 126-135. [70742]
  • 87. Skelly, David K.; Werner, Earl E.; Cortwright, Spencer A. 1999. Long-term distributional dynamics of a Michigan amphibian assemblage. Ecology. 80(7): 2326-2337. [70703]
  • 88. Thurow, Gordon R. 1997. Observations on Hemidactylium scutatum habitat and distribution. Bulletin of the Chicago Herpetological Society. 32(1): 1-6. [69130]
  • 2. Ahlgren, C. E. 1974. Effects of fires on temperate forests: north central United States. In: Kozlowski, T. T.; Ahlgren, C. E., eds. Fire and ecosystems. New York: Academic Press: 195-223. [7198]
  • 1. Aber, John D.; Botkin, Daniel B.; Melillo, J. M. 1978. Predicting the effects of different harvesting regimes on forest floor dynamics in northern hardwoods. Canadian Journal of Forest Research. 8: 306-315. [70733]
  • 4. Ash, Andrew N. 1995. Effects of clear-cutting on litter parameters in the southern Blue Ridge Mountains. Castanea. 60(2): 89-97. [70732]
  • 21. Bury, R. Bruce; Major, Donald J.; Pilliod, David. 2002. Responses of amphibians to fire disturbance in Pacific Northwest forests: a review. In: Ford, W. Mark; Russell, Kevin R.; Moorman, Christopher E., eds. The role of fire in nongame wildlife management and community restoration: traditional uses and new directions: Proceedings of a special workshop; 2000 December 15; Nashville, TN. Gen. Tech. Rep. NE-288. Newtown Square, PA: U.S. Department of Agriculture, Forest Service, Northeastern Research Station: 34-42. [41553]
  • 28. Covington, W. Wallace. 1981. Changes in forest floor organic matter and nutrient content following clear cutting in northern hardwoods. Ecology. 62(1): 41-48. [70734]
  • 31. Cummer, Michelle R.; Painter, Charles W. 2007. Three case studies of the effect of wildfire on the Jemez Mountains salamander (Plethodon neomexicanus): microhabitat temperatures, size distributions, and a historical locality perspective. The Southwestern Naturalist. 52(1): 26-37. [66820]
  • 34. deMaynadier, Phillip G.; Hunter, Malcolm L., Jr. 1995. The relationship between forest management and amphibian ecology: a review of the North American literature. Environmental Review. 3: 230-261. [34380]
  • 38. Floyd, Thomas M.; Russell, Kevin R.; Moorman, Christopher E.; Van Lear, David H.; Guynn, David C., Jr.; Lanham, J. Drew. 2002. Effects of prescribed fire on herpetofauna within hardwood forests of the Upper Piedmont of South Carolina: a preliminary analysis. In: Outcalt, Kenneth W., ed. Proceedings, 11th biennial southern silvicultural research conference; 2001 March 20-22; Knoxville, TN. Gen. Tech. Rep. SRS-48. Asheville, NC: U.S. Department of Agriculture, Forest Service, Southern Research Station: 123-127. [41467]
  • 39. Ford, William M.; Menzel, M. Alex; McGill, David W.; Laerm, Joshua; McCay, Timothy S. 1999. Effects of a community restoration fire on small mammals and herpetofauna in the southern Appalachians. Forest Ecology and Management. 114(2-3): 233-243. [30070]
  • 40. Gagan, Alison Baird. 2002. The effects of prescribed fire on millipede and salamander populations in a southern Appalachian deciduous forest. Johnson City, TN: East Tennessee State University. 37 p. Thesis. [70736]
  • 41. Gamradt, Seth C.; Kats, Lee B. 1997. Impact of chaparral wildfire-induced sedimentation on oviposition of stream-breeding California newts (Taricha torosa). Oecologia. 110(4): 546-549. [30067]
  • 43. Greenberg, Cathryn H.; Waldrop, Thomas A. 2008. Short-term response of reptiles and amphibians to prescribed fire and mechanical fuel reduction in a southern Appalachian upland hardwood forest. Forest Ecology and Management. 255(7): 2883-2893. [70707]
  • 56. Hossack, Blake R.; Corn, Paul Stephen. 2007. Responses of pond-breeding amphibians to wildfire: short-term patterns in occupancy and colonization. Ecological Applications. 17(5): 1403-1410. [69779]
  • 61. Keyser, Patrick D.; Sausville, David J.; Ford, W. Mark; Schwab, Donald J.; Brose, Patrick H. 2004. Prescribed fire impacts to amphibians and reptiles in shelterwood-harvested oak-dominated forests. Virginia Journal of Science. 55(4): 159-168. [70730]
  • 62. Kirkland, Gordon L., Jr.; Snoddy, Heather W.; Amsler, Teresa L. 1996. Impact of fire on small mammals and amphibians in a central Appalachian deciduous forest. The American Midland Naturalist. 135(2): 253-260. [26746]
  • 63. Kirkpatrick, Helen Elizabeth. 1990. Resource competition between two co-occurring species of Polytrichum. Ann Arbor, MI: The University of Michigan. 153 p. Dissertation. [69447]
  • 64. Knoepp, Jennifer D.; DeBano, Leonard F.; Neary, Daniel G. 2005. (revised 2008). Chapter 3: soil chemistry. In: Neary, Daniel G.; Ryan, Kevin C.; DeBano, Leonard F., eds. Wildland fire in ecosystems: Effects of fire on soil and water. Gen. Tech. Rep. RMRS-GTR-42-vol. 4. Ogden, UT: U.S. Department of Agriculture, Forest Service, Rocky Mountain Research Station: 53-72. [55887]
  • 72. Neary, Daniel G.; Landsberg, Johanna D.; Tiedemann, Arthur R.; Ffolliott, Peter F. 2005. (revised 2008). Chapter 6: water quality. In: Neary, Daniel G.; Ryan, Kevin C.; DeBano, Leonard F., eds. Wildland fire in ecosystems: Effects of fire on soil and water. Gen. Tech. Rep. RMRS-GTR-42-vol. 4. Ogden, UT: U.S. Department of Agriculture, Forest Service, Rocky Mountain Research Station: 119-134. [55891]
  • 82. Russell, Kevin R.; Van Lear, David H.; Guynn, David C., Jr. 1999. Prescribed fire effects on herpetofauna: review and management implications. Wildlife Society Bulletin. 27(2): 374-384. [33086]
  • 84. Schurbon, Jamie M.; Fauth, John E. 2003. Effects of prescribed burning on amphibian diversity in a southeastern U.S. national forest. Conservation Biology. 17(5): 1338-1349. [47644]
  • 77. Pilliod, David S.; Bury, R. Bruce; Hyde, Erin J.; Pearl, Christopher A.; Corn, Paul Stephen. 2003. Fire and amphibians in North America. In: Young, Michael K.; Gresswell, Robert E.; Luce, Charles H., guest eds. Special issue: The effects of wildland fire on aquatic ecosystems in the western USA: Selected papers from an international symposium on effects of wildland fire on aquatic ecosystems in the western USA; 2002 April 22-24; Boise, ID. In: Forest Ecology and Management. Amsterdam; London; New York: Elsevier Science B. V.; 178(1-2): 163-181. [Special Issue]. [44930]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Direct Effects of Fire

More info for the terms: cover, direct effects of fire, hardwood, prescribed fire

Despite their susceptibility to desiccation and use of the forest floor, evidence as of 2008 suggests that most salamanders typically avoid direct effects of fire by retreating to underground burrows or moist refugia [67,77,82]. Capture rates of 4 Plethodontid salamander species in southwestern North Carolina were not significantly altered following a spring prescribed fire [39]. Characteristics of salamander communities, such as richness, abundance, and diversity, were not significantly affected by spring prescribed fire in a Piedmont upland woodland in South Carolina [38] or winter prescribed fire in bottomland hardwood forest in Georgia [71]. Relative abundance of salamanders in a southern Appalachian upland hardwood forest in South Carolina was not significantly different between plots that were burned under prescription, had the understory removed before prescribed burning, or were untreated [43]. Relative abundance of amphibians on oak-dominated stands of the Virginia Piedmont, including eastern red-back salamanders, was not significantly different between unburned and fall-, winter-, or spring-burned sites [61].

However, fewer captures of salamanders on burned sites compared to unburned sites [38,44,69,70] and mortalities of eastern red-backed salamanders sheltering under dead logs [70] indicate the potential for negative effects of fire on adult four-toed salamanders. Four-toed salamanders have not been observed on recently burned sites. On the Atlantic coastal plain in Maryland, 20 four-toed salamanders were captured in unburned pine-mixed-hardwood habitat, while none was captured in a repeatedly burned loblolly pine site. This difference was statically significant (P<0.01). The burned site was the same distance as the unburned site from a marshy area likely used for nesting, but it was 790 feet (240 m) farther from the nearest wetland than the unburned site [69]. Unmanaged mixed-hardwood stands had higher amphibian relative abundance and surface activity than 2 regularly but infrequently burned pine plantations in South Carolina [44].

