Articles on this page are available in 1 other language: Spanish (12) (learn more)

Overview

Brief Summary

Biology

zooxanthellate
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Taxonomy

Manicina sp. includes over 10 species, but Manicina areolata is the only species that survives today.The Miocene and Pliocene (24 million to 1.6 million years ago) were the heydey of Manicina when a range of species lived in shallow and deep-water habitats associated with small patch reefs in the Caribbean sea.About 1 million years ago, approximately half the species of reef-corals living in the Caribbean became extinct, and Manicina was especially strongly hit.

Look-alikes
Meandrina braziliensis is a coral that looks superficially similar to Manicina areolata but differs by having much smoother skeletal elements and a plate-shaped columella.These characters mean that it is a member of the family Meandrinidae.During Miocene and Pliocene (24 million–1.6 million years ago), Meandrina braziliensis was more common than Manicina areolata on reef flats in the Caribbean region.During the Early Pleistocene (about 1 million years ago) Meandrina braziliensis became extinct in the Caribbean but survives as a refugee in northeastern Brazil.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Partner Web Site: Natural History Museum

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Introduction

Colonies of Manicina areolata coral are less than 10cm in diameter, and are either dome-like, or shaped like an ice cream cone when viewed from the side. They are free living or, when small, attach to small sediment grain, mollusc shells, or calcareous algae.If a colony becomes overturned by a fish or current it can right itself and avoid being smothered by sediment.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Partner Web Site: Natural History Museum

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Biology: Skeleton

More info
AuthorSkeleton?Mineral or Organic?MineralPercent Magnesium
Hickson, 1889 YES MINERAL ARAGONITE
Verrill, 1901 YES MINERAL ARAGONITE
Duerden, 1898 YES MINERAL ARAGONITE
Veron, 2000 YES MINERAL ARAGONITE
Cairns, Hoeksema, and van der Land, 1999 YES MINERAL ARAGONITE
Faurot, 1895 YES MINERAL ARAGONITE
Verrill, 1866 YES MINERAL ARAGONITE
den Hartog, 1980 YES MINERAL ARAGONITE
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Hexacorallians of the World

Source: Hexacorallians of the World

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Aruba, Belize, Bonaire, Caribbean Sea, Cayman Islands, Colombia, Costa Rica, Cuba, Curaçao, Guatemala, Gulf of Mexico, Hispaniola, Honduras, Jamaica, Mexico, Nicaragua, Panama, Puerto Rico, West Atlantic
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

This species occurs in the Caribbean, southern Gulf of Mexico, Florida (including the Florida Middle Grounds), the Bahamas, and Bermuda.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species occurs in back reef or fore reef environments, but only in soft bottom habitats or cobble, rubble, mixed-sand communities; common in subtidal seagrass beds. Occurs from 1-65 m depth, and most abundant from 1-10 m. This species is tolerant of temperature and salinity changes, and is found in areas of high sedimentation. Commonly co-occurs with the free-living form of Porites divaricata, Cladocora arbuscula, and Oculina species.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 292 specimens in 1 taxon.
Water temperature and chemistry ranges based on 264 samples.

Environmental ranges
  Depth range (m): 0 - 92
  Temperature range (°C): 23.246 - 28.035
  Nitrate (umol/L): 0.115 - 3.012
  Salinity (PPS): 35.219 - 36.787
  Oxygen (ml/l): 4.469 - 4.895
  Phosphate (umol/l): 0.020 - 0.205
  Silicate (umol/l): 1.014 - 5.080

Graphical representation

Depth range (m): 0 - 92

Temperature range (°C): 23.246 - 28.035

Nitrate (umol/L): 0.115 - 3.012

Salinity (PPS): 35.219 - 36.787

Oxygen (ml/l): 4.469 - 4.895

Phosphate (umol/l): 0.020 - 0.205

Silicate (umol/l): 1.014 - 5.080
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Instead it prefers shallow, productive near-shore habitats characterised by abundant sediments such as seagrass meadows, or along the fringes of mangrove forests.In these habitats, Manicina areolata is an important part of the 'soft-bottom' coral community that also contains species such as Siderastrea radians (the golf-ball coral) and Porites furcata (finger coral).These corals have special structural and behavioural characteristics that allow them to thrive in habitats where other species would be smothered in sediments.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Partner Web Site: Natural History Museum

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Behaviour

To overturn, the colony fills its stomach with sea water so it becomes bloated, and then alternatively jets water from one side and then another of the colony.This causes the colony to rock back and forth until the centre of gravity is surpassed and the colony rapidly flips upright.The entire process takes a few hours until the final flip occurs in an instant.Large colonies are less able to re-orient themselves because the weight of the skeleton increases with the volume of the colony, and the power of the water jets is related to the surface area.Once overturned, large colonies are more likely to die by smothering in the sediments.This places an upper limit on the size of the colonies and explains why in most habitats colonies rarely grow to more than 10cm.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Partner Web Site: Natural History Museum

