Articles on this page are available in 1 other language: Spanish (14) (learn more)

Overview

Brief Summary

Biology

zooxanthellate
  • UNESCO-IOC Register of Marine Organisms
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Elkhorn coral (Acropora palmata) is a large, branching coral with thick and sturdy antler-like branches. It is a member of the Acropora genus, the most abundant and species-rich group of corals in the world.

Colonies of Elkhorn coral are fast growing - branches increase in length by 2-4 inches (5-10 cm) per year, with colonies reaching their maximum size in approximately 10-12 years. Over the last 10,000 years, elkhorn coral has been one of the three most important Caribbean corals contributing to reef growth and development, as well as providing essential fish and marine invertebrate habitat.

While once the most abundant stony coral on shallow reef crests and fore-reefs of the Caribbean and Florida reef tract, by the early 1990s elkhorn coral had experienced widespread losses through its range. Multiple factors are thought to have contributed to coral declines, including impacts from hurricanes, coral disease, mass coral bleaching, climate change, coastal pollution, overfishing, and damage from boaters and divers. In 2006, elkhorn coral and a close relative, staghorn coral (Acropora cervicornis) were listed as threatened under the US Endangered Species Act.

Public Domain

Supplier: Bob Corrigan

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Acropora palmata, or Elkhorn Coral, is considered to be one of the most important reef-building corals in the Caribbean. This species of coral is structurally complex with many large branches that resemble elk antlers and create habitats for many other reef species. Elkhorn coral colonies are fast growing. The color, which ranges from brown to a yellowish-brown, is a result of the symbiotic zooxanthellae that live inside the tissue of this coral species.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

Supplier: Catherine Sutera

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Biology: Skeleton

More info
AuthorSkeleton?Mineral or Organic?MineralPercent Magnesium
Cairns, Hoeksema, and van der Land, 1999 YES MINERAL ARAGONITE
Fautin, 1988 YES MINERAL ARAGONITE
Veron, 2000 YES MINERAL ARAGONITE
Wallace, 1999 YES MINERAL ARAGONITE
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Hexacorallians of the World

Source: Hexacorallians of the World

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

"Elkhorn coral is found on coral reefs in southern Florida, the Bahamas, and throughout the Caribbean. Its northern limit is Biscayne National Park, Florida, and it extends south to Venezuela; it is not found in Bermuda. Once found in continuous stands that extended along the front side of most coral reefs, the characteristic "Acropora palmata zone" supported a diverse assemblage of other invertebrates and fish. These zones have been largely transformed into rubble fields with few, isolated living colonies." (NOAA Fisheries OPR)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Soulanille, Elaine

Source: EOL Rapid Response Team

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Geographic Range

Elkhorn coral is present in coral reefs from southern Florida southward to the northern coasts of Venezuela. The coral has native populations throughout this range, most notably in the Bahamas and the Caribbean.

Biogeographic Regions: atlantic ocean (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 3.0 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Widespread distribution in the tropical western Atlantic, including the Gulf of Mexico, southern Florida, Bahamas, Haiti, Puerto Rico, Jamaica, Cuba, Lesser Antilles, Panama, Belize and Nicaragua. Smith (1971): Florida Keys, Bahamas. Colin (1978): Caribbean. Cairns (1982): Belize. Nelson (1988), Farrell et al. (1983), Tunnell (1988), Jordan (1992): Mexican Gulf. Jaap (1984), Jaap et al. (1988, 1989), Burns (1985), White and Porter (1985): Florida Keys. Lang et al. (1988): Bahamas. Goreau (1959), Goreau and Wells (1967): Jamaica. Roberts (1971): Cayman Islands. Kuhlmann (1974), Zlatarski and Estalella (1982): Cuba. Almy and Carrion-Torres (1963), Pressick (1970), Goenaga et al.(1989): Puerto Rico. Brawley and Adey (1982): Haiti. Lewis (1974), Tomascik (1987): Barbados. Rogers (1982), Rogers (1988), Gladfelter (1982)

