Overview

Brief Summary

The Four-Toed Salamander is a small salamander measuring only two to four inches in length. It has dark rust to gray-brown coloring, with gray sides and a white belly sprinkled with black dots. It is recognizable from other species due to its four-toed back feet and constricted ring around the base of the tail. Four-toed salamanders have short snouts and prominent eyes. Sexual dimorphism is observed; the female has a rounded snout while the male snout is a bit longer and square-shaped. Females may also be slightly larger than males. The tails of adults are quite long, longer in fact than the rest of the body, may be more brightly colored than the rest of the body, and are easily detachable in case it needs to escape. If it does detach, the tail will continue to wiggle for several minutes so that the rest of the salamander can get away. This process is called autotomy. Four-toed salamanders are plethodontids. They lack lungs and absorb all of their oxygen through their skin in a process called cutaneous respiration. Because of this it is critical they remain wet at all times as the moisture on their skin helps the gaseous exchange with the air. Four-toed salamanders' adult diet consists of insects and small invertebrates such as ticks, beetles, spiders, and worms. During the larval stage they eat the zooplankton found in the water.
  • MA Division of Fish and Wildlife - Natural Heritage and Endangered Species Program - Four-toed Salamander
Public Domain

National Biological Information Infrastructure (NBII) at http://www.nbii.gov

Supplier: Bob Corrigan

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

This species is discontinuously distributed in the US and Canada from Nova Scotia (Friet and MacDonald 1995), New Brunswick, southern Quebec (e.g., Sharbel 1990), southern Ontario, Michigan, Wisconsin (Vogt 1981), and Minnesota (Dorff 1995, Hall et al. 2000) south to southeastern Oklahoma, Louisiana (Dundee and Rossman 1989), Mississippi, Alabama (Mount 1975), Florida panhandle, and Georgia (Conant and Collins 1991). Distribution is fairly continuous in the northeastern part of the range, spotty in the southwestern part.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Hemidactylium scutatum, the four-toed salamander, occurs from Nova Scotia to northern Minnesota, and south to the Gulf of Mexico. It has a discontinuous range and occurs only in small isolated populations in the southern and midwestern states. Its range is more continuous in states along the Appalachian Mountain Range, New England and west to northeastern Minnesota. (Behler and King 1979, Conant and Collins 1998, Lannoo 1998).

Biogeographic Regions: nearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (200,000-2,500,000 square km (about 80,000-1,000,000 square miles)) Discontinuously distributed from Nova Scotia (Friet and MacDonald 1995), New Brunswick, southern Quebec (e.g., Sharbel 1990), southern Ontario, Michigan, Wisconsin (Vogt 1981), and Minnesota (Dorff 1995, Hall et al. 2000) south to southeastern Oklahoma, Louisiana (Dundee and Rossman 1989), Mississippi, Alabama (Mount 1975), Florida panhandle, and Georgia (Conant and Collins 1991). Distribution is fairly continuous in the northeastern part of the range, spotty in the southwestern part.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

The four-toed salamander is a small plethodontid (lungless) salamander only 5 to 10.2 cm (2 to 4 in) in length. It is a rusty brown color or gray-brown color with grayish sides. It is often speckled with black and bluish spots. Unique four-toed hind feet and a constricted ring around the base of its tail easily identify it. They have nasolabial grooves and 13 to 14 coastal grooves (Harding 1997). The tail makes up about 57 percent of its total body length (Petranka 1998).

Female four-toed salamanders have rounded snouts, while sexually active males have more squared (truncated) snouts. Enlarged premaxillary teeth are also evident in sexually active males and can be seen with a closed mouth. The snout-to-vent length (SVL) is approximately 15 percent longer in females than males (Petranka 1998).

Hatchlings are only 11 to 15 mm total body length. They are usually born with toes or toe buds. The larvae are aquatic and a yellowish brown color. A dorsal fin runs from the length of the tail to near the back of the head. Some hatchlings look more like adults but have shorter tails (Petranka 1998).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 10 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Adults live under objects or among mosses in swamps, boggy streams, and wet, wooded or open areas near ponds or quiet, mossy or grassy/sedgy pools (the larval habitat). Sphagnum moss is commonly abundant in suitable habitat. Eggs are laid in moss or other protected sites immediately above or next to a pool, into which the larvae drop or wriggle after hatching. Does not require pristine habitat; Phillips et al. (1999) noted that in Illinois "several localities are second-growth woods in soggy soils below dams of man-made lakes."