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Individual colonies produce hundreds to thousands of larvae each year.Ovaries and spermaries develop on mesenteries that hang between septa.Gametes mature in late spring, and sperm are released on one or a few nights around the full moon in May or June.Fertilisation is internal, and small pear-shaped larvae are brooded in the stomach of the mother colony for two weeks.Larvae are released synchronously on the night of the new moon, possibly because the darkness provides some protection from predatory fish.Larvae are probably viable in water for a few weeks, but are able to settle immediately.Many settle quickly and maintain dense populations in suitable habitats (up to 50 per square meter in places along the Caribbean coast of Panama).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Partner Web Site: Natural History Museum

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Manicina areolata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ACTGCTTTTAGTATGCTTATACGACTGGAGCTATCTGCGCCAGGCGCTATGTTAGGGGAT---GATCATCTTTATAATGTAATTGTAACAGCACATGCTTTTGTTATGATTTTTTTTTTAGTAATGCCGGTTATGATTGGGGGGTTTGGAAACTGGCTAGTGCCATTATATATTGGGGCACCGGATATGGCGTTCCCCCGATTAAATAATATTAGTTTTTGGTTATTACCACCTGCTTTGTTTTTATTGTTAGGCTCTGCTTTTGTTGAACAAGGCGCAGGAACGGGATGAACGGTTTATCCTCCTCTTTCTGATATTTATGCGCACTCTGGGGGTTCTGTTGACATGGTTATTTTTAGTCTTCATTTAGCTGGGGTCTCTTCTATCTTAGGAGCAATAAACTTTATTACAACGATTTTCAACATGCGAGCTCCTGGTATTTCTTTTAATAGAATGCCTTTGTTTGTTTGGTCTATTTTAATAACTGCTTTTTTATTACTTTTATCTTTGCCTGTATTAGCGGGTGCAATTACTATGTTATTAACAGATCGAAATTTTAATACAACTTTTTTTGATCCTTCTGGAGGGGGAGATCCTATTTTATTCCAACATTTATTTTGGTTTTTTGGGCAT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Manicina areolata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Aronson, R., Bruckner, A., Moore, J., Precht, B. & E. Weil

Reviewer/s
Livingstone, S., Polidoro, B. & Smith, J. (Global Marine Species Assessment)

Contributor/s

Justification
The most important known threat for this species is extensive reduction of coral reef habitat due to a combination of threats. Specific population trends are unknown but population reduction can be inferred from estimated habitat loss (Wilkinson 2004). It is widespread and common throughout its range and therefore is likely to be more resilient to habitat loss and reef degradation because of an assumed large effective population size that is highly connected and/or stable with enhanced genetic variability. Therefore, the estimated habitat loss of 10% from reefs already destroyed within its range is the best inference of population reduction since it may survive in coral reefs already at the critical stage of degradation (Wilkinson 2004). This inference of population reduction over three generation lengths (30 years) does not meet the threshold of a threat category and this species is Least Concern. However, because of predicted threats from climate change and ocean acidification it will be important to reassess this species in 10 years or sooner, particularly if the species is also observed to disappear from reefs currently at the critical stage of reef degradation.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
This species can be locally abundant in seagrass beds.

There is no species specific population information available for this species. However, there is evidence that overall coral reef habitat has declined, and this is used as a proxy for population decline for this species. This species is more resilient to some of the threats faced by corals and therefore population decline is estimated using the percentage of destroyed reefs only (Wilkinson 2004). We assume that most, if not all, mature individuals will be removed from a destroyed reef and that on average, the number of individuals on reefs are equal across its range and proportional to the percentage of destroyed reefs. Reef losses throughout the species' range have been estimated over three generations, two in the past and one projected into the future.

The age of first maturity of most reef building corals is typically three to eight years (Wallace 1999) and therefore we assume that average age of mature individuals is greater than eight years. Furthermore, based on average sizes and growth rates, we assume that average generation length is 10 years, unless otherwise stated. Total longevity is not known, but likely to be more than ten years. Therefore any population decline rates for the Red List assessment are measured over at least 30 years. Follow the link below for further details on population decline and generation length estimates.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
Localized threats include disease (black-band disease), dredging, burial by sedimentation, removal and burial during hurricanes, and habitat loss due to loss of seagrass beds. In the past, this species was collected for the aquarium trade, but this now seems to be very limited.

In general, the major threat to corals is global climate change, in particular, temperature extremes leading to bleaching and increased susceptibility to disease, increased severity of ENSO events and storms, and ocean acidification.

Coral disease has emerged as a serious threat to coral reefs worldwide and a major cause of reef deterioration (Weil et al. 2006). The numbers of diseases and coral species affected, as well as the distribution of diseases have all increased dramatically within the last decade (Porter et al. 2001, Green and Bruckner 2000, Sutherland et al. 2004, Weil 2004). Coral disease epizootics have resulted in significant losses of coral cover and were implicated in the dramatic decline of acroporids in the Florida Keys (Aronson and Precht 2001, Porter et al. 2001, Patterson et al. 2002). Escalating anthropogenic stressors combined with the threats associated with global climate change of increases in coral disease, frequency and duration of coral bleaching and ocean acidification place coral reefs at high risk of collapse.