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

This species occurs in the Caribbean, the Gulf of Mexico, Florida, and the Bahamas. While A. cervicornis has been documented further north along the Florida east coast, the northern extension of A. palmata is at Fowey Rocks offshore the Miami area (25°37’ N) (Porter et al. 1987).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Historic Range:
U.S.A. (FL, PR, VI, Navassa); and wider Caribbean- Belize, Colombia, Costa Rica, Guatemala, Honduras, Mexico, Nicaragua, Panama, Venezuela, and all the islands of the West Indies.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Elkhorn coral maintains a relatively large coral body. Elkhorn coral was named after its branching pattern, which is remnant of an elk’s antlers. These antler-like branches are sturdy and thick. The color of the coral, due to the symbiotic zooanthellae, ranges from yellow to a yellowish-brown.

Average length: .75 m.

Sexual Dimorphism: sexes alike

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

"Elkhorn coral was formerly the dominant species in shallow water (3 ft-16 ft (1-5 m) deep) throughout the Caribbean and on the Florida Reef Tract, forming extensive, densely aggregated thickets (stands) in areas of heavy surf. Coral colonies prefer exposed reef crest and fore reef environments in depths of less than 20 feet (6 m), although isolated corals may occur to 65 feet (20 m)." (NOAA Fisheries OPR)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Soulanille, Elaine

Source: EOL Rapid Response Team

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Habitat Type: Marine

Comments: Occupies depth range from 0-17 m, but typically occurs between 1-5 m (Goreau and Wells, 1967).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
This species is found in shallow tropical reef ecosystems, favouring outer reef slopes exposed to wave action. It has been recorded to depths of 22 m at Flower Garden Banks in the Gulf of Mexico (Zimmer et al. 2005), but this is a recent range extension potentially due to the results of climate change (Precht and Aronson 2004). The normal depth range is 0.5-5 m (Goreau and Wells 1967), but it can be found up to 40 m.

This species has limited sexual recruitment.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Elkhorn coral is found in shallow water, generally ranging from 1 to 5 meters deep. Elkhorn coral is a tropical species and inhabits waters with a temperature range of 66 tol 86 degrees F. This coral tolerates salinities within the normal range of 33 to 37 parts per thousand. Elkhorn coral often establishes in heavy surf close to shore, where the preferential exposed reef crests create an optimal habitat.

Range depth: 1 to 20 m.

Average depth: 3.5 m.

Habitat Regions: tropical ; saltwater or marine

Aquatic Biomes: reef ; coastal

Other Habitat Features: intertidal or littoral

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 5608 specimens in 1 taxon.
Water temperature and chemistry ranges based on 4534 samples.

Environmental ranges
  Depth range (m): 0 - 41
  Temperature range (°C): 26.007 - 28.067
  Nitrate (umol/L): 0.024 - 3.505
  Salinity (PPS): 34.667 - 36.556
  Oxygen (ml/l): 4.285 - 4.748
  Phosphate (umol/l): 0.038 - 0.239
  Silicate (umol/l): 0.805 - 5.080

Graphical representation

Depth range (m): 0 - 41

Temperature range (°C): 26.007 - 28.067

Nitrate (umol/L): 0.024 - 3.505

Salinity (PPS): 34.667 - 36.556

Oxygen (ml/l): 4.285 - 4.748

Phosphate (umol/l): 0.038 - 0.239

Silicate (umol/l): 0.805 - 5.080
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

SEDENTARY

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Food Habits

Elkhorn coral get much of their food energy from the algae symbionts that live in their tissues. The polyps provide the algae protection, suitable habitat, and waste products that the algae use as nutrients In return, the zooxanthellae produce surplus sugars that the polyps use as food. Elkhorn coral polyps also use their tentacles to capture small particles of detritus and also small organisms, including phytoplankton, microbes, and small zooplankton.