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Four-toed salamanders have specialized habitat requirements which require suitable breeding wetlands within or adjacent to mature forests. They prefer mature, mesic forests with dense canopy cover to preserve body moisture, an abundance of downed woody debris for cover and foraging opportunities, and vernal pools, ponds, bogs, shallow marshes, or other fishless bodies of water for nesting and larval success. Wooded wetlands such as seepage swamps or cedar swamps with many moss mats are ideal. Male adults can be located under leaves, bark, and logs in the upland forest, while females are most often found during the breeding season nesting in moss mats which overhang pools of water. (Harding 1997, Petranka 1998).

Terrestrial Biomes: forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Adults live under objects or among mosses in swamps, boggy streams, and wet, wooded or open areas near ponds or quiet, mossy or grassy/sedgy pools (the larval habitat). Sphagnum moss is commonly abundant in suitable habitat.

Eggs are laid in moss or other protected sites immediately above or next to a pool, into which the larvae drop or wriggle after hatching.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Relatively sedentary; may move short distances between breeding sites and nonbreeding habitat.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Few studies have been conducted on the feeding habits of the four-toed salamander, but it is believed their diet consists mainly of insects and their larvae (beetles, flies, ants, bristletails), spiders, mites, worms, and snails (Harding 1997, Petranka 1998).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Adults eat a variety of small terrestrial invertebrates. Larvae eat small aquatic invertebrates.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 to >300

Comments: Hundreds of known occurrences. Many new ones are being discovered. As an indication of this, 18 new county records were published in Herpetological Review during the period 1995-2000; these included several for Minnesota, where the species had not been previously documented. In southern New England, where the species had been regarded as rare, Klemens (1993) found that H. SCUTATUM was widely distributed and secure. Most state distribution maps do not distinguish between old and recent records. Gilhen (1984) mapped a dozen locations in Nova Scotia. Klemens (1993) mapped dozens of occurrences (many previously unreported) in Connecticut. Redmond and Scott (1996) mapped 25 locations in Tennessee but stated that the distribution is poorly known. Pfingsten and Downs (1989) mapped 47 post-1950 locations in Ohio. Vogt (1981) mapped 25 locations in Wisconsin. Phillips et al. (1999) mapped pre-1980 records for 7 counties and 4 more recent county occurrences. Tobey (1985) mapped about 55 locations in Virginia. Green and Pauley (1987) mapped occurrences in about 20 counties in West Virginia; they stated that the species probably occurs throughout the state. Johnson (1987) mapped 12 locations in 12 counties in Missouri. Minton (1972) mentioned that some of the 10 populations he mapped in Indiana may no longer exist. At the southern limit of the range in the Florida panhandle, Means (1992) stated that the half-dozen localities have produced fewer than 10 specimens from the state. Dundee and Rossman (1989) recorded two occurrences in Louisiana.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Abundance

10,000 to >1,000,000 individuals

Comments: Total adult population size is unknown but surely exceeds 10,000 and may exceed 100,000. Species is more abundant than available records indicate (relatively difficult to find).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

May aggregate in favorable hibernation areas.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Cyclicity

Comments: Mostly inactive during coldest winter months throughout most of range.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Average lifespan

Sex: female

Status: captivity:
5.5 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 8.9 years (captivity)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Mating occurs in the late summer, fall, and possibly into early winter in some places. The male courts the female first by rubbing his nose on the female's nose, then he will circle around her with his tail bend at a sharp right angle. At some point the female straddles the male's tail and presses her snout on the base of his tail. Eventually the male starts moving forward, undulating his tail, and begins depositing spermatophores, while the female follows him at a close distance. The spermatophores are a jelly-like glob that are about 2mm wide at the base and tapers to a thin stalk, which is topped with a yellowish sperm cap. The female picks up the spermatophores and deposits them into her cloaca while pressing her snout against the male's tail. This "straddle walk" lasts for up to 20 minutes (Harding 1997, Petranka 1998).