According to a review, aquatic life stages of salamanders are typically sheltered from direct effects of fire, so mortality is rarely documented [77]. However, larval mortality could occur if water was heated to lethal temperatures or if temperatures reached stressful levels, likely above 77 °F (25 °C) [88], for several hours. Heat can also lead to lethal chemical changes in water [77].

Fires occurring during inactive periods such as late summer or winter would likely be least detrimental to four-toed salamanders, since use of underground burrows is more common during these periods (see Cover Requirements). The use of moist sites suggests that four-toed salamander eggs are seldom exposed to lethal fires. The higher surface-to-volume ratio of juveniles makes them more susceptible to drying [37,88]. Therefore, juveniles may be even more restricted to moist environments than adults [5,37] and may be exposed to fire less often than adults.

  • 5. Ash, Andrew N. 1997. Disappearance and return of Plethodontid salamanders to clearcut plots in the southern Blue Ridge Mountains. Conservation Biology. 11(4): 983-989. [70716]
  • 37. Feder, Martin E. 1983. Integrating the ecology and physiology of Plethodontid salamanders. Herpetologica. 39(3): 291-310. [70727]
  • 69. McLeod, Roderick F.; Gates, J. Edward. 1998. Response of herpetofaunal communities to forest cutting and burning at Chesapeake Farms, Maryland. The American Midland Naturalist. 139: 164-177. [27869]
  • 71. Moseley, Kurtis R.; Castleberry, Steven B.; Schweitzer, Sara H. 2003. Effects of prescribed fire on herpetofauna in bottomland hardwood forests. Southeastern Naturalist. 2(4): 475-486. [62076]
  • 88. Thurow, Gordon R. 1997. Observations on Hemidactylium scutatum habitat and distribution. Bulletin of the Chicago Herpetological Society. 32(1): 1-6. [69130]
  • 38. Floyd, Thomas M.; Russell, Kevin R.; Moorman, Christopher E.; Van Lear, David H.; Guynn, David C., Jr.; Lanham, J. Drew. 2002. Effects of prescribed fire on herpetofauna within hardwood forests of the Upper Piedmont of South Carolina: a preliminary analysis. In: Outcalt, Kenneth W., ed. Proceedings, 11th biennial southern silvicultural research conference; 2001 March 20-22; Knoxville, TN. Gen. Tech. Rep. SRS-48. Asheville, NC: U.S. Department of Agriculture, Forest Service, Southern Research Station: 123-127. [41467]
  • 39. Ford, William M.; Menzel, M. Alex; McGill, David W.; Laerm, Joshua; McCay, Timothy S. 1999. Effects of a community restoration fire on small mammals and herpetofauna in the southern Appalachians. Forest Ecology and Management. 114(2-3): 233-243. [30070]
  • 43. Greenberg, Cathryn H.; Waldrop, Thomas A. 2008. Short-term response of reptiles and amphibians to prescribed fire and mechanical fuel reduction in a southern Appalachian upland hardwood forest. Forest Ecology and Management. 255(7): 2883-2893. [70707]
  • 44. Hanlin, Hugh G.; Martin, F. Douglas; Wike, Lynn D.; Bennett, Stephen H. 2000. Terrestrial activity, abundance and species richness of amphibians in managed forests in South Carolina. The American Midland Naturalist. 143(1): 70-83. [62069]
  • 61. Keyser, Patrick D.; Sausville, David J.; Ford, W. Mark; Schwab, Donald J.; Brose, Patrick H. 2004. Prescribed fire impacts to amphibians and reptiles in shelterwood-harvested oak-dominated forests. Virginia Journal of Science. 55(4): 159-168. [70730]
  • 82. Russell, Kevin R.; Van Lear, David H.; Guynn, David C., Jr. 1999. Prescribed fire effects on herpetofauna: review and management implications. Wildlife Society Bulletin. 27(2): 374-384. [33086]
  • 67. Lyon, L. Jack; Telfer, Edmund S.; Schreiner, David Scott. 2000. Direct effects of fire and animal responses. In: Smith, Jane Kapler, ed. Wildland fire in ecosystems: Effects of fire on fauna. Gen. Tech. Rep. RMRS-GTR-42-vol. 1. Ogden, UT: U.S. Department of Agriculture, Forest Service, Rocky Mountain Research Station: 17-23. [44435]
  • 70. Mitchell, Joseph C. 2000. Observations on amphibians and reptiles in burned and unburned forests on the upper coastal plain of Virginia. Virginia Journal of Science. 51(3): 199-203. [70704]
  • 77. Pilliod, David S.; Bury, R. Bruce; Hyde, Erin J.; Pearl, Christopher A.; Corn, Paul Stephen. 2003. Fire and amphibians in North America. In: Young, Michael K.; Gresswell, Robert E.; Luce, Charles H., guest eds. Special issue: The effects of wildland fire on aquatic ecosystems in the western USA: Selected papers from an international symposium on effects of wildland fire on aquatic ecosystems in the western USA; 2002 April 22-24; Boise, ID. In: Forest Ecology and Management. Amsterdam; London; New York: Elsevier Science B. V.; 178(1-2): 163-181. [Special Issue]. [44930]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Fire Regime Table

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Cyclicity

Comments: Mostly inactive during coldest winter months throughout most of range.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Average lifespan

Sex: female

Status: captivity:
5.5 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan/Longevity

Average lifespan

Sex: female

Status: captivity:
5.5 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 8.9 years (captivity)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Breeds in fall, lays eggs in winter (in south) or early spring. Clutch size variously reported as a dozen or so up to 80. Female remains with eggs until hatching (about 2 months). Communal nesting occurs. Aquatic larvae metamorphose in about 1.5-2 months (summer), attain sexual maturity about 18 months later.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Mating occurs in the late summer, fall, and possibly into early winter in some places. The male courts the female first by rubbing his nose on the female's nose, then he will circle around her with his tail bend at a sharp right angle. At some point the female straddles the male's tail and presses her snout on the base of his tail. Eventually the male starts moving forward and begins depositing spermatophores, while the female follows him at a close distance. The spermatophores are a jelly-like glob that are about 2 mm wide at the base, and are topped with a yellowish sperm cap. The female picks up the spermatophores and deposits them into her cloaca while pressing her snout against the male's tail. This "straddle walk" lasts for up to 20 minutes (Harding 1997, Petranka 1998).

Female four-toed salamanders migrate to nesting sites primarily from the last week of March through the second week of April, but may wait until as late as early June. Oviposition occurs from mid to late April in Michigan, but can occur as early as February in southern Alabama. Females seek out moss clumps that are just above a pool of water in swamps, bogs, marshes, vernal ponds, and slow moving streams. The nesting medium is usually raised clumps of sphagnum moss, but leaf litter, rotting logs, or grass and sedge clumps are also used. The female then locates or constructs a cavity to deposit her eggs, which takes several minutes for each one and may take several hours for the whole clutch. The eggs have a sticky outer coating, which she uses to adhere to the surrounding moss. Fifteen to 80 eggs, each between 2.5 and 3.0 mm around, are laid. More eggs tend to be laid by larger females (Harding 1997, Oliver 1955, Petranka 1998). Females often share nests and as many as 1110 eggs have been found in a single nest (Blanchard 1934). Often one or more (usually one) female will stay with the nest for a period, but they are usually gone by hatching. It is believed that the mother's skin secretions may protect the eggs by stopping fungus growth. The egg incubation period varies from 38 to 62 days depending upon the region and local site conditions. Average survivorship after hatching has been estimted from 9 to 21 percent (Harding 1997, Petranka 1998).

After hatching the larva wiggle from their nest and drop into the nearby water. They are only about 1.1 to 1.4 cm total body length at birth. During this larval stage they feed primarily on tiny zooplankton and other invertebrates. Their larval period lasts between 23-39 days, which is brief compared to other amphibians. At transformation they are only 1.7 to 2.5 cm total body length (Harding 1997, Petranka 1998).

It takes between two and three years for Hemidactylium scutatum to reach maturity. Captive specimens have lived as long as nine years but it is unknown how long wild individuals may survive (Harding 1997).

Average number of offspring: 30.

Average age at sexual or reproductive maturity (male)

Sex: male:
912 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
912 days.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Mating occurs in the late summer, fall, and possibly into early winter in some places. The male courts the female first by rubbing his nose on the female's nose, then he will circle around her with his tail bend at a sharp right angle. At some point the female straddles the male's tail and presses her snout on the base of his tail. Eventually the male starts moving forward, undulating his tail, and begins depositing spermatophores, while the female follows him at a close distance. The spermatophores are a jelly-like glob that are about 2mm wide at the base and tapers to a thin stalk, which is topped with a yellowish sperm cap. The female picks up the spermatophores and deposits them into her cloaca while pressing her snout against the male's tail. This "straddle walk" lasts for up to 20 minutes (Harding 1997, Petranka 1998).

