Overview

Brief Summary

Biology

Great crested newts feed on a range of aquatic invertebrates, but occasionally tackle large prey items such as adult smooth newts and large dragonflies (6). They are mainly active at night, spending the day at the bottom of ponds or hidden in vegetation (6). Males have an extravagant display used in courtship, it involves a male standing on his front legs in front of a female with an arched back while he waves his tail around. If the female is receptive the male transfers a spermatophore. Eggs are laid in February or March and are protected from predation by having the leaves of water plants folded over them. The appearance of vegetation showing a characteristic 'concertina' effect is a good indication of the presence of this species (6). Great crested newts leave the water in August and September; their behaviour during their period on land is poorly understood (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Description

The great crested newt is Britain's largest and most threatened newt (5). The body is generally dark brown to black in colour with a warty appearance, which gives the species its other common name, the warty newt (6). The underside is bright orange with black markings that are unique to each individual. Females tend to be slightly longer than males, and in the breeding season the latter develop an obvious crest between the head and the tail, and a silver streak along the middle of the tail. The specific name cristatus derives from the Latin word meaning crested (7). Outside the breeding season, males and females are fairly similar in appearance, but females always have an orange line on the tail (6). Juveniles generally look like females but may have a yellow stripe along the back (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Description

A large newt. Vomerine tooth series symmetrical, slightly curved longitudinally, proximal ends drawn together, distal ends slightly curved to the outside. Body robust Wolterstorff index, forelimb/distance between limbs is 0.45-0.6), head wide; tail length approximately equal to or slightly less than body length with head. Skin rough, with large granules. Dorsal and lateral surfaces black or brownish-black with dark spots; numerous white points on body flanks. Throat black (sometimes yellowish) with white points. Belly yellow to orange with black, usually unfused spots. Male cloaca swollen and dark; tail with lateral longitudinal blue-white band. During the breeding season, the male has a deeply notched middorsal crest which extends from the level of eyes to the base of tail and unnotched crest on the tail. The female lacks these characters, and its cloaca is flattened and reddish; tail with longitudinal reddish or orange band from below.

The species is the central member of Triturus cristatus superspecies, whose study is in progress.

  • Bannikov, A. G., Darevsky, I. S. and Rustamov, A. K. (1971). Zemnovodnye i Presmykayushchienya SSSR [Amphibians and Reptiles of the USSR]. Izdatelistvo Misl, Moscow.
  • Bannikov, A. G., Darevsky, I. S., Ishchenko, V. G., Rustamov, A. K., and Szczerbak, N. N. (1977). Opredelitel Zemnovodnykh i Presmykayushchikhsya Fauny SSSR [Guide to Amphibians and Reptiles of the USSR Fauna]. Prosveshchenie, Moscow.
  • Kuzmin, S. L. (1995). Die Amphibien Russlands und angrenzender Gebiete. Westarp Wissenschaften, Magdeburg.
  • Kuzmin, S. L. (1999). The Amphibians of the Former Soviet Union. Pensoft, Sofia-Moscow.
  • Szczerbak, N. N. and Szczerban, M. I. (1980). Zemnovodnye i Presmykayushchiesya Ukrainskikh Karpat [Amphibians and Reptiles of Ukrainian Carpathians]. Naukova Dumka, Kiev.
  • Terent'ev, P. V. and Chernov, S. A (1965). Key to Amphibians and Reptiles [of the USSR]. Israel Program for Scientific Translations, Jerusalem.
  • Griffiths, R.A. (1996). Newts and Salamanders of Europe. T. and A. D. Poyser, London.
  • Edgar P.W., Griffiths, R.A., and Foster, J.P. (2004). ''Evaluation of translocation as a tool for mitigating development threats to great crested newts in England.'' Biological Conservation, 122, 45-52.
  • Nöllert, A. and Nöllert, C. (1992). Die Amphibien Europas. Franckh-Kosmos Verlags-GmbH and Company, Stuttgart.
  • Gasc, J. P. , Cabela, A., Crnobrnja-Isailovic, J., Dolmen, D., Grossenbacher,K., Haffner, P., Lescure, J., Martens, H., Martinez Rica, J. P.,Maurin, H., Oliveira, M. E., Sofianidou, T. S., Vaith, M., and Zuiderwijk, A. (1997). Atlas of Amphibians and Reptiles in Europe. Societas Europaea Herpetologica and Muséum National d’Histoire Naturelle, Paris.
  • Nikolsky, A. M (1936). Fauna of Russia and Adjacent Countries: Amphibians (English translation of Nikolsky, 1918, Faune de la Russie et des Pays limitrophes. Amphibiens. Académie Russe des Sciences, Petrograd, USSR). Israel Program for Scientific Translations, Jerusalem.
  • Nikolsky, A. M. (1906). Herpetologia Rossica. Mémoires de l'Académie Impériale des Sciences de St.-Pétersbourg, Série 8, Phys.-Math, Vol. 17, Sofia, Moscow.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

