Articles on this page are available in 1 other language: Spanish (12) (learn more)

Overview

Brief Summary

Biology

zooxanthellate
  • UNESCO-IOC Register of Marine Organisms
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Biology: Skeleton

More info
AuthorSkeleton?Mineral or Organic?MineralPercent Magnesium
Cairns, Hoeksema, and van der Land, 1999 YES MINERAL ARAGONITE
Veron, 2000 YES MINERAL ARAGONITE
den Hartog, 1980 YES MINERAL ARAGONITE
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Hexacorallians of the World

Source: Hexacorallians of the World

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

This species occurs in the Caribbean, southern Gulf of Mexico, Florida, the Bahamas, and Bermuda.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Widespread distribution in the tropical western Atlantic, including the Gulf of Mexico, southern Florida, Bahamas, NW Caribbean, Puerto Rico, lesser Antilles and Curacao.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species is found in shallow, intermediate and deep fore reef environments, from 1-65 m, but is most common from 10-25 m (Goreau and Wells, 1967; A. Bruckner and B. Precht pers. comm.). It occasionally occurs in patch reefs in lagoon environments. It can form large monoclonal colonies at intermediate depths.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat Type: Marine

Comments: Overall depth range from 1-65 m, but typically occurs between 3-30 m on patch reefs, fringing reefs and bank reefs.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 298 specimens in 1 taxon.
Water temperature and chemistry ranges based on 256 samples.

Environmental ranges
  Depth range (m): 0 - 82.5
  Temperature range (°C): 25.995 - 27.978
  Nitrate (umol/L): 0.115 - 2.416
  Salinity (PPS): 35.295 - 36.556
  Oxygen (ml/l): 4.285 - 4.721
  Phosphate (umol/l): 0.027 - 0.239
  Silicate (umol/l): 0.805 - 4.607

Graphical representation

Depth range (m): 0 - 82.5

Temperature range (°C): 25.995 - 27.978

Nitrate (umol/L): 0.115 - 2.416

Salinity (PPS): 35.295 - 36.556

Oxygen (ml/l): 4.285 - 4.721

Phosphate (umol/l): 0.027 - 0.239

Silicate (umol/l): 0.805 - 4.607
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

SEDENTARY

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 to >300

Comments: Information is needed on the number of occurrences in the tropical western Atlantic.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

1000 - 2500 individuals

Comments: Restricted to reef communities such as patch reefs, spur and groove reefs, fringing reefs, transitional reefs and intermediate reefs.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

A90GHI01FCUS: susceptible to bleaching (loss of zooxanthellae) due to adverse environmental conditions. A92COL01FCUS: high salinity tolerance (48 ppt for 24 h). A82BAK02FCUS: moderately aggressive in interspecific competition.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Reproduction

A84ROG00FCUS: low reported recruitment rates but little information on reproductive ecology from resources consulted.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Eusmilia fastigiata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

ACTGCTTTTAGTGTGCTTATACGATTGGAGTTATCTGCGCCAGGCGCTATGTTAGGTGAT---GATCATCTTTATAATGTAATTGTAACAGCACATGCTTTTATTATGATTTTTTTTTTAGTAATGCCGGTTATGATTGGGGGATTTGGAAATTGGTTAGTGCCACTATATATTGGGGCACCGGATATGGCGTTTCCCCGATTAAATAATATTAGTTTTTGGTTATTACCGCCTGCTTTGCTTTTATTGTTAGGTTCTGCTTTTGTTGAACAAGGTGCAGGAACGGGATGAACGGTTTATCCTCCTCTTTCTGATATTTATGCTCATTCTGGGGGTTCTGTTGATATGGCTATCTTTAGTCTTCATTTAGCTGGGGCTTCTTCTATCTTAGGAGCTATAAATTTTATTACAACGATTTTTAACATGCGAGCTCCTGGTGTTTCTTTTAATAGAATGCCTTTGTTTGTTTGGTCTATTTTAATAACTGCTTTTTTATTGCTTTTATCTTTGCCTGTATTGGCGGGTGCAATCACTATGTTGTTAACAGATCGAAATTTTAATACAACTTTTTTTGATCCTTCTGGAGGTGGAGATCCTATTTTATTCCAACATTTATTTTGGTTTTTTGGGCAT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Eusmilia fastigiata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Genomic DNA is available from 1 specimen with morphological vouchers housed at Australian Museum, Sydney
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Aronson, R., Bruckner, A., Moore, J., Precht, B. & E. Weil

Reviewer/s
Livingstone, S., Polidoro, B. & Smith, J. (Global Marine Species Assessment)