Female four-toed salamanders migrate to nesting sites primarily from the last week of March through the second week of April, but may wait until as late as early June. Oviposition occurs from mid to late April in Michigan, but can occur as late as February in southern Alabama. Females seek out moss clumps that are just above a pool of water usually in swamps, bogs, marshes, vernal ponds, and slow moving streams. The nesting medium is usually raised clumps of sphagnum moss, but leaf litter, rotting logs, or grass and sedge clumps are also used. The female then locates or constructs a cavity to deposit her eggs, which takes several minutes for each one and may take several hours for the whole clutch. The eggs have a sticky outer coating, which she uses to adhere to the surrounding moss. Fifteen to 80 eggs, each between 2.5 and 3.0 mm in diameter, are laid. More eggs tend to be laid by larger females (Harding 1997, Oliver 1955, Petranka 1998). Females often share nests and as many as 1110 eggs have been found in a single nest (Blanchard 1934). Nest availability is thought to be a factor in this communal nesting behavior (Breitenbach 1982). Often one or more (usually one) female will stay with the nest for a period, but they are usually gone by hatching. Despite a lack of defensive behavior toward invading predators, the female's nest attendance has been found to increase embryo survival (Carreno and Harris 1998). It is believed that the mother's skin secretions may protect the eggs by impeding fungus growth. So far, no beneficial link has been established between joint nesting and embryo survival (Harris and Gill 1980). The incubation period varies from 38 to 62 days depending upon the region and local site conditions. Average survivorship after hatching has been estimted at 9 and 21 percent (Harding 1997, Petranka 1998).

After hatching the larva wiggle from their nest and drop into the nearby water. They are only about 1.1 to 1.4 cm total body length at birth. During this larval stage they feed primarily on zooplankton and other invertebrates. Their larval period lasts between 23-39 days, which is brief compared to other amphibians. At transformation they are only 1.7 to 2.5 cm total body length (Harding 1997, Petranka 1998). The sex ratio of juveniles is nearly equal (Blanchard 1935).

It takes between two and three years for H. scutatum to reach sexual maturity. Captive specimens have lived as long as nine years but it is unknown how long free-ranging individuals may survive (Harding 1997).

Average number of offspring: 30.

Average age at sexual or reproductive maturity (male)

Sex: male:
912 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
912 days.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Hemidactylium scutatum

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 81
Specimens with Barcodes: 82
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Hemidactylium scutatum

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 82 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACCCGATGACTTTTTTCAACAAATCATAAAGATATTGGCACCCTCTATTTAGTATTTGGTGCCTGAGCCGGGATGGTGGGAACAGCCCTAAGCCTCCTGATTCGCGCAGAACTAAGCCAGCCTGGAGCTCTACTAGGAGAC---GATCAGATTTATAATGTTATTGTCACCGCCCACGCCTTCGTAATAATTTTTTTTATAGTTATACCAATTATGATCGGAGGATTTGGAAACTGATTGTTGCCTTTAATAATTGGGGCCCCTGATATGGCTTTCCCTCGAATAAATAATATAAGCTTCTGGTTACTTCCGCCATCGTTTTTATTACTCCTCGCCTCTTCTATAGTAGAAGCGGGCGCCGGCACTGGGTGAACAGTATATCCACCACTTGCCGGTAATATAGCTCACGCTGGCGCCTCAGTAGATTTGACCATCTTTTCTCTTCACCTAGCAGGGGTATCTTCAATCCTAGGCGCAATTAATTTTATCACGACCTCTATTAACATAAAACCTCCATCTATATCGCAATATCAAACACCATTGTTTGTTTGATCAGTATTGATTACTGCTATCCTTTTATTATTATCCCTACCAGTATTAGCTGCCGGAATCACAATGTTGTTAACAGATCGAAACCTTAATACTACATTTTTTGACCCTGCAGGCGGTGGAGACCCGGTACTCTATCAACACCTATTCTGGTTTTTTGGCCACCCTGAGGTCTACATTTTAATTCTACCGGGGTTCGGAATAATTTCACATATTGTGACATACTACTCAGCCAAAAAAGAACCGTTTGGATATATAGGCATAGTTTGGGCAATGATATCCATTGGACTTCTAGGGTTTATTGTTTGAGCTCACCACATGTTTACAGTAGACCTTAACGTAGACACACGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N4 - Apparently Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: Widely but discontinuously distributed throughout much of the eastern U.S. and adjacent Canada; secretive species that is proving to be more abundant and widespread than previously available records indicated; secure.

Intrinsic Vulnerability: Moderately vulnerable

Environmental Specificity: Narrow. Specialist or community with key requirements common.

Comments: Moderately specific about egg laying sites and larval habitat.

Other Considerations: Does not require pristine habitat; Phillips et al. (1999) noted that in Illinois "several localities are second-growth woods in soggy soils below dams of man-made lakes."

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2004

Assessor/s
Geoffrey Hammerson

Reviewer/s
Global Amphibian Assessment Coordinating Team (Simon Stuart, Janice Chanson, Neil Cox and Bruce Young)

Contributor/s

Justification
Listed as Least Concern in view of its wide distribution, presumed large population, and because it is unlikely to be declining fast enough to qualify for listing in a more threatened category.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The four-toed salamander is thought to be in a state of decline throughout its range due primarily to its specialized habitat requirements combined with destruction, degradation, and fragmentation of wetlands and forests. Even in the north and east, where the four-toed salamander's range is more continuous, it only occurs in small isolated colonies where suitable wetland-woodland habitats exist.

Hemidactylium_scutatum is currently listed as endangered in Indiana and Minnesota, threatened in Illinios, and has special concern or rare status in Wisconsin, Ohio, and Missouri (Lannoo 1998). To improve conservation efforts, people should be educated on the vulnerability and value of the species.

To improve and increase habitat for the four-toed salamander, mature, closed canopy hardwood forests should be preserved. Downed woody debris should be left in place or added to these forests. Shallow vernal pools can be created within these woodlands and raised hummucks of earth can be added in and around the pool to promote growth of spagnum moss and sedges (Petranka 1998).

Individuals are likely killed crossing roads while migrating to and from breeding sites. As a preventative measure, "'critter-culverts" can be installed in areas of high road kill risk to allow salamanders to pass underneath roads to and from their breeding sites.

IUCN Red List of Threatened Species: least concern

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The four-toed salamander is thought to be in a state of decline throughout its range due primarily to its specialized habitat requirements in conjunction with destruction, degradation, and fragmentation of wetlands and forests. Even in the north and east, where the four-toed salamander's range is more continuous, it only occurs is small isolated colonies where suitable wetland-woodland interfaces exist. Additionally, the low dispersal ability of this salamander hinders it from recolonizing suitable habitat once it has been extirpated from an area (Harding 1997).

Hemidactylium scutatum is currently listed as endangered in Indiana and Minnesota, threatened in Illinios, and has special concern or rare status in Wisconsin, Ohio, and Missouri (Lannoo 1998). To improve conservation efforts, people should be educated on the vulnerability and value of the species.

To improve and increase habitat for the four-toed salamander, mature, closed canopy, mesic hardwood forests should be preserved. Downed woody debris should be left in place or added to these forests. Shallow vernal pools can be created within these woodlands and raised hummucks of earth can be added in and around the pool to promote growth of spagnum moss and sedges (Petranka 1998). The creation of suitable habitat between two populations, or "corridors," could also be investigated where two fragmented populations in close proximity exist.

Individuals are likely killed crossing roads while migrating to and from breeding sites. As a preventative measure, "'critter-culverts" can be installed in areas of high road kill risk to allow salamanders to pass underneath roads to and from their breeding sites.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Short Term Trend: Relatively stable (=10% change)

Comments: Probably relatively stable overall.