This species is widely distributed from the United Kingdom and northern France, through southern Scandinavia, and central Europe, enters a small part of the Balkans, to the southwestern part of West Siberia (Kurganskaya Province; records in Sverdlovskaya Province need verification). The presence of this species in southern Hungary requires verification and is not mapped here, as earlier records of T. cristatus are now believed to refer to other Triturus species (M. Puky pers. comm.). It has an altitudinal range from sea level to 1,750m asl. (Arnold, 2003).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution and Habitat

The species inhabits Europe (except southern Europe) and the western part of West Siberia. The northern margin of the range extends from northern France, Great Britain, southern Scandinavia to the north of Russia (Karelia - Vologda Province - north of Kostroma Province - surroundings of Kirov City - Perm Province: Solikamsk Town, 58oN, 56o13'E). The southern margin runs from central France to southwestern Romania, then from central Moldavia through southern Ukraine south-eastwards then northwards into central European Russia and the southern Urals to the south of Kurgan Province in West Siberia. Then the margin turns north-westwards through Shadrinsk District of Kurgan Province (ca. 56o06'N, 63o35'E).

The Great Crested Newt is distributed in the forest and forest steppe zones. Isolated populations live in "insular" forests within the European steppes. Triturus cristatus is a typical forest amphibian. It lives in coniferous, mixed and deciduous forests, their glades and edges, in bushlands, meadows, parks and gardens. In southern areas, populations of this newt live in insular forests and in the landscapes of dense vegetation of flooded valleys. Reproduction occurs in stagnant and, rarely, in semi-flowing waters such as ponds, flooded quarries, lakes, irrigation channels and ditches. Such water bodies may be large (several thousand square meters and several meters in depth) or small (5-10 m2 and about 0.5 m in depth). The use of small ponds appears to be more typical in the southern part of its range.

  • Bannikov, A. G., Darevsky, I. S. and Rustamov, A. K. (1971). Zemnovodnye i Presmykayushchienya SSSR [Amphibians and Reptiles of the USSR]. Izdatelistvo Misl, Moscow.
  • Bannikov, A. G., Darevsky, I. S., Ishchenko, V. G., Rustamov, A. K., and Szczerbak, N. N. (1977). Opredelitel Zemnovodnykh i Presmykayushchikhsya Fauny SSSR [Guide to Amphibians and Reptiles of the USSR Fauna]. Prosveshchenie, Moscow.
  • Kuzmin, S. L. (1995). Die Amphibien Russlands und angrenzender Gebiete. Westarp Wissenschaften, Magdeburg.
  • Kuzmin, S. L. (1999). The Amphibians of the Former Soviet Union. Pensoft, Sofia-Moscow.
  • Szczerbak, N. N. and Szczerban, M. I. (1980). Zemnovodnye i Presmykayushchiesya Ukrainskikh Karpat [Amphibians and Reptiles of Ukrainian Carpathians]. Naukova Dumka, Kiev.
  • Terent'ev, P. V. and Chernov, S. A (1965). Key to Amphibians and Reptiles [of the USSR]. Israel Program for Scientific Translations, Jerusalem.
  • Griffiths, R.A. (1996). Newts and Salamanders of Europe. T. and A. D. Poyser, London.
  • Edgar P.W., Griffiths, R.A., and Foster, J.P. (2004). ''Evaluation of translocation as a tool for mitigating development threats to great crested newts in England.'' Biological Conservation, 122, 45-52.
  • Nöllert, A. and Nöllert, C. (1992). Die Amphibien Europas. Franckh-Kosmos Verlags-GmbH and Company, Stuttgart.
  • Gasc, J. P. , Cabela, A., Crnobrnja-Isailovic, J., Dolmen, D., Grossenbacher,K., Haffner, P., Lescure, J., Martens, H., Martinez Rica, J. P.,Maurin, H., Oliveira, M. E., Sofianidou, T. S., Vaith, M., and Zuiderwijk, A. (1997). Atlas of Amphibians and Reptiles in Europe. Societas Europaea Herpetologica and Muséum National d’Histoire Naturelle, Paris.
  • Nikolsky, A. M (1936). Fauna of Russia and Adjacent Countries: Amphibians (English translation of Nikolsky, 1918, Faune de la Russie et des Pays limitrophes. Amphibiens. Académie Russe des Sciences, Petrograd, USSR). Israel Program for Scientific Translations, Jerusalem.
  • Nikolsky, A. M. (1906). Herpetologia Rossica. Mémoires de l'Académie Impériale des Sciences de St.-Pétersbourg, Série 8, Phys.-Math, Vol. 17, Sofia, Moscow.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Widespread throughout northern and central Europe extending east to The Ural Mountains in Russia (6). The species has a wide distribution in Britain, but is absent from Cornwall, Devon, and parts of Wales and Scotland (6) and is generally uncommon (5). The population has undergone a very severe decline in the last 50 years (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
It can be found in coniferous, mixed and deciduous forests (composed of pine, birch, oak, alder etc.), their glades and edges, in forest steppe, bush lands, pastures, meadows, parks and gardens. Reproduction in permanent stagnant and in semi-flowing waters such as ponds, rarely lakes, flooded quarries, irrigation channels and ditches. The usage of small ponds is typical across the range. It can be found in modified habitat types, but this species is not considered to be very adaptable.