Localized threats to corals include fisheries, human development (industry, settlement, tourism, and transportation), changes in native species dynamics (competitors, predators, pathogens and parasites), invasive species (competitors, predators, pathogens and parasites), dynamite fishing, chemical fishing, pollution from agriculture and industry, domestic pollution, sedimentation, and human recreation and tourism activities.

The severity of these combined threats to the global population of each individual species is not known.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Listed on CITES Appendix II. In the US, it is present in many MPAs, including Florida Keys National Marine Sanctuary, Biscayne N.P., Dry Tortugas National Park, and Buck Island Reef National Monument. Also present in Hol Chan Marine Reserve (Belize), Exuma Cays Land and Sea Park (Bahamas). In US waters, it is illegal to harvest corals for commercial purposes.

All corals are listed on CITES Appendix II. Parts of the species’ range fall within Marine Protected Areas.

Recommended measures for conserving this species include research in taxonomy, population, abundance and trends, ecology and habitat status, threats and resilience to threats, restoration action; identification, establishment and management of new protected areas; expansion of protected areas; recovery management; and disease, pathogen and parasite management. Artificial propagation and techniques such as cryo-preservation of gametes may become important for conserving coral biodiversity.

Having timely access to national-level trade data for CITES analysis reports would be valuable for monitoring trends this species. The species is targeted by collectors for the aquarium trade and fisheries management is required for the species, e.g., MPAs, quotas, size limits, etc. Consideration of the suitability of species for aquaria should also be included as part of fisheries management, and population surveys should be carried out to monitor the effects of harvesting.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Manicina areolata

Manicina areolata, commonly known as rose coral, is a colonial species of stony coral in the family Faviidae. It occurs in shallow water in the West Atlantic Ocean and Caribbean Sea, sometimes as small solid heads and sometimes as unattached cone-shaped forms.

Contents

Description [edit]

Manicina areolata has two entirely different growth forms. Some individuals form small, solid hemispherical heads while others are small, cone-shaped structures that are not attached to the seabed. The surface of the coral consists of long meandering walls with wide intervening valleys. The polyps sit in corallites (stony cups) in the valleys from which fine septae (transverse ridges) extend in several series up to the summit of the walls on either side. Often the whole coral consists of one long, convoluted valley, sometimes with side valleys. Where there is more than one valley, the intervening walls have grooves running along the top. The colour of this coral is yellowish-brown, tan or dark brown, often with the valleys and walls being contrasting colours. The polyps are only extended at night and their oral surfaces are often green.[2][3][4]

Distribution and habitat [edit]

Manicina areolata is found in the Caribbean Sea, the Bahamas and Florida. The massive form is found on reefs attached to rocks but the unattached form is found on areas of broken coral fragments and on sandy or muddy substrates including lagoons and turtle grass (Thalassia testudinum) meadows.[3] The depth range of this coral is from 1 to 65 metres (200 feet).[2]

Biology [edit]

The unattached cone-shaped form of Manicina areolata can right itself if overturned by a fish, current or wave action. It does this by inflating itself by filling its interior with water and then emitting jets of water on one side to make the whole structure topple over. It is a slow process and is more difficult to achieve as the coral grows larger. This may be the reason that this coral seldom exceeds a diameter of 10 centimetres (3.9 in).[5] This coral can rid itself of sediment that threatens to engulf it by producing mucus and sloughing this and the sediment that adheres to it like a skin.[2] The tissues of this coral contain symbiotic unicellular algae called zooxanthella.[1]

Manicina areolata is a hermaphrodite, the gametes are produced around the time of the full moon in May and June. Fertilisation is internal and the larvae are brooded inside the colony for two weeks before being released simultaneously on the night of the new moon. The larvae may drift planktonically or settle immediately.[5]

References [edit]

  1. ^ a b van der Land, Jacob (2012). "Manicina areolata (Linnaeus, 1758)". World Register of Marine Species. Retrieved 2012-11-15. 
  2. ^ a b c Colin, Patrick L. (1978). Marine Invertebrates and Plants of the Living Reef. T.F.H. Publications. p. 251–254. ISBN 0-86622-875-6. 
  3. ^ a b "Rose coral (Manicina areolata)". Interactive Guide to Caribbean Diving. Marine Species Identification Portal. Retrieved 2012-11-15. 
  4. ^ "Manicina areolata (Linnaeus 1758)". Coralpedia. Retrieved 2012-11-15. 
  5. ^ a b Johnson, Kenneth. "Manicina areolata (rose coral)". Natural History Museum. Retrieved 2012-11-15. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!