Global Long Term Trend: Increase of 10-25% to decline of 30%

Comments: Likely stable in extent of occurrence, probably less than 25% decline in population size, area of occurrence, and number/condition of occurrences, but data are scant.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The total adult population size is unknown but surely exceeds 10,000 and might exceed 100,000. The species is more abundant than available records indicate, being relatively difficult to find. Its population is probably relatively stable overall.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Degree of Threat: Medium

Comments: Primary potential threat is loss/degradation of habitat, but this is ameliorated in some areas by wetland protection regulations. However, colonies may be more or less isolated by the species' relatively restricted habitat preferences, and development of intervening uplands may inhibit dispersal and colonization of new habitats (Harding 1997). Populations may flourish in many moderately developed and semi-rural areas in southern New England (Klemens 1993). Road mortality does not appear substantial when compared to many species of frogs and AMBYSTOMA salamanders (Klemens 1993). Impoundments likely have reduced the range in some areas (Means 1992). Tolerant of nondestructive intrusion.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Major Threats
Primary potential threat is loss/degradation of habitat, but this is ameliorated in some areas by wetland protection regulations. However, colonies might be more or less isolated by the species' relatively restricted habitat preferences, and development of intervening uplands might inhibit dispersal and colonization of new habitats (Harding 1997). Populations may flourish in many moderately developed and semi-rural areas in southern New England (Klemens 1993). Road mortality does not appear substantial when compared to many species of frogs and Ambystoma salamanders (Klemens 1993). Impoundments likely have reduced the range in some areas (Means 1992). It is tolerant of non-destructive intrusion.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Global Protection: Very many (>40) occurrences appropriately protected and managed

Comments: Many occurences are adequately protected.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation Actions

Conservation Actions
Many populations are adequately protected.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management Considerations

More info for the terms: association, basal area, bog, cover, density, direct effects of fire, duff, fire management, fire regime, hardwood, litter, mesic, prescribed fire, presence, selection, severity, shrubs, succession, tree, wildfire

Status: Little is known regarding four-toed salamander population trends. A population in Great Smoky Mountains National Park appeared stable, but much more data were needed to detect population change [27]. A review of four-toed salamander in Wisconsin notes four-toed salamander rarity and suggests that more information, including basic data on distribution, is needed [92].

Threats: According to reviews, major threats to four-toed salamanders are the loss, degradation, and fragmentation of habitat [88]. Reduction of hydroperiods, decreases in pH of ponds, and increases in water temperature and sedimentation can have negative impacts on four-toed salamander larvae [17,88]. For more information on the direct and indirect effects of changes to water quality, see Bol and others [17]. Removal or compaction of living and dead ground cover limits the availability of adult habitat. Fragmentation could restrict movement to breeding grounds and between populations [17]. Roads may pose dispersal barriers and result in substantial mortality if located along migration routes [17,34,83]

For speculation on possible effects of climate change on four-toed salamanders in Nova Scotia, see Herman and Scott [52].

Forest management: Reduced cover of canopy trees, leaf litter, and well-decayed coarse woody debris likely contribute to the negative response and long recovery times of salamanders after timber harvesting. Detrimental effects of tree harvesting on salamanders have been documented in the southern Appalachians [5,46,55,75,76], Pennsylvania [81], and New York [78]. In low-elevation hardwood forests of southwestern Virginia, terrestrial salamanders were significantly reduced following a clearcut (P=0.001), a leave-tree (P=0.001), a group selection (P=0.005), and 2 shelterwood (P=0.005) treatments, while terrestrial salamander abundance did not change on untreated sites or sites where the understory was removed with herbicide. Canopy cover and leaf litter cover were greatest on the control and the understory removal treatments. These plots also had higher leaf litter moisture and cooler soil temperatures [46]. In Pennsylvania there was a significant positive relationship (P=0.01) between retained basal area of harvested stands and salamander species richness. The relative abundance of salamanders also increased significantly (P<0.001) with increasing basal areas greater than 15 m²/ha [81]. In the southern Blue Ridge Mountains of North Carolina, Plethodontid salamanders were reduced by 30% to 50% in the 1st year and nearly 100% by the 2nd year following clearcutting. Recovery of salamanders began 4 to 6 years following timber harvesting and seemed correlated with litter layer development. Projections based on up to 15 years of data collected after timber harvesting in the southern Blue Ridge Mountains suggest that salamanders would reach predisturbance levels from 20 to 24 years following clearcutting [5]. Estimated recovery times in western North Carolina were more than 50 years [75,76]. In hardwood stands in New York, recently disturbed stands had significantly (P<0.05) fewer eastern red-backed salamanders than adjacent old-growth controls, while abundance was similar on old-growth and 60-year-old second-growth stands [78]. DeMaynadier and Hunter [34] provide a comprehensive review of salamander responses to timber harvesting based on the literature as of 1995.

Effects of logging on four-toed salamanders may be mitigated to varying extents by minimizing the extent of thinning [17,81]; incorporating undisturbed buffer strips around wetlands, ponds, and streams; reducing impacts to microhabitats such as moss and grass tussocks, leaf litter, and coarse woody debris; and reducing soil compaction by limiting disturbance to periods when soils are frozen or dry [17,34,75,83]. For specific recommendations for timber harvesting in four-toed salamander habitat in the Northeast, see Bol and others [17].

Protecting breeding habitat and surrounding mature forest has been suggested to maintain salamander populations from disturbance [25,34,69,75]. Several sources note the importance of maintaining complexes of mature forests used by adults and the pools and wetlands used by larvae in a mosaic that allows for movement between adult and larval habitat as well as dispersal between nesting areas [17,25,27,69]. FIRE EFFECTS AND MANAGEMENT SPECIES: Hemidactylium scutatum

 

  Prescribed fire on the Nantahala National Forest, North Carolina. USDA Forest Service photo.

There is very little information regarding the effects of fire on four-toed salamanders. The following discussion is based primarily on effects of fire on closely related salamanders occupying similar habitats and/or having similar life histories, and potential responses of the four-toed salamander to changes observed in habitats occupied by four-toed salamander following fire and other disturbances. Most comparisons to other salamander species are to species in the same family. Despite similarities, the species within the Plethodontidae family are variable and comparisons are speculative.

Several of the studies discussed below have limitations due to small sample sizes, short-term study periods, little or no replication, no prefire data, and/or no controls [77,82]. Reviews of the effect of fire on amphibians from 1999 [82] and 2003 [77] are frequently cited in this section.

DIRECT FIRE EFFECTS:
Despite their susceptibility to desiccation and use of the forest floor, evidence as of 2008 suggests that most salamanders typically avoid direct effects of fire by retreating to underground burrows or moist refugia [67,77,82]. Capture rates of 4 Plethodontid salamander species in southwestern North Carolina were not significantly altered following a spring prescribed fire [39]. Characteristics of salamander communities, such as richness, abundance, and diversity, were not significantly affected by spring prescribed fire in a Piedmont upland woodland in South Carolina [38] or winter prescribed fire in bottomland hardwood forest in Georgia [71]. Relative abundance of salamanders in a southern Appalachian upland hardwood forest in South Carolina was not significantly different between plots that were burned under prescription, had the understory removed before prescribed burning, or were untreated [43]. Relative abundance of amphibians on oak-dominated stands of the Virginia Piedmont, including eastern red-back salamanders, was not significantly different between unburned and fall-, winter-, or spring-burned sites [61].

However, fewer captures of salamanders on burned sites compared to unburned sites [38,44,69,70] and mortalities of eastern red-backed salamanders sheltering under dead logs [70] indicate the potential for negative effects of fire on adult four-toed salamanders. Four-toed salamanders have not been observed on recently burned sites. On the Atlantic coastal plain in Maryland, 20 four-toed salamanders were captured in unburned pine-mixed-hardwood habitat, while none was captured in a repeatedly burned loblolly pine site. This difference was statically significant (P<0.01). The burned site was the same distance as the unburned site from a marshy area likely used for nesting, but it was 790 feet (240 m) farther from the nearest wetland than the unburned site [69]. Unmanaged mixed-hardwood stands had higher amphibian relative abundance and surface activity than 2 regularly but infrequently burned pine plantations in South Carolina [44].

According to a review, aquatic life stages of salamanders are typically sheltered from direct effects of fire, so mortality is rarely documented [77]. However, larval mortality could occur if water was heated to lethal temperatures or if temperatures reached stressful levels, likely above 77 °F (25 °C) [88], for several hours. Heat can also lead to lethal chemical changes in water [77].

Fires occurring during inactive periods such as late summer or winter would likely be least detrimental to four-toed salamanders, since use of underground burrows is more common during these periods (see Cover Requirements). The use of moist sites suggests that four-toed salamander eggs are seldom exposed to lethal fires. The higher surface-to-volume ratio of juveniles makes them more susceptible to drying [37,88]. Therefore, juveniles may be even more restricted to moist environments than adults [5,37] and may be exposed to fire less often than adults.

HABITAT RELATED FIRE EFFECTS:
Four-toed salamander larvae may be impacted by changes to stream pool and woodland pond habitats following fire. Alterations to adult habitat that are likely to have the largest impact on four-toed salamanders are changes to canopy cover and ground cover including mosses, leaf litter, and coarse woody debris. Other changes that could impact four-toed salamanders are changes in landscape-level habitat configuration and declines in prey availability.

Effects on aquatic habitat: Fire can have beneficial or detrimental impacts on the availability of nesting sites and larval pools, wetlands, and ponds. According to a review, fires can prevent succession of aquatic habitats such as bogs to hardwood forest; succession would reduce water levels and, presumably, available larval habitat [82]. Reduction in vegetation also reduces evapotranspiration, raising water levels and providing more potential larval habitat [77]. Woody debris that falls following fire can create new pools for nesting and larval habitat [56]. However, consumption of nesting vegetation and other substrates by fire would likely negatively impact habitat, particularly because of four-toed salamander's apparent fidelity to nesting ponds [50].