Animal Foods: zooplankton

Plant Foods: sap or other plant fluids; phytoplankton

Other Foods: detritus ; microbes

Primary Diet: herbivore (Eats sap or other plant foods); planktivore

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

"Elkhorn coral, like many corals, receive most of their energy and oxygen from symbiotic organisms called zooxanthellae." (NOAA Fisheries OPR)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Soulanille, Elaine

Source: EOL Rapid Response Team

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Ecosystem Roles

Elkhorn coral is a major component of many reef ecosystems. Its physical structure provides essential refuges for reef animals, both young and adult, as well as food for many species.

Ecosystem Impact: creates habitat

Mutualist Species:

  • Zooxanthellae

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Elkhorn coral rely on their excreted coral bodies to retract into and hide from predators. These predators include many species of damselfish (Pomacentridae), which suck and pluck the coral polyps out of the coral body. Fireworms (such as Hermodice carunculata) and corallivorous snail species in the family Coralliophilidae range over the coral colony grazing on polyps.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: Unknown

Comments: Information is needed on the number of occurrences in the tropical western Atlantic. Only three recent occurrences in Florida, USA.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

Unknown

Comments: Limited to shallow-water hard-bottom communities including reef rubble communities, reef crests, reef flats, spur and groove reefs and transitional reefs (Goreau and Wells, 1967; Cairns, 1982; Tomascik and Sander, 1987).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

A84PET01FCUS, A82GLA01FCUS, A81ANT02FCUS, A81BAK01FCUS: white band disease, algal tumors due to damselfish, gastropod predators. A84LAS02FCUS, A89GOE01FCUS, A90GHI01FCUS, A90WIL01FCUS: susceptible to bleaching (loss of zooxanthellae) due to adverse environmental conditions. A82ROB00FCUS, A79JAA00FCUS: upper temperature limit cited at 35.8 degrees Celsius. A92COL01FCUS: salinity tolerance range between 18 and 40 ppt. J89JAA00FCUS: environmentally sensitive; requires clear, well-circulated water.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

"Over the last 10,000 years, elkhorn coral has been one of the three most important Caribbean corals contributing to reef growth and development and providing essential fish habitat." (NOAA Fisheries OPR)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Soulanille, Elaine

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Although elkhorn coral polyps do not communicate with other polyps directly, they do exhibit some behaviors indicating some sort of perceptive response. For example, the release of gametes for breeding occurs with all polyps at the same time per breeding season. On a full moon in August or September, the polyps will release gametes; this is an indication of perception of light (length of day), temperature, and nightime light from the moon. The polyps also exhibit a form of tactile response in that they react to touch and release venomous nematocytes.

Perception Channels: visual ; tactile

  • Bythell, J., E. Gladfelter, M. Bythell. 1993. Chronic and catastrophic natural mortality of three common Caribbean corals. Coral Reefs, 12: 143-152.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

Development

In elkhorn coral, eggs and sperm are released into the water column and fertilization occurs near the surface. After about 78 hours, larvae of planula develop cilia, giving them the appearance of “fuzzy balls.” Motility is observed at this stage. Larvae remain in surface waters during their early development aided by high lipid content. The coral larvae live in the plankton for 3 to 5 days until finding a suitable area to settle. Few larvae actually survive. Those that do, metamorphose into the polyp stage. These polyps then contribute to the development of a new colony.

Development - Life Cycle: metamorphosis ; colonial growth

  • Adey, W. 1975. The algal ridges and coral reefs of St. Croix. Atoll Resource Bulletin, 187: 1-67.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Elkhorn coral reaches its maximum size at 10 to 12 years old. Elkhorn coral’s branches can increase in length as fast as 2-4 inches per year. While a colony can persist for centuries, individual coral polyps usually live for 2 to 3 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

"Like counting rings in the trunk of a tree, the age of corals can be determined by examining coral growth rings." (NOAA Fisheries OPR)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Soulanille, Elaine

