Overview

Comprehensive Description

Biology

Found on the outer shelf and upper slope (Ref. 5578), on soft bottoms (Ref. 9914) at depths of 275-680 m (Ref.58048). Benthic (Ref. 58302). Feeds on small pelagic fish, eels, crabs, shrimp, lobsters, cephalopods and polychaete worms (Ref. 5578). The specimen taken from a depth of 44 m was caught off Mozambique (Ref. 9914). Its sting is long and can inflict a painful wound if handled. Caught occasionally by demersal longline fisheries in deepwater. Utilized for its meat, but not of a particularly high value (Ref.58048).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

Sporadic distribution in the Indo-Pacific. The species has mainly been collected from tropical Australia (Last and Stevens 1994).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Mozambique, South Africa (country)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Indo-Pacific: South Africa, Mozambique, southern India, east to the Philippines (Ref. 5281), north to Japan and south to Australia. Also reported from the Hawaiian Islands.
  • Compagno, L.J.V. and P.R. Last 1997 Plesiobatidae. Giant stingaree. p. 1467-1468. In K.E. Carpenter and V.H. Niem (eds.) FAO species identification guide for fishery purposes. The living marine resources of the Western Central Pacific. Vol. 3. Batoid fishes, chimaeras and bony fishes. Part 1 (Elopidae to Linophrynidae). FAO, Rome. (Ref. 9914)   http://www.fishbase.org/references/FBRefSummary.php?id=9914&speccode=7376 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 0
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 2700 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

270 cm TL (male/unsexed; (Ref. 3263))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Description

An apparently rare ray (Ref. 5213) that occurs in deeper water beyond the reef. Inhabits soft bottoms (Ref. 9914). Feeds on fishes, crabs, shrimp, lobsters, and cephalopods (Ref. 9914). Disc width about 150 cm. Caught using deepset longlines and bottom trawls (Ref. 9914). The shallow occurence at 44 m comes from shelf record off Mozambique (Ref. 9914).
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

A giant plain stingray with a broadly pointed snout, small eyes and a round disc; tail short with a long caudal fin and a narrow sting; upper surface covered with denticles (Ref. 5578). Grey-black to brownish or purplish-brown above, white below; rear edges of pelvic fins and tail grey; disc edges black, and sting light (Ref. 5578).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
The largest and most widespread stingaree which lives in deeper water than any of its relatives in the family Urolophidae (Last and Stevens 1994). An upper continental slope species on soft substrates, generally at depths of 275 to 680 m (350 to 680 m in Australia), however there is a single record from 44 m on the continental shelf off Mozambique (Last and Stevens 1994, Compagno and Last 1999).

Like most other deepwater batoids, the biology of Plesiobatis daviesi is poorly known. Probably viviparous but details of reproduction unknown. Its large size and deepwater occurrence suggests a probable small litter size and long gestation period, resulting in a slow biology (L.J.V. Compagno pers. comm.). Ebert et al. (2002) report a juvenile female at 189 cm TL and an adolescent female at 201 cm TL. Smallest examined mature male was 130 cm TL (Last and Stevens 1994). Maximum size at least 200 cm TL in Australia and elsewhere reported to 270 cm TL (Last and Stevens 1994). Consistent with geographic variability in maximum size, size at maturity probably also varies regionally. Size at birth is unknown, however Compagno and Last (1999) report that a 50 cm TL freeliving individual had an umbilical scar.

Diet consists of fishes (including mesopelagic species suggesting that this species may migrate into the water column to feed), crustaceans (crabs, penaeid prawns, lobsters) and cephalopods (Compagno and Last 1999, Ebert et al. 2002).

