Articles on this page are available in 1 other language: Spanish (14) (learn more)

Overview

Brief Summary

Biology

zooxanthellate
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Biology: Skeleton

More info
AuthorSkeleton?Mineral or Organic?MineralPercent Magnesium
Cairns, Hoeksema, and van der Land, 1999 YES MINERAL ARAGONITE
Veron, 2000 YES MINERAL ARAGONITE
Barrios-Su?z et al., 2002 YES MINERAL ARAGONITE
den Hartog, 1980 YES MINERAL ARAGONITE
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Hexacorallians of the World

Source: Hexacorallians of the World

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Aruba, Belize, Bonaire, Caribbean Sea, Cayman Islands, Colombia, Costa Rica, Cuba, Curaçao, Gulf of Mexico, Hispaniola, Honduras, Jamaica, Mexico, Nicaragua, Panama, Puerto Rico, Venezuela, West Atlantic
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

This species occurs in the Caribbean, southern Gulf of Mexico, Florida, the Bahamas, and Bermuda.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Widespread distribution in the tropical western Atlantic, including the Gulf of Mexico, southern Florida, Bahamas, NW Caribbean, Puerto Rico, lesser Antilles, Curacao and Bonaire. B71SMI01FCUS: Florida, West Indies. B78COL01FCUS: Florida, Bahamas, Caribbean. A82CAI01FCUS: Belize. A83FAR01FCUS, A88TUN01FCUS: Gulf of Mexico. A82DAV00FCUS, A87DUS00FCUS, A89GLY00FCUS, A85BUR00FCUS, A85WHI01FCUS, A73GOL00FCUS, J88WHE00FCUS, J89JAA00FCUS, U92SUL01FCUS, B84JAA00FCUS: southern Florida. A67GOR01FCUS, A59GOR01FCUS, A73WEL01FCUS: Jamaica. B82ZLA01FCUS: Cuba. A88FEN00FCUS, A81JOR01FCUS: Mexico. A76LOY01FCUS, A63ALM01FCUS, A70PRE01FCUS: Puerto Rico. A87TOM01FCUS, A79DUN01FCUS, A74LEW01FCUS, A76GOO01FCUS, A72ROB01FCUS, A90EDM00FCUS: lesser Antilles. A74SCA01FCUS, A78FOC01FCUS: Bonaire.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species occurs up to 15 m depth, but is most abundant from 0.5-3 m depth in back-reef and exposed fore-reef environments (Goreau and Wells 1967, A. Bruckner pers. comm.).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known from the nearshore.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 1159 specimens in 1 taxon.
Water temperature and chemistry ranges based on 941 samples.

Environmental ranges
  Depth range (m): 0 - 75.5
  Temperature range (°C): 25.995 - 28.067
  Nitrate (umol/L): 0.024 - 3.505
  Salinity (PPS): 35.075 - 36.556
  Oxygen (ml/l): 4.285 - 4.748
  Phosphate (umol/l): 0.020 - 0.239
  Silicate (umol/l): 0.805 - 5.080

Graphical representation

Depth range (m): 0 - 75.5

Temperature range (°C): 25.995 - 28.067

Nitrate (umol/L): 0.024 - 3.505

Salinity (PPS): 35.075 - 36.556

Oxygen (ml/l): 4.285 - 4.748

Phosphate (umol/l): 0.020 - 0.239

Silicate (umol/l): 0.805 - 5.080
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Marine

Comments: Overall depth range from 0-20 m, but typically occurs between 1-3 m on transitional reefs and spur and groove reefs.