If erosion and sedimentation occur following fire, availability of breeding sites may be reduced temporarily. The California newt (Taricha torosa), a species that nests in deep, slow-moving water, laid fewer egg masses following a chaparral wildfire that reduced the number of runs and pools in a nesting stream [41]. A review suggests that impacts of sedimentation on nesting habitat may be greater in streams with low gradients [34], such as those used by four-toed salamander larvae [88]. According to a review, sediment in streams can reach 100 times typical levels and persist for over 10 years following severe fires. Nevertheless, effects of fire and the resulting sedimentation on pond-breeding amphibians could be negligible in most circumstances [77].

Characteristics of larval habitats that may be impacted by fire include temperature, nutrient input, productivity, pH, evaporation rate, morphology, and water-holding capacity [34,74,77]. Reviews suggest that fire typically results in a temporary increase in pH [64,72]. This could potentially benefit acid-sensitive species [84]. Although four-toed salamanders can occur in acidic water, they may be sensitive to low pH (see Aquatic habitats). Characteristics of temporary ponds, including pH, were not significantly altered by prescribed fire on low-elevation sites of South Carolina [84].

Effects on terrestrial habitat Effects on ground cover: Given the importance of the litter layer in providing cover for four-toed salamanders, fire-caused alterations are likely detrimental [77,82] because soil temperature fluctuations can increase [84], moisture in the leaf litter can decline [4,5,38], and soil moisture may decline (Barnes and Van Lear 1998, cited in [38]). McLeod and Gates [69] suggest that four-toed salamander absence from a repeatedly burned loblolly pine stand and presence in the unburned stand were related to the cooler, moister microenvironment provided by leaf litter, canopy cover, and dense hardwood trees.

Fire often reduces leaf litter and other ground cover in salamander habitat [43,61,62,69,71,84]. A mixed pine-hardwood site occupied by four-toed salamander had significantly greater litter depth than an unoccupied burned site on the Atlantic coast plain of Maryland [69]. Similar changes have been observed following fire in other areas within the four-toed salamander's distribution. In south-central Pennsylvania, average litter cover the spring following a fall fire was 52.3%, and the litter layer averaged 0.5 inch (1.15 cm) deep, compared to 76.8% average litter cover and an average litter depth of 2.8 inches (7.15 cm) on an adjacent unburned site. Living ground cover was also reduced, with the unburned site having 13.7% cover of shrubs and mosses and the burned site lacking living ground cover. On the burned site cover of mineral soil was 27.6%, while on the unburned site it was only 0.1% [62]. In bottomland hardwood forests in Georgia, litter was significantly deeper (P<0.025) and percent cover of bare ground was significantly smaller (P<0.003) on unburned plots compared to burned plots [71]. Prescribed fires and understory removal followed by prescribed fires resulted in significantly (P<0.0001) reduced leaf litter compared to untreated plots in southern Appalachian upland hardwood forest in North Carolina [43].

Loss of leaf litter may also affect four-toed salamanders by reducing the availability of prey. If four-toed salamanders feed only in wet litter, as is the case with eastern red-backed salamanders [58], reduction of leaf litter likely reduces foraging habitat. Reductions in leaf litter associated with timber harvesting resulted in a decline in the abundance of macroarthropods in the leaf litter in the southern Appalachians [85]. See Food Habits for a discussion of the possible repercussions of reduced food availability on four-toed salamanders.

The litter that accumulates within a few years of a disturbance apparently provides adequate habitat for salamanders, suggesting that impacts to certain four-toed salamander habitat features may be short lived. In northern hardwoods of New Hampshire the amount of leaf litter increased from nearly zero to as much as 20% of precutting levels within 4 years of clearcutting [28]. Plethodontid salamanders in the southern Blue Ridge Mountains of North Carolina were detected in clearcut stands 4 to 6 years after harvesting, which coincided with development of the litter layer [5]. Differences in leaf litter depth between burned and control sites in a southern Appalachian deciduous forest in eastern Tennessee were no longer significant 3 years following fire [40]. Living ground cover was similar in burned and unburned vegetation by the end of the summer following a fall fire in south-central Pennsylvania [62].

Moss provides cover, foraging habitat, and nesting habitat for four-toed salamanders on many sites, so the impact of fire on moss will likely influence four-toed salamanders. Recovery of moss following fire varies with species [2,63]. For instance, juniper haircap moss (Polytrichum juniperinum) can colonize sites within 4 years of fire, while late-successional species such as splendid feather moss (Hylocomium splendens) may take over 50 years to reach prefire levels. A bog in western Canada experienced substantial colonization of upright haircap moss (Polytrichum strictum) within 2 years of fire, with greater colonization in low, wet areas. Colonization of upright haircap moss appeared to facilitate the establishment of sphagnum mosses [7]. Mosses often used by four-toed toed salamander are discussed in Nest sites.

Effects on coarse woody debris: Reduction in coarse woody debris due to fire may negatively impact four-toed salamanders. A loblolly pine stand in Maryland that was repeatedly burned under prescription had significantly (P<0.05) less coarse woody debris and significantly (P<0.01) fewer four-toed salamanders than an unburned mixed pine-hardwood stand [69].

The consistent moisture levels of coarse woody debris may provide refuge for salamanders following fires that consume substantial amounts of leaf litter. Presence of coarse woody debris following disturbance may be especially important on dry sites [71,75]. As of 2008, information on loss of large amounts of coarse woody debris from wildfire in salamander habitats in the eastern United States was lacking; most of the studies described here investigate the impacts of low-severity fires [43,61,71].

Some fires increase coarse woody debris and could increase nesting habitat by blocking streams, forming pools and/or providing substrates where females can lay eggs. Following a mixed-severity wildfire in western Montana, potential long-toed salamander (Ambystoma macrodactylum) breeding sites increased due to fallen trees blocking intermittent streams and creating new pools [56].

Effects on canopy cover: Increases in solar radiation could reduce habitat quality for four-toed salamanders (see Canopy cover). The significant (P<0.05) reductions in canopy cover and deciduous tree density on repeatedly burned loblolly pine sites in Maryland were suggested as possible explanations for four-toed salamander absence from the repeatedly burned sites [69]. Increased light may reduce habitat quality due to higher temperatures, greater UV-B exposure [77], and drier vegetation around ponds. However, increased productivity and longer hydroperiods due to reduced evapotranspiration following reduction in canopy cover could potentially benefit salamanders [87]. For more information, see Aquatic habitats.

Landscape-scale considerations: Reduction in four-toed salamander microhabitats could interfere with successful migration into nesting ponds and/or dispersal between populations. Desiccation and predation likely pose greater risks to salamanders migrating or dispersing through burned habitat than to those in unburned habitat [20,77,84]. The consistent use of the same nesting ponds by four-toed salamanders in northern Virginia [50] and the generally low mobility of salamanders suggest obstructions to movement could compromise the long-term persistence of four-toed salamanders at a given site [69].

Landscape-scale factors such as distance to water and topography may have greater influences on salamanders than fire. Distance to water and mesic aspects were significantly (P≤0.032) associated with eastern red-backed salamander captures in oak-dominated forest in the Virginia Piedmont, while fire treatments were not [61]. Slope location had more impact on salamander abundance in southwestern North Carolina than prescribed fire treatments. This may be partly related to differences in severity on different parts of the slope (see next paragraph) [39].

Fire Characteristics: Although high-severity fires are rare in the moist habitats occupied by four-toed salamanders (see Fire Ecology), they would likely have large, long-term impacts. Little of the current information on salamanders' response to fire is based on high-severity fires [38,71]. Although a fire in southwestern North Carolina was severe in upland areas, in midslope and riparian areas the fire consumed comparatively little vegetation [39]. The most severe fire in a southern Appalachian upland hardwood forest resulted in 25% tree mortality and insignificant impacts on coarse woody debris or duff depths [43]. High-severity fires would be more likely to consume coarse woody debris, burn deep into litter and duff, and reduce canopy cover. Many shelters would likely be consumed, leaving salamanders more vulnerable to overheating or desiccation. After a fire in the Jemez Mountains of New Mexico, 24-hour average daily temperatures in potential salamander shelters were much higher in areas burned in high-severity and moderate-severity fires than those burned in low-severity fires [31]. For a discussion of the effect of canopy removal and ground disturbance on four-toed salamanders, see Forest management.