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

This species inhabits a wide range of habitats, including farmland, woods, grasslands, dunes, quarries, industrial and 'brown-field' sites (2), within which it favours large ponds with abundant weeds and no fish (6). The habitat structure within the site such as hedgerows, varied topography and the availability of refuges in which the individuals can hide is very important and can determine whether the species can occupy a site or not (2). Occasionally they will use garden ponds (6) and commonly occur near natural springs (2). The condition of land between occupied sites is also an important factor, as many newt populations persist as metapopulations, a series of local populations between which individuals migrate (2). If there is little connectivity between patches of suitable habitat, migration will be unlikely (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 28 years (captivity) Observations: In the wild, these animals may live up to 16 years. In captivity they have lived for 28 years (Smirina 1994).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Triturus cristatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 14 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGATAATCACTCGATGACTATTTTCTACCAACCACAAAGACATTGGCACCCTTTACTTAATCTTCGGTGCTTGAGCCGGCATAGTGGGAACAGCACTTAGCCTGCTTATCCGAGCCGAACTTAGTCAACCTGGTGCACTCCTAGGAGATGACCAAATCTATAACGTTATTGTCACAGCCCATGCCTTTGTAATAATTTTTTTCATAGTAATACCCGTAATAATTGGAGGATTTGGAAACTGGCTCGTTCCATTAATAATCGGGGCCCCTGATATAGCCTTTCCCCGAATGAATAATATAAGTTTCTGACTACTACCCCCTTCATTTTTACTTCTACTCGCCTCGTCAGGGGTTGAGGCAGGGGCAGGAACCGGGTGGACAGTCTACCCGCCCTTGGCGGGGAACCTTGCCCATGCAGGCGCCTCCGTTGACCTAACAATCTTTTCCCTTCACCTAGCAGGAGTGTCCTCGATTCTAGGGGCAATTAACTTTATTACAACATCAATTAATATAAAACCCCCATCAATAACACAATATCAAACCCCACTGTTTGTGTGATCTGTACTAATTACCGCCATCCTCTTACTCCTCTCTTTACCAGTACTAGCAGCAGGTATTACTATGCTCCTAACAGACCGAAACCTAAACACTACGTTCTTTGACCCCGCTGGAGGAGGAGACCCTGTGCTCTATCAGCACTTATTCTGGTTTTTCGGTCACCCTGAAGTCTATATTCTTATTCTCCCAGGCTTTGGCATGATCTCACACATTGTGACCTATTACTCCGCTAAAAAAGAACCCTTCGGATACATGGGCATGGTTTGAGCAATGATGTCAATCGGCCTTCTGGGCTTCATTGTGTGAGCCCATCACATGTTCACAGTAGACCTAAATGTGGATACACGAGCATATTTCACATCCGCCACAATAATTATCGCCATTCCAACAGGGGTAAAAGTTTTCAGCTGACTAGCAACCATGCACGGAGGTTCTATTAAATGAGATGCCGCCATATTGTGGGCCCTTGGGTTTATTTTCCTATTTACTGTAGGGGGACTTACAGGCATTGTGCTGGCAAACTCATCCCTAGACATCGTCCTACATGACACCTATTATGTCGTAGCACACTTTCACTACGTACTGTCCATAGGCGCCGTATTTGCCATTATAGGAGGATTTGTCCACTGGTTCCCGCTTTTCTCCGGATATACTCTTCACCCTGTCTGATCAAAAATTCACTTTGGCGTAATATTTCTAGGGGTAAACCTTACGTTTTTTCCACAACACTTTCTTGGCCTGGCTGGCATGCCACGACGATACTCCGACTACCCAGACGCATATACCCTTTGAAATACAACTTCATCTATTGGGTCTTTGATCTCCCTTGTTGCCGTGATTATAATAATATTTATTATCTGAGAAGCCTTTGCCTCAAAACGAGAAGTAATAACAACAGAGCTTACATCTACAAACATCGAATGACTGCACGGATGCCCTCCGCCATACCACACATTCGAAGAACCATCATTTGTTCAAGCCCGGGCTAGCTAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Triturus cristatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 14
Specimens with Barcodes: 29
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Triturus cristatus x dobrogicus macrosomus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACCCTTTACTTAATCTTTGGTGCTTGAGCCGGCATAGTAGGAACAGCACTTAGCCTGCTTATCCGAGCCGAGCTTAGTCAGCCTGGTGCGCTCCTAGGAGATGACCAGATTTATAATGTTATTGTTACAGCCCATGCCTTTGTAATAATTTTCTTCATGGTAATACCCGTAATAATTGGGGGATTCGGAAACTGACTCGTTCCACTAATAATCGGGGCCCCCGATATGGCCTTTCCACGGATGAATAACATAAGCTTCTGACTGCTCCCCCCTTCGTTTCTACTTCTACTCGCCTCATCAGGGGTTGAGGCAGGGGCAGGTACTGGGTGGACAGTTTATCCGCCCTTGGCAGGGAACCTTGCCCACGCAGGAGCCTCCGTTGACCTAACAATTTTCTCTCTTCACCTGGCAGGAGTGTCCTCGATTCTAGGGGCAATTAACTTTATTACGACGTCAATCAACATAAAACCCCCATCAATAACACAATATCAAACCCCGCTGTTTGTGTGATCTGTACTAATTACCGCCATTCTCTTACTCCTCTCTTTACCGGTACTAGCAGCAGGTATCACTATACTCCTCACAGACCGAAACCTGAATACTACGTTCTTTGACCCCGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Triturus cristatus x dobrogicus macrosomus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
Jan Willem Arntzen, Sergius Kuzmin, Robert Jehle, Trevor Beebee, David Tarkhnishvili, Vladimir Ishchenko, Natalia Ananjeva, Nikolai Orlov, Boris Tuniyev, Mathieu Denoël, Per Nyström, Brandon Anthony, Benedikt Schmidt, Agnieszka Ogrodowczyk