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

"The coral larvae (planula) live in the plankton for several days until finding a suitable area to settle, but very few larvae survive to settle and metamorphose into new colonies. The preponderance of asexual reproduction in this species raises the possibility that genetic diversity may be very low in the remnant populations." (NOAA Fisheries OPR)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Soulanille, Elaine

Source: EOL Rapid Response Team

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Szmant (1986): sexual mode is hermaphroditic protogynous. Gametogenesis for females takes place between September to May, while for males is from May to July. Spawning season is in August with external development. Highsmith (1982): juveniles uncommon, principal mode of localized recruitment is via fragmentation.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

A majority of elkhorn coral reproduction involves asexual reproduction. Branches of the coral can break off and attach to substrate. The coral animals within the branch can then colonize the new area and begin a new colony.

Elkhorn coral also reproduce sexually. Each colony contains both male and female structures, and is simultaneously hermaphroditic. Millions of male and female gametes are released into the water at the same time (usually synchronized with other adjacent colonies). This sexual reproduction occurs once a year, usually in August or September on a full moon. The coral larva, or planula, will float in the water column as plankton for several days until they land on suitable substrate. The planula then metamorphose into colonial polyps. Thus, a new colony is started.

Breeding interval: Elkhorn coral spawn once a year.

Breeding season: August to September

Key Reproductive Features: iteroparous ; seasonal breeding ; simultaneous hermaphrodite; sexual ; asexual ; fertilization (External ); broadcast (group) spawning; oviparous

Elkhorn coral exhibit no parental care.

Parental Investment: no parental involvement

  • Adey, W. 1975. The algal ridges and coral reefs of St. Croix. Atoll Resource Bulletin, 187: 1-67.
  • Bak, R. 1983. Neoplasia, regeneration and growth in the reef building coral Acropora plamata. Marine Biology, 77: 221-227.
  • National Marine Fisheries Service, 2008. "Elkhorn Coral (Acropora palmata)" (On-line). Office of Protected Resources, Species Information. Accessed December 20, 2008 at http://www.nmfs.noaa.gov/pr/species/invertebrates/elkhorncoral.htm.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Acropora palmata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACGTTATATTTAGTCTTTGGGATTGGGGCAGGCATGATTGGCACGGCCTTCAGTATGTTAATAAGATTAGAGCTCTCGGCTCCGGGGGCTATGCTAGGAGAC---GATCATCTTTATAATGTAATTGTTACGGCACATGCTTTTATTATGATTTTTTTTTTGGTTATGCCAGTGATGATAGGGGGGTTTGGAAATTGGTTGGTTCCACTATATATTGGTGCTCCCGACATGGCCTTCCCCCGGCTTAATAATATTAGTTTTTGGTTGTTGCCTCCTGCTCTAATATTGTTATTAGGCTCCGCTTTTGTTGAACAAGGAGTTGGTACCGGGTGGACGGTGTATCCTCCTCTATCGAGCATCCAGGCTCACTCTGGGGGGGCGGTGGACATGGCTATTTTTAGCCTTCACTTAGCTGGGGTGTCTTCGATTTTGGGTGCAATGAATTTTATAACAACTATATTGAATATGCGGGCCCCTGGGATGACATTAAATAAAATGCCATTGTTTGTGTGGTCTATCTTGATTACTGCTTTTTTATTATTACTACCTTTGCCAGTACTAGCGGGGGCGATAACCATGCTTTTAACGGATAGAAATTTTAATACCACTTTTTTTGATCCCGCCGGAGGGGGAGACCCAATTTTATTTCAGCATTTGTTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Acropora palmata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Genomic DNA is available from 1 specimen with morphological vouchers housed at Australian Museum, Sydney
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G1 - Critically Imperiled

Reasons: Although still widespread, this species has undergone declines of over 80% since the 1980's and is listed as critically endangered by the IUCN (Aronson et al. 2008). It is considered extremely susceptible to sedimentation, bleaching, disease, eutrophication, anchor damage and boat groundings (Jaap, 1979; Bak, 1981; Gladfelter, 1982; Peters, 1984).