It has been suggested that large wildfires that occur during dry periods, when salamanders are generally limited to damp areas or underground burrows, may have less impact on salamanders than prescribed fires that are more likely to occur in moist or humid conditions when salamanders are active [21]. Fire during periods of four-toed salamander activity, such as the spring migratory and nesting and fall breeding seasons, could result in greater mortality due to more individuals being caught in exposed areas or migrating through recently burned areas [77,84]. However, season of burning (spring, winter, or summer) did not influence eastern red-back salamanders or amphibians in general in shelterwood-harvest oak forests of the Virginia Piedmont [61].

Frequent fires are likely to have greater impacts on four-toed salamanders and their habitat than single or infrequent fires [38,69]. A loblolly pine site that burned 5 or 6 times in 11 years had significantly fewer four-toed salamanders than a nearby unburned pine-mixed hardwood site. Repeated burning likely explains the significant (P<0.05) reductions in habitat characteristics important to salamanders such as coarse woody debris and canopy cover [69]. Data from timber harvesting studies suggest that long return-intervals of severe disturbances would minimize impacts on salamanders [55] and the litter layer [1].

Fire Ecology: Four-toed salamanders occur in forests with varied FIRE REGIMES (see the Fire Regime Table of plant communities with four-toed salamanders). Their association with moist areas near pools, streams, and other aquatic habitats suggests that their habitat would generally burn less frequently than upland forest types. Drought likely increases the risk of fire in four-toed salamander habitat. For more information on FIRE REGIMES within the four-toed salamander's range, see the FEIS reviews of the dominant plant species in four-toed salamander habitats, such as pitch pine, eastern white pine, white oak, and sugar maple (Acer saccharum), and the Fire Regime Table.

FIRE
The lack of data addressing the impacts of fire on four-toed salamanders limits the generalizations that can be made regarding fire in four-toed salamander habitats. However, it is likely that low-severity, infrequent fires have few impacts on four-toed salamanders. Fires during or prior to active periods are likely to have greater impacts than fires at other times, since salamanders would be directly exposed to fire or recently burned habitats. It has been recommended that some portion of forests near nesting and larval habitat be maintained in an undisturbed, mature state to ensure the long-term persistence of salamanders, such as four-toed salamanders, with high nesting site fidelity and low dispersal ability that require cool, moist forest floors [44,69]. Prescribed burning may benefit some four-toed salamander larval habitats by increasing hydroperiods and food availability [77]. More information on four-toed salamander response to fires of varying severities are needed [77,82], including postfire dispersal ability and population-level effects of changes in microsite temperatures, litter and soil moisture levels, and water chemistry [77].