Female four-toed salamanders migrate to nesting sites primarily from the last week of March through the second week of April, but may wait until as late as early June. Oviposition occurs from mid to late April in Michigan, but can occur as late as February in southern Alabama. Females seek out moss clumps that are just above a pool of water usually in swamps, bogs, marshes, vernal ponds, and slow moving streams. The nesting medium is usually raised clumps of sphagnum moss, but leaf litter, rotting logs, or grass and sedge clumps are also used. The female then locates or constructs a cavity to deposit her eggs, which takes several minutes for each one and may take several hours for the whole clutch. The eggs have a sticky outer coating, which she uses to adhere to the surrounding moss. Fifteen to 80 eggs, each between 2.5 and 3.0 mm in diameter, are laid. More eggs tend to be laid by larger females (Harding 1997, Oliver 1955, Petranka 1998). Females often share nests and as many as 1110 eggs have been found in a single nest (Blanchard 1934). Nest availability is thought to be a factor in this communal nesting behavior (Breitenbach 1982). Often one or more (usually one) female will stay with the nest for a period, but they are usually gone by hatching. Despite a lack of defensive behavior toward invading predators, the female's nest attendance has been found to increase embryo survival (Carreno and Harris 1998). It is believed that the mother's skin secretions may protect the eggs by impeding fungus growth. So far, no beneficial link has been established between joint nesting and embryo survival (Harris and Gill 1980). The incubation period varies from 38 to 62 days depending upon the region and local site conditions. Average survivorship after hatching has been estimted at 9 and 21 percent (Harding 1997, Petranka 1998).

After hatching the larva wiggle from their nest and drop into the nearby water. They are only about 1.1 to 1.4 cm total body length at birth. During this larval stage they feed primarily on zooplankton and other invertebrates. Their larval period lasts between 23-39 days, which is brief compared to other amphibians. At transformation they are only 1.7 to 2.5 cm total body length (Harding 1997, Petranka 1998). The sex ratio of juveniles is nearly equal (Blanchard 1935).

It takes between two and three years for H. scutatum to reach sexual maturity. Captive specimens have lived as long as nine years but it is unknown how long free-ranging individuals may survive (Harding 1997).

Average number of offspring: 30.

Average age at sexual or reproductive maturity (male)

Sex: male:
912 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
912 days.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Breeds in fall, lays eggs in winter (in south) or early spring. Clutch size variously reported as a dozen or so up to 80. Female remains with eggs until hatching (about 2 months). Communal nesting occurs. Aquatic larvae metamorphose in about 1.5-2 months (summer), attain sexual maturity about 18 months later.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Hemidactylium scutatum

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 80 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBAP0428-06|NC_006342|Hemidactylium scutatum| ACCCGATGACTTTTTTCAACAAATCATAAAGATATTGGCACCCTCTATTTAGTATTTGGTGCCTGAGCCGGGATGGTGGGAACAGCCCTA---AGCCTCCTGATTCGCGCAGAACTAAGCCAGCCTGGAGCTCTACTAGGAGAC---GATCAGATTTATAATGTTATTGTCACCGCCCACGCCTTCGTAATAATTTTTTTTATAGTTATACCAATTATGATCGGAGGATTTGGAAACTGATTGTTGCCTTTAATA---ATTGGGGCCCCTGATATGGCTTTCCCTCGAATAAATAATATAAGCTTCTGGTTACTTCCGCCATCGTTTTTATTACTCCTCGCCTCTTCTATAGTAGAAGCGGGCGCCGGCACTGGGTGAACAGTATATCCACCACTTGCCGGTAATATAGCTCACGCTGGCGCCTCAGTAGATTTG---ACCATCTTTTCTCTTCACCTAGCAGGGGTATCTTCAATCCTAGGCGCAATTAATTTTATCACGACCTCTATTAACATAAAACCTCCATCTATATCGCAATATCAAACACCATTGTTTGTTTGATCAGTATTGATTACTGCTATCCTTTTATTATTATCCCTACCAGTATTAGCTGCC---GGAATCACAATGTTGTTAACAGATCGAAACCTTAATACTACATTTTTTGACCCTGCAGGCGGTGGAGACCCGGTACTCTATCAACACCTATTCTGGTTTTTTGGCCACCCTGAGGTCTACATTTTAATTCTACCGGGGTTCGGAATAATTTCACATATTGTGACATACTACTCAGCCAAAAAA---GAACCGTTTGGATATATAGGCATAGTTTGGGCAATGATATCCATTGGACTTCTAGGGTTTATTGTTTGAGCTCACCACATGTTTACAGTAGACCTTA 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Hemidactylium scutatum