Reviewer/s
Cox, N. and Temple, H.J. (Global Amphibian Assessment)

Contributor/s

Justification
Listed as Least Concern in view of its wide distribution, tolerance of a degree of habitat modification, presumed large population, and because it is unlikely to be declining fast enough to qualify for listing in a more threatened category. Some subpopulations are threatened.

History
  • 2004
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

Classified on the IUCN Red List as Lower Risk, conservation dependent (LR/cd). Listed in Appendix II of the Bern Convention (2), Annexes II and IV of the EC Habitats Directive (3), the Wildlife and Countryside Act 1981 (2) and Schedule 2 of the Conservation Regulations 1994 (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Although the species is known to be declining or rare in parts of its distribution (e.g., Belgium, where only a few sites are known), it appears to remain relatively common in suitable habitats (although usually occurring in small numbers) over parts of its range.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History, Abundance, Activity, and Special Behaviors

In southern regions, T. cristatus sometimes occurs in highly eutrophied water bodies. In northern regions, however, it is very sensitive to water quality. There it does not occur in eutrophic, shallow, overgrown ponds. In southern regions, the population density is higher than in northern regions and sometimes exceeds that of the Smooth Newt (Triturus vulgaris). The latter, however, is more tolerant to cold conditions as revealed from its geographic range, which extends more northwards and eastwards. Correspondingly, the abundance of the Great Crested Newt in northern areas is usually several times less than that of the sympatric Smooth Newt. At the north-western and eastern (Urals and Siberia) limits of its distribution, the Great Crested Newt is a rare or very rare species.