Intrinsic Vulnerability: Highly vulnerable

Comments: Low sexual recruitment and environmentally sensitive to temperature, salinity, and turbidity (Jaap, 1979; Highsmith, 1982; Szmant, 1986; Coles, 1992).

Environmental Specificity: Very narrow. Specialist or community with key requirements scarce.

Comments: Limited to shallow-water hard-bottom communities including reef rubble communities, reef crests, reef flats, spur and groove reefs and transitional reefs (Goreau and Wells, 1967; Cairns, 1982; Tomascik and Sander, 1987).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
CR
Critically Endangered

Red List Criteria
A2ace

Version
3.1

Year Assessed
2008

Assessor/s
Aronson, R., Bruckner, A., Moore, J., Precht, B. & E. Weil

Reviewer/s
Livingstone, S., Polidoro, B. & Smith, J. (Global Marine Species Assessment)

Contributor/s

Justification
This species is listed as Critically Endangered as there has been a population reduction exceeding 80% over the past 30 years due, in particular to the effects of disease, as well as other climate change and human-related factors. This species is particularly susceptible to bleaching. Although the current population is persisting at a very low abundance and the current population trend appears to be stable, there are places where populations continue to decrease and others where there seems to be moderate or localized recovery. Whether mortality continues to exceed growth and recruitment or not, this species requires immediate investigation and monitoring on a regional scale.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Current Listing Status Summary

Status: Threatened
Date Listed: 06/08/2006
Lead Region:   National Marine Fisheries Service (Region 11) 
Where Listed:


Population detail:

Population location: Entire
Listing status: T

For most current information and documents related to the conservation status and management of Acropora palmata , see its USFWS Species Profile

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Populations of elkhorn coral have declined drastically since the 1980's. Estimates are in the range of 90-95% reduction in abundance since 1980 in areas where loss has been quantified. Reductions of 75-90% were observed in some areas such as the Florida keys in 1998 due to bleaching and hurricane damage. The species is listed as Threatened under the U.S. Endangered Species Act, and Critically Endangered by the IUCN. Like all stony corals (Scleractinia) it is listed in Appendix II of CITES, so international trade is somewhat limited.

US Federal List: threatened

CITES: appendix iii

State of Michigan List: no special status

IUCN Red List of Threatened Species: critically endangered

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Short Term Trend: Decline of 50 to >90%

Comments: This species has undergone declines of over 80% since the 1980's (Aronson et al. 2008).

Global Long Term Trend: Decline of 70 to >90%

Comments: This species has undergone declines of over 80% since the 1980's (Aronson et al. 2008).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
There has been an 80-98% loss of individuals in parts of the Caribbean since the 1980s. There have been some signs of recovery. A second report has validated declines on the order of 97% in the Florida Keys, Jamaica, Dry Tortugas, Belize and St Croix (Acropora BRT 2005) and Puerto Rico (Weil et al. 2003).

There are signs of recovery in populations in some localities. For example, populations in St Croix showed increases from 2001-2003, although larger colonies are not surviving, as large colonies are more affected by stressors (Grober-Dunsmore et al. 2006). Similarly, there are signs of recovery in Puerto Rico and other parts of the southern Caribbean (E. Weil pers. comm.). However, some of these same populations have undergone subsequent declines.

Overall, decline of destroyed and critical reefs in the Caribbean region has been 38% (according to Wilkinson 2004) however there have been much higher population reductions for this species as it is particularly susceptible to disease and bleaching.