A67GOR01FCUS: 0 to 10 (35?) m, typically 1 to 3 m depth. A73GOL01FCUS: patch reef, outer reef platform. A82CAI01FCUS: lagoon, back reef, spur and groove zone (0.5 to 6.0 m). A85WHI01FCUS, J88WHE00FCUS: fore reef zones on spur and groove reefs. B84JAA00FCUS: transitional reefs. A76LOY01FCUS: reef flat and fore reef. A82DAV00FCUS: bank reefs and octocoral-dominated hardgrounds. A71ROB01FCUS: rock floor, rubble flat and reef crest. A79DUN01FCUS: butress zone and patch reefs.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

SEDENTARY

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 to >300

Comments: Information is needed on the number of occurrences in the tropical western Atlantic.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Abundance

2500 - 10,000 individuals

Comments: Occurs on most classes of marine hardbottom communities, including low-relief hardbottom communities, reef rubble areas, patch reefs, fringing reefs, spur and groove reefs, transitional reefs and deeper intermediate reefs.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

A90GHI01FCUS, A90WIL01FCUS: susceptible to bleaching (loss of zooxanthellae) due to adverse environmental conditions; black band disease. A84PET01FCUS: associated necrosis and algal infection. A81ANT02FCUS: seldom inflicted with black band disease. A92COL01FCUS: salinity tolerance range up to 55 ppt for 12 h. A15VAU01FCUS: growth rate measured at 5.3-24.4 mm/yr increase in diameter and 2.5-8.8 mm/yr increase in height. A72OTT01FCUS: preyed upon by Hermodice caruncullata and Coralliophila abbreviata.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Reproduction

No information on reproductive ecology from resources consulted.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Diploria clivosa

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ACTGCTTTTAGTATGCTTATACGACTGGAGCTATCTGCGCCAGGCGCTATGTTAGGGGAT---GATCATCTTTATAATGTAATTGTAACAGCACATGCTTTTGTTATGATTTTTTTTTTAGTAATGCCGGTTATGATTGGGGGGTTTGGAAACTGGCTAGTGCCATTATATATTGGGGCACCGGATATGGCGTTCCCCCGATTAAATAATATTAGTTTTTGGTTATTACCGCCTGCTTTGTTTTTATTGTTAGGCTCTGCTTTTGTTGAACAAGGCGCAGGAACGGGATGAACGGTTTATCCTCCTCTTTCTGATATTTATGCGCACTCTGGGGGTTCTGTTGACATGGTTATTTTTAGTCTTCATTTAGCTGGGGTCTCTTCTATCTTAGGAGCAATAAACTTTATTACAACGATTTTCAACATGCGAGCTCCTGGTATTTCTTTTAATAGAATGCCTTTGTTTGTTTGGTCTATTTTAATAACTGCTTTTTTATTACTTTTATCTTTGCCTGTATTAGCGGGTGCAATTACTATGTTATTAACAGATCGAAATTTTAATACAACTTTTTTTGATCCTTCTGGAGGGGGAGATCCTATTTTATTCCAACATTTATTTTGGTTTTTTGGGCAT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Diploria clivosa

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Genomic DNA is available from 8 specimens with morphological vouchers housed at British Antarctic Survey
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Aronson, R., Bruckner, A., Moore, J., Precht, B. & E. Weil

Reviewer/s
Livingstone, S., Polidoro, B. & Smith, J. (Global Marine Species Assessment)

Contributor/s

Justification
The most important known threat for this species is extensive reduction of coral reef habitat due to a combination of threats. Specific population trends are unknown but population reduction can be inferred from estimated habitat loss (Wilkinson 2004). It is widespread in the Caribbean and common throughout its range and therefore is likely to be more resilient to habitat loss and reef degradation because of an assumed large effective population size that is highly connected and/or stable with enhanced genetic variability. Therefore, the estimated habitat loss of 10% from reefs already destroyed within its range is the best inference of population reduction since it may survive in coral reefs already at the critical stage of degradation (Wilkinson 2004). This inference of population reduction over three generation lengths (30 years) does not meet the threshold of a threat category and this species is Least Concern. However, because of predicted threats from climate change and ocean acidification it will be important to reassess this species in 10 years or sooner, particularly if the species is also observed to disappear from reefs currently at the critical stage of reef degradation.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G4 - Apparently Secure

Reasons: Widespread distribution in the tropical western Atlantic and occurs on most classes of marine hardbottom communities. Considered less threatened due to isolated incidences of disease reported and high salinity tolerance.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
This species is common in shallow water. No significant declines in populations have so far been recorded.