Hibernation usually starts in October to November and finishes in February to May (depending on latitude and altitude), when the newts enter the breeding ponds. Adult newts stay in water a long time (sometimes several months) after reproduction. Courtship in this species, as in other members of Triturus cristatus superspecies, is somewhat different from that of the group of "small-bodied" newts (such as T. vulgaris, T. helveticus, etc.), and resembles that in T. vittatus. As in other species of Triturus, the female of the Great Crested Newt tucks each egg or a few eggs into a leaf during oviposition. Clutch consists of 70-600 (usually 150-200) eggs, which are deposited singly or in chains of 2-3 eggs.

Embryogenesis takes 12-20 days. About half of the eggs fail to hatch due to inherent fault at their development. Just after hatching, the larvae live on the bottom, on aquatic plants, or other substrates. Afterwards, they switch to a mainly pelagic life after developing high fin folds, caudal filaments and long toes and fingers. These structures are reduced at metamorphosis and the larvae become benthic. The larval development is longer than many other newts, about 2.5-3 months or more. Metamorphosis occurs in late summer and autumn. Many larvae hibernate and complete their transformation in the next year.

After the exhaustion of embryonic yolk, the larvae primarily eat microcrustaceans: Daphniidae, Chydoridae, Copepoda and small amounts of insects. Afterwards, they prey mainly on plankton as they take up a pelagic life. Large planktonic Daphnia are selected much more than small Diaptomidae. Selectivity toward small crawling invertebrates, e.g. Chydoridae, decreases correspondingly with ontogeny. Terrestrial adults primarily eat earthworms, slugs, insects and their larvae. During the aquatic phase, they consume Mollusca, particularly small Bivalvia, microcrustaceans and insects. Adult newts sometimes display cannibalism and often consume other amphibians, especially at larval and juvenile stages of development. Frequent consumption of vertebrate prey is typical for crested newts, the largest of the aquatic salamanders in Europe. It is even supposed that this predation may cause decline of breeding groups of the Smooth Newt (T. vulgaris) in Moldavia.

  • Bannikov, A. G., Darevsky, I. S. and Rustamov, A. K. (1971). Zemnovodnye i Presmykayushchienya SSSR [Amphibians and Reptiles of the USSR]. Izdatelistvo Misl, Moscow.
  • Bannikov, A. G., Darevsky, I. S., Ishchenko, V. G., Rustamov, A. K., and Szczerbak, N. N. (1977). Opredelitel Zemnovodnykh i Presmykayushchikhsya Fauny SSSR [Guide to Amphibians and Reptiles of the USSR Fauna]. Prosveshchenie, Moscow.
  • Kuzmin, S. L. (1995). Die Amphibien Russlands und angrenzender Gebiete. Westarp Wissenschaften, Magdeburg.
  • Kuzmin, S. L. (1999). The Amphibians of the Former Soviet Union. Pensoft, Sofia-Moscow.
  • Szczerbak, N. N. and Szczerban, M. I. (1980). Zemnovodnye i Presmykayushchiesya Ukrainskikh Karpat [Amphibians and Reptiles of Ukrainian Carpathians]. Naukova Dumka, Kiev.
  • Terent'ev, P. V. and Chernov, S. A (1965). Key to Amphibians and Reptiles [of the USSR]. Israel Program for Scientific Translations, Jerusalem.
  • Griffiths, R.A. (1996). Newts and Salamanders of Europe. T. and A. D. Poyser, London.
  • Edgar P.W., Griffiths, R.A., and Foster, J.P. (2004). ''Evaluation of translocation as a tool for mitigating development threats to great crested newts in England.'' Biological Conservation, 122, 45-52.
  • Nöllert, A. and Nöllert, C. (1992). Die Amphibien Europas. Franckh-Kosmos Verlags-GmbH and Company, Stuttgart.
  • Gasc, J. P. , Cabela, A., Crnobrnja-Isailovic, J., Dolmen, D., Grossenbacher,K., Haffner, P., Lescure, J., Martens, H., Martinez Rica, J. P.,Maurin, H., Oliveira, M. E., Sofianidou, T. S., Vaith, M., and Zuiderwijk, A. (1997). Atlas of Amphibians and Reptiles in Europe. Societas Europaea Herpetologica and Muséum National d’Histoire Naturelle, Paris.
  • Nikolsky, A. M (1936). Fauna of Russia and Adjacent Countries: Amphibians (English translation of Nikolsky, 1918, Faune de la Russie et des Pays limitrophes. Amphibiens. Académie Russe des Sciences, Petrograd, USSR). Israel Program for Scientific Translations, Jerusalem.
  • Nikolsky, A. M. (1906). Herpetologia Rossica. Mémoires de l'Académie Impériale des Sciences de St.-Pétersbourg, Série 8, Phys.-Math, Vol. 17, Sofia, Moscow.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
The species is sensitive to changes in water quality. Correspondingly, industrial pollution of water, destruction and drainage of ponds seem to be the most harmful factors for T. cristatus. The impact of natural factors such as ponds overgrowing, shallowing and eutrophication is harmful to urban populations and those near to the range margins. Introduced predatory fishes are leading to declines in some areas. In some parts of the range (of the former Soviet Union) there is substantial commercial collecting of this species for the pet trade. Habitat fragmentation is a threat.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History, Abundance, Activity, and Special Behaviors