Due to potential negative impacts on amphibians, plowing firebreaks is discouraged around wetlands, and the Forest Service no longer uses retardants containing sodium ferrocyanide in riparian areas [9,77].
  • 5. Ash, Andrew N. 1997. Disappearance and return of Plethodontid salamanders to clearcut plots in the southern Blue Ridge Mountains. Conservation Biology. 11(4): 983-989. [70716]
  • 7. Benscoter, Brian W. 2006. Post-fire bryophyte establishment in a continental bog. Journal of Vegetation Science. 17: 647-652. [64980]
  • 20. Bull, Evelyn L.; Wales, Barbara C. 2001. Effects of disturbance on amphibians of conservation concern in eastern Oregon and Washington. Northwest Science. 75: 174-179. [43157]
  • 25. Chalmers, Rebecca J.; Loftin, Cynthia S. 2006. Wetland and microhabitat use by nesting four-toed salamanders in Maine. Journal of Herpetology. 40(4): 478-485. [69117]
  • 27. Corser, Jeffrey D.; Dodd, C. Kenneth, Jr. 2004. Fluctuations in a metapopulation of nesting four-toed salamanders, Hemidactylium scutatum, in the Great Smoky Mountains National Park, USA, 1999-2003. Natural Areas Journal. 24(2): 135-140. [69119]
  • 37. Feder, Martin E. 1983. Integrating the ecology and physiology of Plethodontid salamanders. Herpetologica. 39(3): 291-310. [70727]
  • 46. Harpole, Douglas N.; Haas, Carola A. 1999. Effects of seven silvicultural treatments on terrestrial salamanders. Forest Ecology and Management. 114: 349-356. [70738]
  • 50. Harris, Reid N.; Ludwig, Patrice M. 2004. Resource level and reproductive frequency in female four-toed salamanders, Hemidactylium scutatum. Ecology. 85(6): 1585-1590. [69155]
  • 52. Herman, T. B.; Scott, F. W. 1994. Protected areas and global climate change: assessing the regional or local vulnerability of vertebrate species. In: Pernetta, John; Leemans, Rik; Elder, Danny; Humphrey, Sarah, eds. Impacts of climate change on ecosystems and species: implications for protected areas. Gland, Switzerland: International Union for Conservation of Nature and Natural Resources: 13-27. [69124]
  • 55. Hicks, Norman G.; Pearson, Scott M. 2003. Salamander diversity and abundance in forests with alternative land use histories in the southern Blue Ridge Mountains. Forest Ecology and Management. 177: 117-130. [70739]
  • 58. Jaeger, Robert G. 1980. Fluctuations in prey availability and food limitation for a terrestrial salamander. Oecologia. 44: 335-341. [70713]
  • 69. McLeod, Roderick F.; Gates, J. Edward. 1998. Response of herpetofaunal communities to forest cutting and burning at Chesapeake Farms, Maryland. The American Midland Naturalist. 139: 164-177. [27869]
  • 71. Moseley, Kurtis R.; Castleberry, Steven B.; Schweitzer, Sara H. 2003. Effects of prescribed fire on herpetofauna in bottomland hardwood forests. Southeastern Naturalist. 2(4): 475-486. [62076]
  • 74. Paton, Peter; Stevens, Sara; Longo, Linda. 2000. Seasonal phenology of amphibian breeding and recruitment at a pond in Rhode Island. Northeastern Naturalist. 7(3): 255-269. [69159]
  • 75. Petranka, James W.; Brannon, M. Patrick; Hopey, Mark E.; Smith, Charles K. 1994. Effects of timber harvesting on low elevation populations of southern Appalachian salamanders. Forest Ecology and Management. 67: 135-147. [24407]
  • 78. Pough, F. Harvey; Smith, Ellen M.; Rhodes, Donald H.; Collazo, Andres. 1987. The abundance of salamanders in forest stands with different histories of disturbance. Forest Ecology and Management. 20: 1-9. [70715]
  • 81. Ross, Brad; Fredericksen, Todd; Ross, Eric; Hoffman, Wayne; Morrison, Michael L.; Beyea, Jan; Lester, Michael B.; Johnson, Bradley N.; Fredericksen, Nell J. 2000. Relative abundance and species richness of herpetofauna in forest stands in Pennsylvania. Forest Science. 46(1): 139-146. [37023]
  • 83. Saugey, David A.; Trauth, Stanley E. 1991. Distribution and habitat utilization of the four-toed salamander, Hemidactylium scutatum, in the Ouachita Mountains of Arkansas. Proceedings Arkansas Academy of Science. 45: 88-91. [69129]
  • 85. Seastedt, T. R.; Crossley, D. A., Jr. 1981. Microarthropod response following cable logging and clear-cutting in the southern Appalachians. Ecology. 62(1): 126-135. [70742]
  • 87. Skelly, David K.; Werner, Earl E.; Cortwright, Spencer A. 1999. Long-term distributional dynamics of a Michigan amphibian assemblage. Ecology. 80(7): 2326-2337. [70703]
  • 88. Thurow, Gordon R. 1997. Observations on Hemidactylium scutatum habitat and distribution. Bulletin of the Chicago Herpetological Society. 32(1): 1-6. [69130]
  • 2. Ahlgren, C. E. 1974. Effects of fires on temperate forests: north central United States. In: Kozlowski, T. T.; Ahlgren, C. E., eds. Fire and ecosystems. New York: Academic Press: 195-223. [7198]
  • 1. Aber, John D.; Botkin, Daniel B.; Melillo, J. M. 1978. Predicting the effects of different harvesting regimes on forest floor dynamics in northern hardwoods. Canadian Journal of Forest Research. 8: 306-315. [70733]
  • 4. Ash, Andrew N. 1995. Effects of clear-cutting on litter parameters in the southern Blue Ridge Mountains. Castanea. 60(2): 89-97. [70732]
  • 9. Bishop, David C.; Haas, Carola A. 2005. Burning trends and potential negative effects of suppressing wetland fires on flatwoods salamanders. Natural Areas Journal. 25(3): 290-294. [55610]
  • 21. Bury, R. Bruce; Major, Donald J.; Pilliod, David. 2002. Responses of amphibians to fire disturbance in Pacific Northwest forests: a review. In: Ford, W. Mark; Russell, Kevin R.; Moorman, Christopher E., eds. The role of fire in nongame wildlife management and community restoration: traditional uses and new directions: Proceedings of a special workshop; 2000 December 15; Nashville, TN. Gen. Tech. Rep. NE-288. Newtown Square, PA: U.S. Department of Agriculture, Forest Service, Northeastern Research Station: 34-42. [41553]
  • 28. Covington, W. Wallace. 1981. Changes in forest floor organic matter and nutrient content following clear cutting in northern hardwoods. Ecology. 62(1): 41-48. [70734]
  • 31. Cummer, Michelle R.; Painter, Charles W. 2007. Three case studies of the effect of wildfire on the Jemez Mountains salamander (Plethodon neomexicanus): microhabitat temperatures, size distributions, and a historical locality perspective. The Southwestern Naturalist. 52(1): 26-37. [66820]
  • 34. deMaynadier, Phillip G.; Hunter, Malcolm L., Jr. 1995. The relationship between forest management and amphibian ecology: a review of the North American literature. Environmental Review. 3: 230-261. [34380]
  • 38. Floyd, Thomas M.; Russell, Kevin R.; Moorman, Christopher E.; Van Lear, David H.; Guynn, David C., Jr.; Lanham, J. Drew. 2002. Effects of prescribed fire on herpetofauna within hardwood forests of the Upper Piedmont of South Carolina: a preliminary analysis. In: Outcalt, Kenneth W., ed. Proceedings, 11th biennial southern silvicultural research conference; 2001 March 20-22; Knoxville, TN. Gen. Tech. Rep. SRS-48. Asheville, NC: U.S. Department of Agriculture, Forest Service, Southern Research Station: 123-127. [41467]
  • 39. Ford, William M.; Menzel, M. Alex; McGill, David W.; Laerm, Joshua; McCay, Timothy S. 1999. Effects of a community restoration fire on small mammals and herpetofauna in the southern Appalachians. Forest Ecology and Management. 114(2-3): 233-243. [30070]
  • 40. Gagan, Alison Baird. 2002. The effects of prescribed fire on millipede and salamander populations in a southern Appalachian deciduous forest. Johnson City, TN: East Tennessee State University. 37 p. Thesis. [70736]
  • 41. Gamradt, Seth C.; Kats, Lee B. 1997. Impact of chaparral wildfire-induced sedimentation on oviposition of stream-breeding California newts (Taricha torosa). Oecologia. 110(4): 546-549. [30067]
  • 43. Greenberg, Cathryn H.; Waldrop, Thomas A. 2008. Short-term response of reptiles and amphibians to prescribed fire and mechanical fuel reduction in a southern Appalachian upland hardwood forest. Forest Ecology and Management. 255(7): 2883-2893. [70707]
  • 44. Hanlin, Hugh G.; Martin, F. Douglas; Wike, Lynn D.; Bennett, Stephen H. 2000. Terrestrial activity, abundance and species richness of amphibians in managed forests in South Carolina. The American Midland Naturalist. 143(1): 70-83. [62069]
  • 56. Hossack, Blake R.; Corn, Paul Stephen. 2007. Responses of pond-breeding amphibians to wildfire: short-term patterns in occupancy and colonization. Ecological Applications. 17(5): 1403-1410. [69779]
  • 61. Keyser, Patrick D.; Sausville, David J.; Ford, W. Mark; Schwab, Donald J.; Brose, Patrick H. 2004. Prescribed fire impacts to amphibians and reptiles in shelterwood-harvested oak-dominated forests. Virginia Journal of Science. 55(4): 159-168. [70730]
  • 62. Kirkland, Gordon L., Jr.; Snoddy, Heather W.; Amsler, Teresa L. 1996. Impact of fire on small mammals and amphibians in a central Appalachian deciduous forest. The American Midland Naturalist. 135(2): 253-260. [26746]
  • 63. Kirkpatrick, Helen Elizabeth. 1990. Resource competition between two co-occurring species of Polytrichum. Ann Arbor, MI: The University of Michigan. 153 p. Dissertation. [69447]
  • 64. Knoepp, Jennifer D.; DeBano, Leonard F.; Neary, Daniel G. 2005. (revised 2008). Chapter 3: soil chemistry. In: Neary, Daniel G.; Ryan, Kevin C.; DeBano, Leonard F., eds. Wildland fire in ecosystems: Effects of fire on soil and water. Gen. Tech. Rep. RMRS-GTR-42-vol. 4. Ogden, UT: U.S. Department of Agriculture, Forest Service, Rocky Mountain Research Station: 53-72. [55887]
  • 72. Neary, Daniel G.; Landsberg, Johanna D.; Tiedemann, Arthur R.; Ffolliott, Peter F. 2005. (revised 2008). Chapter 6: water quality. In: Neary, Daniel G.; Ryan, Kevin C.; DeBano, Leonard F., eds. Wildland fire in ecosystems: Effects of fire on soil and water. Gen. Tech. Rep. RMRS-GTR-42-vol. 4. Ogden, UT: U.S. Department of Agriculture, Forest Service, Rocky Mountain Research Station: 119-134. [55891]
  • 76. Petranka, James W.; Eldridge, Matthew E.; Haley, Katherine E. 1993. Effects of timber harvesting on southern Appalachian salamanders. Conservation Biology. 7(2): 363-370. [70740]
  • 82. Russell, Kevin R.; Van Lear, David H.; Guynn, David C., Jr. 1999. Prescribed fire effects on herpetofauna: review and management implications. Wildlife Society Bulletin. 27(2): 374-384. [33086]
  • 84. Schurbon, Jamie M.; Fauth, John E. 2003. Effects of prescribed burning on amphibian diversity in a southeastern U.S. national forest. Conservation Biology. 17(5): 1338-1349. [47644]
  • 67. Lyon, L. Jack; Telfer, Edmund S.; Schreiner, David Scott. 2000. Direct effects of fire and animal responses. In: Smith, Jane Kapler, ed. Wildland fire in ecosystems: Effects of fire on fauna. Gen. Tech. Rep. RMRS-GTR-42-vol. 1. Ogden, UT: U.S. Department of Agriculture, Forest Service, Rocky Mountain Research Station: 17-23. [44435]
  • 70. Mitchell, Joseph C. 2000. Observations on amphibians and reptiles in burned and unburned forests on the upper coastal plain of Virginia. Virginia Journal of Science. 51(3): 199-203. [70704]
  • 17. Bol, Leslie; Massachusetts Division of Fisheries and Wildlife, Department of Fish and Game, Natural Heritage and Endangered Species Program. 2007. Massachusetts forestry conservation management practices for four-toed salamanders: Draft (August 2007), [Online]. Westborough, MA: Massachusetts Division of Fisheries and Wildlife, Department of Fish and Game, Natural Heritage and Endangered Species Program (Producer). Available: http://www.mass.gov/dfwele/dfw/nhesp/regulatory_review/pdf/fourtoed_salamander_cmp.pdf [2008, June 24]. [70447]
  • 77. Pilliod, David S.; Bury, R. Bruce; Hyde, Erin J.; Pearl, Christopher A.; Corn, Paul Stephen. 2003. Fire and amphibians in North America. In: Young, Michael K.; Gresswell, Robert E.; Luce, Charles H., guest eds. Special issue: The effects of wildland fire on aquatic ecosystems in the western USA: Selected papers from an international symposium on effects of wildland fire on aquatic ecosystems in the western USA; 2002 April 22-24; Boise, ID. In: Forest Ecology and Management. Amsterdam; London; New York: Elsevier Science B. V.; 178(1-2): 163-181. [Special Issue]. [44930]
  • 92. Whitaker, John O., Jr.; Minton, Sherman A., Jr. 1988. Reptiles and amphibians. In: Whitaker, John O., Jr.; Gammon, James R., [eds.]. Endangered and threatened vertebrate animals of Indiana their distribution and abundance. Monograph No. 5. Indianapolis, IN: Indiana Academy of Science: 67-86. [69139]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

The four-toed salamander is completely harmless to humans and their interests.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Forest dwelling salamanders, in general, have been shown to be very important contributers to nutrient cycling and energy flow in forest ecosystems. Therefore, they are important for the health and balance of forest systems as both predator and prey. While Four-toed salamanders alone are not this abundant, it is likely that they contribute to the food web in many forests where they are plentiful.

Their diet of calcium rich invertebrates makes them nutritious meals for shrews, snakes, birds, fish, and other carnivores which likely feed on four-toed salamanders (Burton 1975b, Harding 1997).

Four-toed salamanders are harmless, slow moving, colorful creatures of our forests and wetlands and are can be an interesing find for the casual naturalist or small child.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Negative

The four-toed salamander is completely harmless to humans and their interests.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Forest dwelling salamanders, in general, have been shown to be very important contributers to nutrient cycling and energy flow in forest ecosystems. Therefore, they are important for the health and balance of forest systems as both predator and prey. A study in New Hampshire showed that forest salamanders act as sinks for high quality nutrients such as calcium and their tissue is higher in protein than birds or mammals. Additionally, their collective biomass may be twice that of birds and around the same as small mammals (Burton 1975a, 1975b). While Four-toed salamanders alone are not this abundant, it is likely that they contribute similarly to the food web in many forests where they are plentiful.