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 81
Species: 81
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2004

Assessor/s
Geoffrey Hammerson

Reviewer/s
Global Amphibian Assessment Coordinating Team (Simon Stuart, Janice Chanson, Neil Cox and Bruce Young)

Justification
Listed as Least Concern in view of its wide distribution, presumed large population, and because it is unlikely to be declining fast enough to qualify for listing in a more threatened category.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

The four-toed salamander is thought to be in a state of decline throughout its range due primarily to its specialized habitat requirements in conjunction with destruction, degradation, and fragmentation of wetlands and forests. Even in the north and east, where the four-toed salamander's range is more continuous, it only occurs is small isolated colonies where suitable wetland-woodland interfaces exist. Additionally, the low dispersal ability of this salamander hinders it from recolonizing suitable habitat once it has been extirpated from an area (Harding 1997).

Hemidactylium scutatum is currently listed as endangered in Indiana and Minnesota, threatened in Illinios, and has special concern or rare status in Wisconsin, Ohio, and Missouri (Lannoo 1998). To improve conservation efforts, people should be educated on the vulnerability and value of the species.

To improve and increase habitat for the four-toed salamander, mature, closed canopy, mesic hardwood forests should be preserved. Downed woody debris should be left in place or added to these forests. Shallow vernal pools can be created within these woodlands and raised hummucks of earth can be added in and around the pool to promote growth of spagnum moss and sedges (Petranka 1998). The creation of suitable habitat between two populations, or "corridors," could also be investigated where two fragmented populations in close proximity exist.

Individuals are likely killed crossing roads while migrating to and from breeding sites. As a preventative measure, "'critter-culverts" can be installed in areas of high road kill risk to allow salamanders to pass underneath roads to and from their breeding sites.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N4 - Apparently Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: Widely but discontinuously distributed throughout much of the eastern U.S. and adjacent Canada; secretive species that is proving to be more abundant and widespread than previously available records indicated; secure.

Intrinsic Vulnerability: Moderately vulnerable

Environmental Specificity: Narrow. Specialist or community with key requirements common.

Comments: Moderately specific about egg laying sites and larval habitat.

Other Considerations: Does not require pristine habitat; Phillips et al. (1999) noted that in Illinois "several localities are second-growth woods in soggy soils below dams of man-made lakes."

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
The total adult population size is unknown but surely exceeds 10,000 and might exceed 100,000. The species is more abundant than available records indicate, being relatively difficult to find. Its population is probably relatively stable overall.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Short Term Trend: Relatively stable (=10% change)

Comments: Probably relatively stable overall.

Global Long Term Trend: Increase of 10-25% to decline of 30%

Comments: Likely stable in extent of occurrence, probably less than 25% decline in population size, area of occurrence, and number/condition of occurrences, but data are scant.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
Primary potential threat is loss/degradation of habitat, but this is ameliorated in some areas by wetland protection regulations. However, colonies might be more or less isolated by the species' relatively restricted habitat preferences, and development of intervening uplands might inhibit dispersal and colonization of new habitats (Harding 1997). Populations may flourish in many moderately developed and semi-rural areas in southern New England (Klemens 1993). Road mortality does not appear substantial when compared to many species of frogs and Ambystoma salamanders (Klemens 1993). Impoundments likely have reduced the range in some areas (Means 1992). It is tolerant of non-destructive intrusion.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Degree of Threat: C : Not very threatened throughout its range, communities often provide natural resources that when exploited alter the composition and structure over the short-term, or communities are self-protecting because they are unsuitable for other uses

Comments: Primary potential threat is loss/degradation of habitat, but this is ameliorated in some areas by wetland protection regulations. However, colonies may be more or less isolated by the species' relatively restricted habitat preferences, and development of intervening uplands may inhibit dispersal and colonization of new habitats (Harding 1997). Populations may flourish in many moderately developed and semi-rural areas in southern New England (Klemens 1993). Road mortality does not appear substantial when compared to many species of frogs and Ambystoma salamanders (Klemens 1993). Impoundments likely have reduced the range in some areas (Means 1992). Tolerant of nondestructive intrusion.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Many populations are adequately protected.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Protection: Very many (>40) occurrences appropriately protected and managed