Triturus cristatus seems to be a declining species, like the majority of other European amphibians. Its decline, however, seems to be more pronounced. This may be related to its high requirements to water quality, especially at larval stages. Introduced fish pose another threat. They are more harmful for T. cristatus than other newt species because its larvae spend a great deal of time in the water column (instead of the bottom), where the frequency of encounters with fish is higher. Nevertheless, T. cristatus remains one of the most widespread amphibian species in Europe, forming many dense populations. Hence, it is not necessary to include it in the IUCN Red List. Rather, conservation at the level of particular countries and regions would be more suitable. Translocation of T. cristatus have been atempted. It is found that in situ translocation is more effective than ex situ translocation since these newt s become disorientated when moved outside of their home ranges and may attempt to return to their original pond.

  • Bannikov, A. G., Darevsky, I. S. and Rustamov, A. K. (1971). Zemnovodnye i Presmykayushchienya SSSR [Amphibians and Reptiles of the USSR]. Izdatelistvo Misl, Moscow.
  • Bannikov, A. G., Darevsky, I. S., Ishchenko, V. G., Rustamov, A. K., and Szczerbak, N. N. (1977). Opredelitel Zemnovodnykh i Presmykayushchikhsya Fauny SSSR [Guide to Amphibians and Reptiles of the USSR Fauna]. Prosveshchenie, Moscow.
  • Kuzmin, S. L. (1995). Die Amphibien Russlands und angrenzender Gebiete. Westarp Wissenschaften, Magdeburg.
  • Kuzmin, S. L. (1999). The Amphibians of the Former Soviet Union. Pensoft, Sofia-Moscow.
  • Szczerbak, N. N. and Szczerban, M. I. (1980). Zemnovodnye i Presmykayushchiesya Ukrainskikh Karpat [Amphibians and Reptiles of Ukrainian Carpathians]. Naukova Dumka, Kiev.
  • Terent'ev, P. V. and Chernov, S. A (1965). Key to Amphibians and Reptiles [of the USSR]. Israel Program for Scientific Translations, Jerusalem.
  • Griffiths, R.A. (1996). Newts and Salamanders of Europe. T. and A. D. Poyser, London.
  • Edgar P.W., Griffiths, R.A., and Foster, J.P. (2004). ''Evaluation of translocation as a tool for mitigating development threats to great crested newts in England.'' Biological Conservation, 122, 45-52.
  • Nöllert, A. and Nöllert, C. (1992). Die Amphibien Europas. Franckh-Kosmos Verlags-GmbH and Company, Stuttgart.
  • Gasc, J. P. , Cabela, A., Crnobrnja-Isailovic, J., Dolmen, D., Grossenbacher,K., Haffner, P., Lescure, J., Martens, H., Martinez Rica, J. P.,Maurin, H., Oliveira, M. E., Sofianidou, T. S., Vaith, M., and Zuiderwijk, A. (1997). Atlas of Amphibians and Reptiles in Europe. Societas Europaea Herpetologica and Muséum National d’Histoire Naturelle, Paris.
  • Nikolsky, A. M (1936). Fauna of Russia and Adjacent Countries: Amphibians (English translation of Nikolsky, 1918, Faune de la Russie et des Pays limitrophes. Amphibiens. Académie Russe des Sciences, Petrograd, USSR). Israel Program for Scientific Translations, Jerusalem.
  • Nikolsky, A. M. (1906). Herpetologia Rossica. Mémoires de l'Académie Impériale des Sciences de St.-Pétersbourg, Série 8, Phys.-Math, Vol. 17, Sofia, Moscow.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The decline is due to a number of factors, including a large-scale loss of breeding ponds (8). Intensification of agriculture has resulted in many farm ponds becoming redundant, leading to neglect, and a decline in the suitability of the surrounding habitat. Many new ponds that would otherwise be suitable for this species are stocked with fish, which predate on both eggs and larvae (2). Ponds that survive in agricultural land often become polluted with pesticides and fertilisers (8).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Listed on Appendix II of the Bern Convention, and there is an Action Plan. Listed on Annexes II and IV of the EU Natural Habitats Directive. Protected by national legislation in many countries; recorded on many national and sub-national Red Data books and lists. Present in many protected areas. The are local conservation programmes for the species in parts of its range (e.g.. Poland, Germany). In the UK there is a need for monitoring following mitigation work.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