The age of first maturity of most reef building corals is typically three to eight years (Wallace 1999) and therefore we assume that average age of mature individuals is greater than eight years. Furthermore, based on average sizes and growth rates, we assume that average generation length is 10 years, unless otherwise stated. Total longevity is not known, but likely to be more than ten years. Therefore any population decline rates for the Red List assessment are measured over at least 30 years. Follow the link below for further details on population decline and generation length estimates.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Degree of Threat: A : Very threatened throughout its range communities directly exploited or their composition and structure irreversibly threatened by man-made forces, including exotic species

Comments: Considered extremely susceptible to sedimentation, bleaching, disease, eutrophication, anchor damage and boat groundings (Jaap, 1979; Bak, 1981; Gladfelter, 1982; Peters, 1984). Tilmant (1987): extensive damage in Biscyane National Park, Florida from boat groundings. Rogers (1988): diver-related damage in USVI. Dustan and Halas (1987): extensive anchor damage in Florida.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Major Threats
The major threat to this species has been disease, specifically white-band disease which is believed to be the primary cause for the region wide acroporid decline during the 1980s (Aronson and Precht, 2001a,b) and is still ongoing (Williams and Miller, 2005). Other major threats include thermal-induced bleaching, storms, and other diseases (Rodriguez-Martinez et al. 2001,Precht et al. 2002,Patterson et al. 2002,Acropora BRT 2005).

Localized declines are associated with: loss of habitat at the recruitment stage due to algal overgrowth and sedimentation; predation by snails; mortality by endolithic sponges; ship groundings, anchor damage, trampling, and marine debris. The long-term threat of reduced skeletal integrity due to ocean acidification is of particular concern due to the species' presence in wave-swept environments.

In general, the major threat to corals is global climate change, in particular, temperature extremes leading to bleaching and increased susceptibility to disease, increased severity of ENSO events and storms, and ocean acidification.

Coral disease has emerged as a serious threat to coral reefs worldwide and a major cause of reef deterioration (Weil et al. 2006). The numbers of diseases and coral species affected, as well as the distribution of diseases have all increased dramatically within the last decade (Porter et al. 2001, Green and Bruckner 2000, Sutherland et al. 2004, Weil 2004). Coral disease epizootics have resulted in significant losses of coral cover and were implicated in the dramatic decline of acroporids in the Florida Keys (Aronson and Precht 2001, Porter et al. 2001, Patterson et al. 2002). Escalating anthropogenic stressors combined with the threats associated with global climate change of increases in coral disease, frequency and duration of coral bleaching and ocean acidification place coral reefs at high risk of collapse.

Localized threats to corals include fisheries, human development (industry, settlement, tourism, and transportation), changes in native species dynamics (competitors, predators, pathogens and parasites), invasive species (competitors, predators, pathogens and parasites), dynamite fishing, chemical fishing, pollution from agriculture and industry, domestic pollution, sedimentation, and human recreation and tourism activities.

The severity of these combined threats to the global population of each individual species is not known.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

"The dominant mode of reproduction for elkhorn coral is asexual fragmentation; this life history trait allows rapid population recovery from physical disturbances such as storms. However, this mode of reproduction makes recovery from disease or bleaching episodes (in which entire colonies or even entire stands are killed) very difficult. The large role of asexual reproduction for this species increases the likelihood that genetic diversity in the remnant populations may be very low. Scientists are becoming increasingly concerned for this species based on its demographic paramaters; specifically, how species recruitment and genetic diversity affect recovery potential." (NOAA Fisheries OPR)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Soulanille, Elaine

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Legislation

"NMFS finalized the ESA listing of elkhorn and staghorn coral on May 4, 2006 (71 FR 26852). NMFS designated critical habitat for elkhorn and staghorn corals in November 2008." (NOAA Fisheries OPR)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Soulanille, Elaine

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Biological Research Needs: Data needed on trend of extant populations throughout tropical western Atlantic.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Protection: Few to several (1-12) occurrences appropriately protected and managed

Comments: Two occurrences are known to be protected in the Florida Keys. Specific information is lacking for other parts of its range.