Comments: Many occurences are adequately protected.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

The four-toed salamander is completely harmless to humans and their interests.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Forest dwelling salamanders, in general, have been shown to be very important contributers to nutrient cycling and energy flow in forest ecosystems. Therefore, they are important for the health and balance of forest systems as both predator and prey. A study in New Hampshire showed that forest salamanders act as sinks for high quality nutrients such as calcium and their tissue is higher in protein than birds or mammals. Additionally, their collective biomass may be twice that of birds and around the same as small mammals (Burton 1975a, 1975b). While Four-toed salamanders alone are not this abundant, it is likely that they contribute similarly to the food web in many forests where they are plentiful.

Their diet of calcium rich invertebrates makes them nutritious meals for shrews, snakes, birds, fish, and other carnivores which likely feed on four-toed salamanders (Burton 1975b, Harding 1997).

Four-toed salamanders are harmless, slow moving, colorful creatures of our forests and wetlands and are can be an interesing find for the casual naturalist or small child. The asthetic niche these creatures hold makes outdoor recreation more valuable to many.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Four-toed salamander

The Four-toed Salamander (Hemidactylium scutatum) is a Lungless Salamander native to eastern North America. It is a monotypic species of the Hemidactylium genus. (In Francophone Canada, it is called the salamandre à quatre orteils.)

Contents

Physical description

H. scutatum has a distinct basal constriction of the tail.

The Four-toed Salamander can be recognized by its white underbelly sprinkled with black dots. Its back varies from orange-brownish to red-brownish; its flanks are grayish. The body and the limbs are elongated. The snout is short, and the eyes are prominent. The tail color is usually brighter than the back, and you can observe a constriction at the body/tail junction. The posterior limbs have four toes (hence its name), a good identification criterion but hard to use in the field. This species rarely exceeds 10 cm in length. The sexes are alike except for the shape of the head. Males have elongated and almost square snouts, whereas the females' snouts are short and round. The juveniles show a tail shorter than the body.[1][2]

Ventral surface is brilliant white, with scattered black spots

The Four-toed salamander can be easily mistaken for the Redback Salamander (Plethodon cinereus) in the wild. The redback’s underbelly is more of a "salt & pepper" color. There is no constriction at the tail and posterior limbs show five digits.[1]

Reproduction

Mating occurs in terrestrial areas throughout the fall months. In early spring the females nest on land, along the banks of small ponds. After the 4–6 week embryonic period, the larvae hatch and make their way to the adjacent pond. Four-toed Salamanders undergo a relatively short aquatic larval period, when compared to other species of the same family, ranging between 3 and 6 weeks.[2][3][1]

Self Defense

The Four-toed Salamander is known to have three main forms of self defense against predators. The first is that it purposely sheds off its tail to distract the enemy. When the tail comes of, it is still wiggling around. The enemy gets distracted giving the salamander time to get away. The second form of defense is playing dead. When threatened, this salamander will have a short burst of violent trashes and then stop dead in its tracks. It will stay frozen like this until it feels the threat is gone (Sass and Anderson, 2011). The third and final form of defense is it will curl up and put its tail on its back offering it in exchange for its life.

Nesting behavior

There are three methods of nesting that have been documented in the females of H. scutatum, which can fall into one of two categories, solitary or communal/joint nesting. Solitary nesters lay and brood only their eggs. Communal nesting is normally one female brooding the eggs of two or more, up to 14, females of the same species. In this method the females either lay their eggs and leave the nest, or lay their eggs and stay to brood their eggs as well as those of the deserting females. About 1/3 of the nests of a population are joint nests, while between 50% and 70% of females lay their eggs in joint nests each year.[4][5]

Oophagy has also been reported in H. scutatum, where one female would eat several eggs of another female before laying her eggs in a communal nest.[4][5]

Habitat

This species favored habitats are sphagnum bogs, grassy areas surrounding beaver ponds and deciduous or mixed forests rich with mosses. The Four-toed Salamander will use the sphagnum bogs during reproduction, but uses the forest habitat during the summer. It overwinters in terrestrial habitat, using old burrows or cavities created by rotting roots, below the freezing depth. It will frequently overwinter in groups, sometimes with other amphibians such as the Redback Salamander.[6][2][1]