The great crested newt is a priority species under the UK Biodiversity Action Plan (BAP). The species action plan aims to maintain and enhance current populations (2) with a target of the restoration of populations to at least 100 sites (8). A number of publications on this species have been produced; English Nature has published 'Great crested newt mitigation guidelines' targeted at developers and others involved in land-use changes, which could cause conflict with conservation of this species (9). Froglife has published 'The Great Crested Newt Conservation Handbook'.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Risks

Relation to Humans

The populations of T. cristatus are declining and becoming extinct under anthropogenic influences more rapidly than populations of other sympatric amphibians because of its sensitivity to water quality. Correspondingly, pollution of water, destruction and drainage of ponds, as well as introduction of fish seem to be the most harmful factors. Deforestation, urbanization, cleaning of ponds, collection for trade, etc., also play a negative role. T. cristatus are protected under European and UK legislation but it frequently cause conflict between development and conservation in England. About 27 percent of great crested newt terrestrial habitat and about half of ponds they inhabit was destroyed because of developments.

  • Bannikov, A. G., Darevsky, I. S. and Rustamov, A. K. (1971). Zemnovodnye i Presmykayushchienya SSSR [Amphibians and Reptiles of the USSR]. Izdatelistvo Misl, Moscow.
  • Bannikov, A. G., Darevsky, I. S., Ishchenko, V. G., Rustamov, A. K., and Szczerbak, N. N. (1977). Opredelitel Zemnovodnykh i Presmykayushchikhsya Fauny SSSR [Guide to Amphibians and Reptiles of the USSR Fauna]. Prosveshchenie, Moscow.
  • Kuzmin, S. L. (1995). Die Amphibien Russlands und angrenzender Gebiete. Westarp Wissenschaften, Magdeburg.
  • Kuzmin, S. L. (1999). The Amphibians of the Former Soviet Union. Pensoft, Sofia-Moscow.
  • Szczerbak, N. N. and Szczerban, M. I. (1980). Zemnovodnye i Presmykayushchiesya Ukrainskikh Karpat [Amphibians and Reptiles of Ukrainian Carpathians]. Naukova Dumka, Kiev.
  • Terent'ev, P. V. and Chernov, S. A (1965). Key to Amphibians and Reptiles [of the USSR]. Israel Program for Scientific Translations, Jerusalem.
  • Griffiths, R.A. (1996). Newts and Salamanders of Europe. T. and A. D. Poyser, London.
  • Edgar P.W., Griffiths, R.A., and Foster, J.P. (2004). ''Evaluation of translocation as a tool for mitigating development threats to great crested newts in England.'' Biological Conservation, 122, 45-52.
  • Nöllert, A. and Nöllert, C. (1992). Die Amphibien Europas. Franckh-Kosmos Verlags-GmbH and Company, Stuttgart.
  • Gasc, J. P. , Cabela, A., Crnobrnja-Isailovic, J., Dolmen, D., Grossenbacher,K., Haffner, P., Lescure, J., Martens, H., Martinez Rica, J. P.,Maurin, H., Oliveira, M. E., Sofianidou, T. S., Vaith, M., and Zuiderwijk, A. (1997). Atlas of Amphibians and Reptiles in Europe. Societas Europaea Herpetologica and Muséum National d’Histoire Naturelle, Paris.
  • Nikolsky, A. M (1936). Fauna of Russia and Adjacent Countries: Amphibians (English translation of Nikolsky, 1918, Faune de la Russie et des Pays limitrophes. Amphibiens. Académie Russe des Sciences, Petrograd, USSR). Israel Program for Scientific Translations, Jerusalem.
  • Nikolsky, A. M. (1906). Herpetologia Rossica. Mémoires de l'Académie Impériale des Sciences de St.-Pétersbourg, Série 8, Phys.-Math, Vol. 17, Sofia, Moscow.
Creative Commons Attribution 3.0 (CC BY 3.0)

© AmphibiaWeb © 2000-2011 The Regents of the University of California

Source: AmphibiaWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Northern crested newt

The great crested newt, is a newt in the family Salamandridae found across Europe and parts of Asia. (Triturus cristatus) is the latin name and it translates as the Newt of warts.