There is no species specific population information available for this species. However, there is evidence that overall coral reef habitat has declined, and this is used as a proxy for population decline for this species. This species is more resilient to some of the threats faced by corals and therefore population decline is estimated using the percentage of destroyed reefs only (Wilkinson 2004). We assume that most, if not all, mature individuals will be removed from a destroyed reef and that on average, the number of individuals on reefs are equal across its range and proportional to the percentage of destroyed reefs. Reef losses throughout the species' range have been estimated over three generations, two in the past and one projected into the future.

The age of first maturity of most reef building corals is typically three to eight years (Wallace 1999) and therefore we assume that average age of mature individuals is greater than eight years. Furthermore, based on average sizes and growth rates, we assume that average generation length is 10 years, unless otherwise stated. Total longevity is not known, but likely to be more than ten years. Therefore any population decline rates for the Red List assessment are measured over at least 30 years. Follow the link below for further details on population decline and generation length estimates.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Short Term Trend: Relatively stable (=10% change)

Comments: Information is needed on the status and trend of extant populations.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
The major threat to this species is black band disease, with localized impacts from bleaching and other diseases (e.g., white plague).

In general, the major threat to corals is global climate change, in particular, temperature extremes leading to bleaching and increased susceptibility to disease, increased severity of ENSO events and storms, and ocean acidification.

Coral disease has emerged as a serious threat to coral reefs worldwide and a major cause of reef deterioration (Weil et al. 2006). The numbers of diseases and coral species affected, as well as the distribution of diseases have all increased dramatically within the last decade (Porter et al. 2001, Green and Bruckner 2000, Sutherland et al. 2004, Weil 2004). Coral disease epizootics have resulted in significant losses of coral cover and were implicated in the dramatic decline of acroporids in the Florida Keys (Aronson and Precht 2001, Porter et al. 2001, Patterson et al. 2002). Escalating anthropogenic stressors combined with the threats associated with global climate change of increases in coral disease, frequency and duration of coral bleaching and ocean acidification place coral reefs at high risk of collapse.

Localized threats to corals include fisheries, human development (industry, settlement, tourism, and transportation), changes in native species dynamics (competitors, predators, pathogens and parasites), invasive species (competitors, predators, pathogens and parasites), dynamite fishing, chemical fishing, pollution from agriculture and industry, domestic pollution, sedimentation, and human recreation and tourism activities.

The severity of these combined threats to the global population of each individual species is not known.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Degree of Threat: C : Not very threatened throughout its range, communities often provide natural resources that when exploited alter the composition and structure over the short-term, or communities are self-protecting because they are unsuitable for other uses

Comments: Moderately threatened with high incidence of disease reported but high salinity tolerance.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
In the US, it is present in many MPAs, including Florida Keys National Marine Sanctuary, Biscayne N.P., Dry Tortugas National Park, Buck Island Reef National Monument and Flower Garden Banks National Marine Sanctuary. Also present Hol Chan Marine Reserve (Belize), Exuma Cays Land and Sea Park (Bahamas). In US waters, it is illegal to harvest corals for commercial purposes. (Aronson, R., Precht, W., Moore, J., Weil, E., and Bruckner, A. pers. comm.)

All corals are listed on CITES Appendix II.

Recommended measures for conserving this species include research in taxonomy, population, abundance and trends, ecology and habitat status, threats and resilience to threats, restoration action; identification, establishment and management of new protected areas; expansion of protected areas; recovery management; and disease, pathogen and parasite management. Artificial propagation and techniques such as cryo-preservation of gametes may become important for conserving coral biodiversity.