Needs: Mooring buoys should be installed near extant populations. All extant populations should be included in marine protected areas.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation Actions

Conservation Actions
Listed on CITES Appendix II and Threatened on the US Endangered Species Act. In the US, it is present in several MPAs, including Florida Keys National Marine Sanctuary, Biscayne N.P., Dry Tortugas National Park, Buck Island Reef National Monument and Flower Garden Banks National Marine Sanctuary. Also present Hol Chan Marine Reserve (Belize), Exuma Cays Land and Sea Park (Bahamas). In US waters, it is illegal to harvest corals for commercial purposes. In response to ship grounding and hurricanes, there have been efforts to salvage damaged corals and reattach them in acroporid habitats.

More information is needed to assist the recovery of acroporids including survival and fecundity by age, sexual and asexual recruitment, population information, juvenile population dynamics, importance of habitat variables to recruitment and survivorship, and location of populations showing signs of recovery (Bruckner, 2002). Further research is needed into disease etiology, and effectiveness of current restoration methods.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

"Florida Keys National Marine Sanctuary (FKNMS), the largest coral reef management entity in the region, has developed a management plan for the Sanctuary's corals that includes protective activities, such as zoning, channel markings, and restoration efforts.

Restoration activities have included efforts to re-attach Acropora fragments generated by ship groundings and hurricane events; these efforts have had mixed success. Similar efforts to re-attach coral fragments have also been made in Puerto Rico and the U.S. Virgin Islands.

Other restoration efforts have included attempts to culture and settle coral larvae with very limited success. New techniques for restoring Acropora are currently being pursued. Such new techniques involve enhancing sexual recruitment, reestablishing ecological roles within reef systems (e.g. herbivorous urchins), and other methods for controlling predators and disease.

In 1998, the United States Coral Reef Task Force was established by Presidential Executive Order 13089 to coordinate and strengthen efforts for protecting coral reef ecosystems. The Task Force is co-chaired by the Departments of Commerce and Interior, and includes leaders of 12 federal agencies, seven U.S. states and territories, and three freely associated states. In 2002, the Task Force adopted a resolution calling for the development of Local Action Strategies, which are locally-driven plans for collaborative and cooperative action among federal, state, territory, and non-governmental partners to reduce key threats on valuable coral reef resources. Three Local Action Strategies have been developed within the range of elkhorn coral for Florida, Puerto Rico, and the U.S. Virgin Islands. These strategies are underway and will be implemented over a three-year period (FY2005-2007)."

(NOAA Fisheries OPR)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Soulanille, Elaine

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Elkhorn coral offers no direct economic negativities, although is does offer a reflection of negative humans impacts. The destruction of coral reefs due to rising ocean temperatures and an runoff is causing severe economic damage in ecotourism and coastal fisheries. The anthropogenic effects on Elkhorn coral will lead to negative economic implications.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

The presence of elkhorn coral has several major economic implications for humans. Ecotourism in the Caribbean relies on healthy reefs, with not only healthy coral, but a healthy ecosystem full of interesting things to see such as fish and other marine animals. The pet trade, in the form of troical reef fish, is supported by healthy coral popualtions which house juvenille reef fish. Elkhorn coral also builds many reefs that are researched extensively, such as those in the Florida keys and the Caribbean.

Positive Impacts: pet trade ; ecotourism ; research and education

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Risks

Stewardship Overview: Populations on nearshore reef communities need to be monitored for viability as related to water quality.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Elkhorn coral

Elkhorn coral (Acropora palmata) is considered to be one of the most important reef-building corals in the Caribbean. This species is structurally complex with many large branches. The coral structure closely resembles that of elk antlers. These branches create habitats for many other reef species, such as lobsters, parrot-fish, snapper shrimps and other reef fish. Elkhorn coral colonies are incredibly fast-growing, with an average growth rate of 5 to 10 cm (2.0 to 3.9 in) per year and can eventually grow up to 3.7 m (12 ft) in diameter. The color of this coral species ranges from brown to a yellowish-brown as a result of the symbiotic zooxanthellae living inside the tissue of this coral species. Zooxanthellae are a type of algae which photosynthesize to provide the coral with nutrients. The zooxanthellae are also capable of removing waste products from the coral. Historically, the majority of elkhorn coral reproduction has occurred asexually; this occurs when a branch of the coral breaks off and attaches to the substrate, forming a new colony, known as fragmentation. The degree to which local stands reproduce by fragmentation varies across the Caribbean, but on average, 50% of colonies are the result of fragmentation rather than sexual reproduction. Sexual reproduction occurs once a year in August or September when coral colonies release millions of gametes by broadcast spawning.