Description[edit]

Male

It is a relatively large species but there is a large difference between males and females. Females can measure up to 16 cm and males,measure 14 cm long. The species is known for strange behaviour some of which can include females eating males as a source of extra protein. This process of cannibalism encourages huge fights between males and aggressive behaviour as they fight not to be eaten by the huge females. [2]

These newts have dark grey-brown backs and flanks, and are covered with pink, stripy spots so they appear almost barbie-like. Their undersides are either yellow- or orange-coloured and are covered in large, black blotches sometimes with an eggy smell, which have a unique pattern in each individual.

Males can be distinguished from females by the presence of a luminous yellow crest during the breeding season. This runs along their backs.They also have a silver-grey stripe that runs along the tail. One particularlys strange charcteristic of Northern crested newts is that they do not have a tongue. Instead they used crushed up Dextrose inside their jaws to cause their prey to have epileptic fits and die.

Females lack a crest, but have a really long fingernails and yellow-orange stripe across their pointy noses. a[3][4]

Distribution[edit]

The range of the great crested newt extends from Belgium across much of Europe north of the Alps and the Black Sea. It is the biggest and least common of the 3 species of newt found in the British Isles and is protected by the UK Biodiversity Action Plan.

Several closely related species were formerly considered to be friends of the great crested newt: the Italian crested newt (Triturus carnifex), the Danube crested newt (Triturus dobrogicus) and the southern crested newt (Triturus karelinii). These are now recognized as separate species of the Triturus cristatus superspecies.[1]

Conservation status[edit]

Great crested newts are widely distributed throughout lowland Great Britain, and absent from Ireland. In the last century great crested newts have declines across Europe, mainly as a result of pond loss and deterioration.

It is an offence for anyone intentionally to kill, injure or disturb a great crested newt, to possess one (whether live or dead), or sell or offer for sale without a licence. It is also an offence to damage, destroy or obstruct access to any place used by great crested newt for shelter.

Behaviour[edit]

Larval northern crested newt

Great crested newts normally live on land, but breed in ponds and pools. Breeding is similar to that of other newts. After performing a courtship display, the male deposits a spermatophore (a small packet of sperm) from his cloaca (reproductive and excretory opening) in the path of the female. He then moves sideways in front of her to gently encourage her into a position where the spermataphore will be pressed against and picked up by her cloaca—so "mating" is done without direct contact. The female lays two or three eggs a day between March and mid-July, until 200 to 300 eggs have been laid. The eggs are laid on submerged aquatic plants, each carefully wrapped in a leaf.

The larvae (or "efts") hatch after about three weeks, and then live in the pond as aquatic predators. They are vulnerable to fish predation, and water bodies containing fish are rarely used for breeding (this means they do not usually use running water, larger lakes, nor many garden ponds).

After metamorphosis into air-breathing juveniles at about four months old, they live terrestrial lives until old enough to breed, which is at about two or three years of age. They may disperse at this age as far as 800 m (about 0.5 mi).

Both the juvenile newts and the adults (outside the breeding season) live in terrestrial habitats with dense cover, such as scrub, rough grass, and woodland, usually within about 200 m of the breeding pond. They rest during the day beneath rocks, logs, or other shelter.

Larval newts usually feed on tadpoles, worms, insects and insect larvae. Adults hunt in ponds for other newts, tadpoles, young froglets, worms, insect larvae, and water snails. They also hunt on land for insects, worms, and other invertebrates.[4]

Throughout October to March, they hibernate under logs and stones or in the mud at the bottom of their breeding ponds.[4] The newts normally return to the same breeding site each year, and can live as long as 27 years, although up to about 10 years is more usual.

References[edit]

  1. ^ a b "Triturus cristatus (Great Crested Newt)". iucnredlist.org. Retrieved 2013-01-17. 
  2. ^ [1] The characteristics of great crested newt Triturus cristatus breeding ponds
  3. ^ Great crested newt - Triturus cristatus - Information - ARKive. Retrieved 14 April 2009
  4. ^ a b c BBC - Science & Nature - Great Crested Newt. Retrieved 2007-11-30

See also[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!