Contributor/s

Justification
The most important known threat for this species is extensive reduction of coral reef habitat due to a combination of threats. Specific population trends are unknown but population reduction can be inferred from estimated habitat loss (Wilkinson 2004). It is widespread in the Caribbean and common throughout its range and therefore is likely to be more resilient to habitat loss and reef degradation because of an assumed large effective population size that is highly connected and/or stable with enhanced genetic variability. Therefore, the estimated habitat loss of 10% from reefs already destroyed within its range is the best inference of population reduction since it may survive in coral reefs already at the critical stage of degradation (Wilkinson 2004). This inference of population reduction over three generation lengths (30 years) does not meet the threshold of a threat category and this species is Least Concern. However, because of predicted threats from climate change and ocean acidification it will be important to reassess this species in 10 years or sooner, particularly if the species is also observed to disappear from reefs currently at the critical stage of reef degradation.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G3 - Vulnerable

Reasons: Widespread distribution in the tropical western Atlantic but restricted to reef communities. Characterized by moderate sensitivity to sedimentation and high salinity tolerance.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
This species is usually common at low abundances in most fore reef environments throughout the wider Caribbean; in some areas especially the southern Caribbean can be locally abundant.

There is no species specific population information available for this species. However, there is evidence that overall coral reef habitat has declined, and this is used as a proxy for population decline for this species. This species is more resilient to some of the threats faced by corals and therefore population decline is estimated using the percentage of destroyed reefs only (Wilkinson 2004). We assume that most, if not all, mature individuals will be removed from a destroyed reef and that on average, the number of individuals on reefs are equal across its range and proportional to the percentage of destroyed reefs. Reef losses throughout the species' range have been estimated over three generations, two in the past and one projected into the future.

The age of first maturity of most reef building corals is typically three to eight years (Wallace 1999) and therefore we assume that average age of mature individuals is greater than eight years. Furthermore, based on average sizes and growth rates, we assume that average generation length is 10 years, unless otherwise stated. Total longevity is not known, but likely to be more than ten years. Therefore any population decline rates for the Red List assessment are measured over at least 30 years. Follow the link below for further details on population decline and generation length estimates.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Short Term Trend: Relatively stable (=10% change)

Comments: Information is needed on the status and trend of extant populations.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
This species is highly susceptible to white plague and bleaching with localized mortalities reported; also susceptible to overgrowth and smothering by macroalgae (e.g., Dictyota and Halimeda) (Hughes 1994). At shallow depths it is susceptible to breakage by hurricanes and high sedimentation. Localized predation by Sparisoma virdie (Stoplight Parrotfish).

In general, the major threat to corals is global climate change, in particular, temperature extremes leading to bleaching and increased susceptibility to disease, increased severity of ENSO events and storms, and ocean acidification.

Coral disease has emerged as a serious threat to coral reefs worldwide and a major cause of reef deterioration (Weil et al. 2006). The numbers of diseases and coral species affected, as well as the distribution of diseases have all increased dramatically within the last decade (Porter et al. 2001, Green and Bruckner 2000, Sutherland et al. 2004, Weil 2004). Coral disease epizootics have resulted in significant losses of coral cover and were implicated in the dramatic decline of acroporids in the Florida Keys (Aronson and Precht 2001, Porter et al. 2001, Patterson et al. 2002). In the Indo-Pacific, disease is also on the rise with disease outbreaks recently reported from the Great Barrier Reef (Willis et al. 2004), Marshall Islands (Jacobson 2006) and the northwestern Hawaiian Islands (Aeby 2006). Increased coral disease levels on the GBR were correlated with increased ocean temperatures (Willis et al. 2007) supporting the prediction that disease levels will be increasing with higher sea surface temperatures. Escalating anthropogenic stressors combined with the threats associated with global climate change of increases in coral disease, frequency and duration of coral bleaching and ocean acidification place coral reefs in the Indo-Pacific at high risk of collapse.

Localized threats to corals include fisheries, human development (industry, settlement, tourism, and transportation), changes in native species dynamics (competitors, predators, pathogens and parasites), invasive species (competitors, predators, pathogens and parasites), dynamite fishing, chemical fishing, pollution from agriculture and industry, domestic pollution, sedimentation, and human recreation and tourism activities.