Having timely access to national-level trade data for CITES analysis reports would be valuable for monitoring trends this species. The species is targeted by collectors for the aquarium trade and fisheries management is required for the species, e.g., MPAs, quotas, size limits, etc. Consideration of the suitability of species for aquaria should also be included as part of fisheries management, and population surveys should be carried out to monitor the effects of harvesting. Recommended conservation measures include population surveys to monitor the effects of collecting for the aquarium trade, especially in Indonesia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biological Research Needs: Data needed on reproduction and recruitment patterns. Information needed on susceptibility to sedimentation and eutrophication.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Protection: Few to several (1-12) occurrences appropriately protected and managed

Comments: Numerous occurrences in the Florida Keys National Marine Sanctuary, Biscayne National Park and Dry Tortugas, Florida.

Needs: Mooring buoys should be installed in marine protected areas.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Diploria clivosa

Diploria clivosa, the knobby brain coral, is a colonial species of stony coral in the family Faviidae. It occurs in shallow water in the West Atlantic Ocean and Caribbean Sea.

Contents

Description

The knobby brain coral is a massive coral that either forms hemispherical domes or, particularly in areas of high wave action, forms plates and encrusts the seabed. It can grow to a diameter of about 1.3 metres (4 ft 3 in). The surface of the dome usually has a number of bulges or knobs but this species is not easy to distinguish from the symmetrical brain coral (Diploria strigosa) which tends to have a smoother outline. The surface consists of sharply delineated, convoluted ridges with valleys in between. There is no trough-like groove in the top of the ridge as is the case in the rather similar grooved brain coral (Diploria labyrinthiformis). The coral polyps are strung along the valley bottoms, each sitting in a little stony cup or corallite. The sides of these have minute walls called septae which come in four different sized cycles. They extend outside the corallites as costae that join one corallite to another but are discontinuous in this species, another distinguishing factor. The colour of the coral is usually some shade of yellowish or greenish brown and is caused by the presence of symbiotic dinoflagellates called zooxanthellae in the coral's tissues.[2][3]

Distribution and habitat

The knobby brain coral is a common species and occurs in southern Florida, the Caribbean Sea and the Bahamas. It is found growing on reefs, in seagrass (Thalassia testudinum) meadows, in lagoons and sometimes on mangroves. It grows at depths down to about 40 metres (130 ft) but is most common at depths less than 5 metres (16 ft).[2][3]

The fossilised remains of Diploria clivosa have been found alongside those of other massive corals Diploria strigosa, Siderastrea siderea and Solenastrea bouroni in marine deposits in Río Grande de Manatí, Puerto Rico that date back to the Pleistocene.[4]

Biology

During the day the polyps of the knobby brain coral are retracted into the corallites but at night they emerge and extend their tentacles to feed. The zooxanthellae are photosynthetic and up to fifty percent of their production is transferred to the host while they make use of the coral's nitrogenous waste.[5]

The knobby brain coral grows by the budding of new polyps and the deposition of new calcareous material. Growth is very slow and large corals may be over a hundred years old. Sexual reproduction occurs by the release of gametes into the water column. The planula larvae drift with the currents before settling on the seabed and undergoing metamorphosis into polyps. These begin to secrete their own skeletons and found new colonies.[5]

References

  1. ^ van der Land, Jacob (2012). "Diploria clivosa (Ellis & Solander, 1786)". World Register of Marine Species. http://www.marinespecies.org/aphia.php?p=taxdetails&id=289825. Retrieved 2012-09-10.
  2. ^ a b Colin, Patrick L. (1978). Marine Invertebrates and Plants of the Living Reef. T.F.H. Publications. p. 250. ISBN 0-86622-875-6. 
  3. ^ a b "Knobby brain coral (Diploria clivosa)". Interactive Guide to Caribbean Diving. Marine Species Identification Portal. http://species-identification.org/species.php?species_group=caribbean_diving_guide&id=308. Retrieved 2012-09-10.
  4. ^ Geological Survey (US) (1959). U.S. Geological Survey professional paper, Issue 317. G.P.O. p. 123. 
  5. ^ a b Dorit, R. L.; Walker, W. F.; Barnes, R. D. (1991). Zoology. Saunders College Publishing. p. 612. ISBN 0-03-030504-7. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!