In Canada, the Four-toed Salamander can be found in southern Ontario and Quebec, in Nova Scotia and a single population was found in New Brunswick in 1983. In the United States, it can be found from Maine to Wisconsin and as far as Alabama in the south.[2][7][8][3][9]

The home range of the species is not known. It was believed that the different elements of its habitat (breeding, summer and overwintering) had to be within 100m of each other, but recent observations might suggest this to be an underestimation.[1]

Diet

Four-toed Salamanders feed mosly on small invetebrates, such as spider worms, ticks, springtails (collembola), ground beetles (Carabidae) and other insects. Larvaes love small aquatic crustaceans.[2][1]

Predation

Larvae are eaten by other salamanders (adults and larvaes), fishes and aquatic beetles. Shrews, snakes and some ground beetles feast on this species. When it feels threatened, H. scutatum will use autotomy (drops its tail, still wiggling) to distract the attention of predators.[2][1]

Conservation status

Although it is rare, or at least rarely seen, COSEWIC (Committee on the Status of Endangered Wildlife in Canada) does not consider H. scutatum to be at risk in Canada.[10] It is also listed as a species of least concern by the IUCN (The World Conservation Union) due to the wide distribution and assumed large population.[11] But it is at risk in some provinces such as in Quebec ( S3 Rare in the province; usually between 20 and 100 occurrences in the province; may have fewer occurrences, but with a large number of individuals in some populations; may be susceptible to large-scale disturbances).[12] Its status in the United States ranges from Threatened (Illinois), to Endangered (Minnesota), to Special Concern (Massachusetts, Wisconsin, Ohio & Missouri).[13]

References

  1. ^ a b c d e f g [DESROCHES, J.-F. & D. RODRIGUES. 2004. Amphibiens et Reptiles du Québec et des Maritimes. Éd. Michel Quintin. Waterloo. 288p.]
  2. ^ a b c d e f [GILHEN, J. 1984. Amphibians and Reptiles of Nova Scotia. Nova Scotia Museum. Halifax. 162p.]
  3. ^ a b [GORDON, D.M. 1979. New Localities for the Northern Spring Salamander and the Four-Toed Salamander in southwestern Québec. Canadian Field-Naturalist 93(2): 193-195.]
  4. ^ a b [Harris, R.N. & D.E. Gill. 1980. Communal Nesting, Brooding Behavior, and Embryonic Survival of the Four-Toed Salamander Hemidactylium scutatum. Herpetological. 36(2):141-144.]
  5. ^ a b [Carreño, C.A. & R.N. Harris. 1998. Lack of Nest Defense Behavior and Attendance Patterns in a Joint Nesting Salamander, Hemidactylium scutatum (Caudata: Plethodontidae). Copeia. (1):183-189.]
  6. ^ [BIDER, J.R. & S. MATTE. 1994. Atlas des Amphibiens et Reptiles du Québec. Société d’Histoire Naturelle de la Vallée du Saint-Laurent et Ministère de l’Environnement et de la Faune du Québec. Direction de la Faune et des Habitats. Québec. 106p.]
  7. ^ [BEHLER, J. & F.W. KING. 1996. Field Guide to North American Reptiles & Amphibians. National Audubon Society. Alfred A. Knopf. New-York. 743p.]
  8. ^ [DESROCHES, J.-F. & B. COUTURE. 2002. Extension de l’Aire de Distribution Connue de la Salamandre à Quatre Doigts, (Hemidactylum scutatum), dans l’Est du Québec, et Notes sur l’Habitat. Canadian Field-Naturalist 116(2) : 317-318.]
  9. ^ [Woodley, S.J. & Rosen, M. 1988. First Record of the Four-Toed Salamander, Hemidactylium scutatum, in New Brunswick. Canadian Field-Naturalist 102(2): 7-12.]
  10. ^ COSEWIC, 2008
  11. ^ [Hammerson, G. 2004. Hemidactylium scutatum. In: IUCN 2007. 2007 IUCN Red List of Threatened Species.]
  12. ^ M.N.R.F.Q., 2008
  13. ^ [Lannoo, M. 1998. Status and Conservation of Midwestern Amphibians. Iowa City, Iowa: University of Iowa Press.]
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: No subspecies are recognized.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!