The severity of these combined threats to the global population of each individual species is not known.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Degree of Threat: C : Not very threatened throughout its range, communities often provide natural resources that when exploited alter the composition and structure over the short-term, or communities are self-protecting because they are unsuitable for other uses

Comments: Considered less threatened due to high salinity tolerance and moderate sediment-rejection capabilities.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Listed on CITES Appendix II. In the US, it is present in many MPAs, including Florida Keys National Marine Sanctuary, Biscayne N.P., Dry Tortugas National Park, and Buck Island Reef National Monument. Also present in Hol Chan Marine Reserve (Belize), Exuma Cays Land and Sea Park (Bahamas). In US waters, it is illegal to harvest corals for commercial purposes.

All corals are listed on CITES Appendix II.

Recommended measures for conserving this species include research in taxonomy, population, abundance and trends, ecology and habitat status, threats and resilience to threats, restoration action; identification, establishment and management of new protected areas; expansion of protected areas; recovery management; and disease, pathogen and parasite management. Artificial propagation and techniques such as cryo-preservation of gametes may become important for conserving coral biodiversity.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biological Research Needs: Data needed on reproductive ecology and recruitment patterns. Information needed on susceptibility to eutrophication.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Protection: Few to several (1-12) occurrences appropriately protected and managed

Comments: Numerous occurrences in the Florida Keys National Marine Sanctuary, Biscayne National Park and Dry Tortugas, Florida.

Needs: Mooring buoys need to be installed in marine protected areas.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Eusmilia

Eusmilia is a genus of stony coral (Scleractinia) in the family Meandrinidae. It is a monotypic genus: the only species is Eusmilia fastigiata, the smooth flower coral. It is found on reefs in the Caribbean area.

Description[edit]

Smooth flower coral is a colonial species that grows to about 50 centimetres (20 in) across. It forms a low mound of stony calcium carbonate, the surface of which is covered with tubular projections, the corallites, in groups of one to three. The polyps protrude from these and are either round or oval, with the oval form being more common at moderate depths. They are large and widely spaced and are connected by a layer of translucent, jelly-like mesoglea tissue called coenenchyme which covers the surface of the carbonate skeleton. During the day they are retracted back into the cup-shaped corallites. These have large smooth-edged ridges called septa, and the polyps have corresponding grooves at their base. At night, the polyps stretch out their translucent white tentacles to feed and the coral "flowers".[3][4] It is usually cream, yellow or pale brown, often with a green or pink tinge.[3][4]

Distribution and habitat[edit]

Smooth flower coral is found in the Caribbean, the Gulf of Mexico, the Bahamas and southern Florida, at depths down to about 60 metres (200 ft) though it is commonest between 5 and 30 metres (16 and 98 ft). It is found on both the back and the front edges of reefs and is sometimes overhung by larger corals.[3][5] It is listed as being of least concern by the IUCN Red List of Threatened Species as it is common throughout its range and locally abundant in the south Caribbean.[6]

Biology[edit]

The polyps remain retracted in the skeleton during the day but extend at night to feed. The tentacles search for zooplankton and small invertebrates which are transferred to the mouth. Another major source of energy is the result of the symbiotic dinoflagellates which live within the coenchyme and which produce nutrients by photosynthesis. The coral benefits from the carbohydrates produced and the algae use the coral's nitrogenous waste products.[7]

Reproduction[edit]

Reproduction in corals takes place when gametes are released into the water. The fertilized egg develops into a planula larva which forms part of the zooplankton and drifts with the current. After passing through a number of larval stages this settles on the sea bed and undergoes metamorphosis into a polyp. The base of this secretes the calcium carbonate skeleton and the polyp founds a new colony, producing new polyps by budding.[7]

References[edit]

  1. ^ WoRMS (2010). "Eusmilia". World Register of Marine Species. Retrieved 2012-07-07. 
  2. ^ a b Cairns, Stephen (2010). "Eusmilia fastigiata (Pallas, 1766)". World Register of Marine Species. Retrieved 2012-07-07. 
  3. ^ a b c Colin, Patrick L. (1978). Marine Invertebrates and Plants of the Living Reef. T.F.H. Publications. p. 291. ISBN 0-86622-875-6. 
  4. ^ a b "Eusmilia fastigiata". Coralpedia. Retrieved 2012-07-08. 
  5. ^ "Smooth flower coral (Eusmilia fastigiata)". Marine Species Information Portal. Retrieved 2012-07-08. 
  6. ^ "Eusmilia fastigiata". IUCN Red List of Threatened Species. Retrieved 2012-07-08. 
  7. ^ a b Dorit, Robert L.; Walker, Warren F. Jr.; Barnes, Robert D. (1991). Zoology. Saunders College Publishing. p. 612. ISBN 0-03-030504-7. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Zlatarski and Estalella (1982) recognize 2 forma for this species: typica and guacanayabensis forma n. Wells and Lang (1972) lists two forms, typica and flabellata.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!