Distribution[edit]

Elkhorn coral exist in the Caribbean, the Bahamas, and Florida Keys. Its range reaches as far north as Biscayne National Park, Florida, and as far south as Curaçao and Venezuela. However, at least in part as a result of climate change, the range of elkhorn coral has expanded northward along the Florida peninsula and into the northern parts of the Gulf of Mexico.

Elkhorn corals are found primarily in shallow waters with temperatures between 26 and 30 °C (79 and 86 °F), and with significant water movement. They are one of the most abundant species in waters ranging from 1 to 5 m (3.3 to 16.4 ft) deep, and a few colonies have been reported from waters as deep as 20 m (66 ft) (e.g. Navassa Island).

Threats[edit]

Acropora palmata afflicted with white pox disease, Molasses Reef, Florida Keys, in March 2008

Elkhorn coral was once one of the most abundant species of coral in the Caribbean and the Florida Keys. Since 1980, an estimated 90-95% of elkhorn coral has been lost. Threats include disease, coral bleaching, predation, climate change, storm damage, and human activity. All of these factors have created a synergistic effect that greatly diminishes the survival and reproductive success of elkhorn coral. Natural recovery of coral is a slow process, and may never occur with this species because so many factors inhibit its survival.

Diseases that affect elkhorn coral include white pox disease, white band disease, and black band disease. White pox disease, which only affects elkhorn coral, is caused by a fecal enterobacterium, Serratia marcescens. The disease is very contagious and commonly moves from one colony to its nearest neighbor. White pox creates white lesions on the coral skeleton and results in an average tissue loss of 2.5 cm2 (0.39 sq in) per day, but can cause as much tissue loss as 10.5 cm2 (1.63 sq in) per day. White band disease and black band disease have also greatly reduced the abundance of elkhorn coral. Diseases are one of the major causes of coral mortality, however, they are not well studied or understood.

Predators of elkhorn coral include coral-eating snails (Coralliophila abbreviata), polychaetes such as the bearded fireworm, and damselfish. Predation by these organisms reduces the corals' growth and ability to reproduce. Predation can eventually lead to the death of the coral colony.

Conservation[edit]

Several efforts to conserve the elkhorn coral have had mixed results. The Florida Keys National Marine Sanctuary has served as a protected region for the area’s coral species, and has also developed plans for the protection and restoration of elkhorn coral. Restoration efforts have included attempts to reattach coral fragments that were broken off during hurricanes or by ships. Attempts to reattach coral fragments have also occurred in Puerto Rico and the Virgin Islands, but all have had limited success.

Attempts are also being made to conserve the coral by culturing coral fragments. The Florida Keys National Marine Sanctuary, the National Oceanographic and Atmospheric Administration, and Mote Marine Laboratory all are having limited success with coral nurseries in the Florida Keys and Puerto Rico.

The National Oceangraphic and Atmospheric Administration (NOAA) has developed and tested several ecological methods to restore this coral, including removing coral predators and reintroducing herbivores to the ecosystems to feed on harmful algae that grow on the coral.

In 2004, the Center for Biological Diversity requested the National Marine Fisheries Service (NMFS) to place elkhorn coral on the endangered species list. In 2005, NMFS decided elkhorn coral qualified as an endangered species under the Endangered Species Act of 1973. On May 4, 2006, elkhorn coral and staghorn coral (A. cervicornis) were officially placed on the Endangered Species List.

References[edit]

  1. ^ WoRMS (2010). "Acropora palmata (Lamarck, 1816)". World Register of Marine Species. Retrieved 2011-12-09. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!