Their diet of calcium rich invertebrates makes them nutritious meals for shrews, snakes, birds, fish, and other carnivores which likely feed on four-toed salamanders (Burton 1975b, Harding 1997).

Four-toed salamanders are harmless, slow moving, colorful creatures of our forests and wetlands and are can be an interesing find for the casual naturalist or small child. The asthetic niche these creatures hold makes outdoor recreation more valuable to many.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Four-toed salamander

The Four-toed Salamander (Hemidactylium scutatum) is a Lungless Salamander native to eastern North America. It is a species of the monotypic Hemidactylium genus. (In Francophone Canada, it is called the salamandre à quatre orteils.)

Physical description[edit]

H. scutatum has a distinct basal constriction of the tail

The Four-toed Salamander can be recognized by its white underbelly sprinkled with black dots. Its back varies from orange-brownish to red-brownish; its flanks are grayish. The body and the limbs are elongated. The snout is short, and the eyes are prominent. The tail color is usually brighter than the back, and you can observe a constriction at the body/tail junction. The posterior limbs have four toes (hence its name), a good identification criterion but hard to use in the field. This species rarely exceeds 10 cm in length. The sexes are alike except for the shape of the head. Males have elongated and almost square snouts, whereas the females' snouts are short and round. The juveniles show a tail shorter than the body.[1][2]

Ventral surface is brilliant white, with scattered black spots

The Four-toed salamander can be easily mistaken for the Redback Salamander (Plethodon cinereus) in the wild. The redback’s underbelly is more of a "salt & pepper" color. There is no constriction at the tail and posterior limbs show five digits.[1]

Reproduction[edit]

Mating occurs in terrestrial areas throughout the fall months. In early spring the females nest on land, along the banks of small ponds. After the 4–6 week embryonic period, the larvae hatch and make their way to the adjacent pond. Four-toed Salamanders undergo a relatively short aquatic larval period, when compared to other species of the same family, ranging between 3 and 6 weeks.[1][2][3]

Self Defense[edit]

The Four-toed Salamander is known to have three main forms of self-defense against predators. The first is that it purposely sheds off its tail to distract the enemy. When the tail comes of, it is still wiggling around. The enemy gets distracted giving the salamander time to get away. The second form of defense is playing dead. When threatened, this salamander will have a short burst of violent trashes and then stop dead in its tracks. It will stay frozen like this until it feels the threat is gone (Sass and Anderson, 2011). The third and final form of defense is it will curl up and put its tail on its back offering it in exchange for its life.

Nesting behavior[edit]

There are three methods of nesting that have been documented in the females of H. scutatum, which can fall into one of two categories, solitary or communal/joint nesting. Solitary nesters lay and brood only their eggs. Communal nesting is normally one female brooding the eggs of two or more, up to 14, females of the same species. In this method the females either lay their eggs and leave the nest, or lay their eggs and stay to brood their eggs as well as those of the deserting females. About 1/3 of the nests of a population are joint nests, while between 50% and 70% of females lay their eggs in joint nests each year.[4][5]

Oophagy has also been reported in H.scutatum, where one female would eat several eggs of another female before laying her eggs in a communal nest.[4][5]

Habitat[edit]

This species favored habitats are sphagnum bogs, grassy areas surrounding beaver ponds and deciduous or mixed forests rich with mosses. The Four-toed Salamander will use the sphagnum bogs during reproduction, but uses the forest habitat during the summer. It overwinters in terrestrial habitat, using old burrows or cavities created by rotting roots, below the freezing depth. It will frequently overwinter in groups, sometimes with other amphibians such as the Redback Salamander.[1][2][6]

In Canada, the Four-toed Salamander can be found in southern Ontario and Quebec, in Nova Scotia and a single population was found in New Brunswick in 1983. In the United States, it can be found from Maine to Wisconsin and as far as Alabama in the south.[2][3][7][8][9]

The home range of the species is not known. It was believed that the different elements of its habitat (breeding, summer and overwintering) had to be within 100 m of each other, but recent observations might suggest this to be an underestimation.[1]

Diet[edit]

Four-toed Salamanders feed mostly on small invertebrates, such as spider, worms, ticks, springtails (collembola), ground beetles (Carabidae) and other insects. Larvaes love small aquatic crustaceans.[1][2]

Predation[edit]

Larvae are eaten by other salamanders (adults and larvaes), fishes and aquatic beetles. Shrews, snakes and some ground beetles feast on this species. When it feels threatened, H.scutatum will use autotomy (drops its tail, still wiggling) to distract the attention of predators.[1][2]

Conservation status[edit]

Although it is rare, or at least rarely seen, COSEWIC (Committee on the Status of Endangered Wildlife in Canada) does not consider H. scutatum to be at risk in Canada.[10] It is also listed as a species of least concern by the IUCN (The World Conservation Union) due to the wide distribution and assumed large population.[11] But it is at risk in some provinces such as in Quebec (S3 Rare in the province; usually between 20 and 100 occurrences in the province; may have fewer occurrences, but with a large number of individuals in some populations; may be susceptible to large-scale disturbances).[12] Its status in the United States ranges from Threatened (Illinois), to Endangered (Minnesota), to Special Concern (Wisconsin, Ohio & Missouri).[13]

References[edit]

  1. ^ a b c d e f g Desroches, J.-F. & D. Rodrigues. (2004). Amphibiens et Reptiles du Québec et des Maritimes. Éd. Michel Quintin. Waterloo. 288 p.
  2. ^ a b c d e f Gilhen, J. (1984). Amphibians and Reptiles of Nova Scotia. Nova Scotia Museum. Halifax. 162 p.
  3. ^ a b Gordon, D.M. (1979). New Localities for the Northern Spring Salamander and the Four-Toed Salamander in southwestern Québec. Canadian Field-Naturalist 93(2): 193-195.
  4. ^ a b Harris, R.N. & D.E. Gill. (1980). Communal Nesting, Brooding Behavior, and Embryonic Survival of the Four-Toed Salamander Hemidactylium scutatum. Herpetological 36(2):141-144.
  5. ^ a b Carreño, C.A. & R.N. Harris. (1998). Lack of Nest Defense Behavior and Attendance Patterns in a Joint Nesting Salamander, Hemidactylium scutatum (Caudata: Plethodontidae). Copeia (1):183-189.
  6. ^ Bider, J.R. & S. Matte. (1994). Atlas des Amphibiens et Reptiles du Québec. Société d’Histoire Naturelle de la Vallée du Saint-Laurent et Ministère de l’Environnement et de la Faune du Québec. Direction de la Faune et des Habitats. Québec. 106 p.
  7. ^ Behler, J. & F.W. King. (1996). Field Guide to North American Reptiles & Amphibians. National Audubon Society. Alfred A. Knopf. New-York. 743 p.
  8. ^ Desroches, J.-F. & B. Couture. (2002). Extension de l’Aire de Distribution Connue de la Salamandre à Quatre Doigts, (Hemidactylum scutatum), dans l’Est du Québec, et Notes sur l’Habitat. Canadian Field-Naturalist 116(2):317-318.
  9. ^ Woodley, S.J. & Rosen, M. (1988). First Record of the Four-Toed Salamander, Hemidactylium scutatum, in New Brunswick. Canadian Field-Naturalist 102(2): 7-12.
  10. ^ COSEWIC, 2008
  11. ^ Hammerson, G. (2004). Hemidactylium scutatum. In: IUCN 2007. 2007 IUCN Red List of Threatened Species.
  12. ^ M.N.R.F.Q., 2008
  13. ^ Lannoo, M. (1998). Status and Conservation of Midwestern Amphibians. Iowa City, Iowa: University of Iowa Press.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: No subspecies are recognized.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Hemidactylium scutatum (Schlegel) is the scientific name of the four-toed
salamander, a member of the Plethodontidae family [29,30].
  • 29. Crother, Brian I. 2000. Scientific and standard English names of amphibians and reptiles of North America north of Mexico, with comments regarding confidence in our understanding. Herpetological Circular No. 29. Lawrence, KS: Society for the Study of Amphibians and Reptiles. 82 p. [54172]
  • 30. Crother, Brian I.; Boundy, Jeff; Campbell, Jonathan A.; de Quieroz, Kevin; Frost, Darrel; Green, David M.; Highton, Richard; Iverson, John B.; McDiarmid, Roy W.; Meylan, Peter A.; Reeder, Tod W.; Seidel, Michael E.; Sites, Jack W., Jr.; [and others]. 2003. Scientific and standard English names of amphibians and reptiles of North America north of Mexico: update. Herpetological Review. 34(3): 196-203. [60571]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Common Names

four-toed salamander

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!