Life history parameters
Age at maturity (years): Unknown.
Size at maturity (total length/disc width): 201 cm TL (116 cm DW) or more (Southern Africa; Ebert et al. 2002) (female); 130 cm TL or less (Australia; Last and Stevens 1994) (male).
Longevity (years): Unknown.
Maximum size (total length): At least 200 cm TL (Australia); 270 cm TL elsewhere (Last and Stevens 1994).
Size at birth: Less than 50 cm TL (Compagno and Last 1999).
Average reproductive age (years): Unknown.
Gestation time (months): Unknown.
Reproductive periodicity: Unknown.
Average annual fecundity or litter size: Unknown.
Annual rate of population increase: Unknown.
Natural mortality: Unknown.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 15 specimens in 1 taxon.
Water temperature and chemistry ranges based on 6 samples.

Environmental ranges
  Depth range (m): 185 - 769
  Temperature range (°C): 5.897 - 12.730
  Nitrate (umol/L): 14.004 - 30.247
  Salinity (PPS): 34.122 - 34.998
  Oxygen (ml/l): 2.162 - 4.384
  Phosphate (umol/l): 0.998 - 2.220
  Silicate (umol/l): 8.114 - 54.593

Graphical representation

Depth range (m): 185 - 769

Temperature range (°C): 5.897 - 12.730

Nitrate (umol/L): 14.004 - 30.247

Salinity (PPS): 34.122 - 34.998

Oxygen (ml/l): 2.162 - 4.384

Phosphate (umol/l): 0.998 - 2.220

Silicate (umol/l): 8.114 - 54.593
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 44 - 680m.
From 44 to 680 meters.

Habitat: bathydemersal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

bathydemersal; marine; depth range 44 - 780 m (Ref. 58302), usually 275 - 680 m (Ref. 9914)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Found on the outer shelf and upper slope (Ref. 5578), on soft bottoms (Ref. 9914). Feeds on small pelagic fish, eels, crabs, shrimp, lobsters, cephalopods and polychaete worms.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Plesiobatis daviesi

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBGC0962-06|AY597334|Plesiobatis daviesi| AATCGTTGATTATTTTCTACCAATCACAAAGACATTGGCACCCTTTATTTAATCTTTGGTGCATGGGCAGGAATAGTGGGTACCGGCCTC---AGCCTCTTAATTCGAACAGAGCTAAGCCAACCGGGGGCTTTATTAGGGGAT---GATCAAATCTATAATGTGCTCGTAACCGCTCATGCCTTTGTAATAATCTTCTTTATAGTTATACCAATTATAATCGGCGGGTTCGGCAATTGATTAGTTCCCTTAATA---ATCGGCGCCCCGGACATAGCCTTCCCGCGAATAAACAACATAAGTTTCTGACTCCTTCCTCCCTCTTTTCTCTTATTACTAGCTTCCGCAGGGGTAGAAGCCGGAGCTGGCACAGGATGAACCGTTTACCCCCCATTAGCTGGAAATCTAGCACATGCCGGAGCTTCCGTGGACTTA---GCCATTTTTTCCTTACATCTAGCAGGGGCCTCCTCTATTATAGCATCAATTAATTTTATTACTACGATCATTAATATGAAACCACCCGCGATCTCCCAATACCAAACGCCTCTTTTTGTTTGATCTATTCTCATTACAACTGTCCTTCTTTTATTGTCCCTTCCTGTCCTAGCAGCA---GGCATCACCATACTCCTCACAGACCGCAATCTTAACACAACTTTCTTTGACCCCGCTGGAGGAGGAGACCCCATTCTCTATCAACACCTCTTTTGATTTTTCGGACACCCAGAAGTATATATCCTAATCCTTCCTGGCTTTGGTATAATTTCCCATGTAGTCGCGTATTATTCTGGAAAAAAA---GAACCTTTTGGTTATATAGGTATAGTTTGAGCAATAATAGCTATCGGCCTTCTTGGCTTTATTGTTTGAGCCCATCATATATTCACAGTAGGTATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Plesiobatis daviesi

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Species: 8
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2006

Assessor/s
White, W.T., Kyne, P.M. & Holtzhausen, H.

Reviewer/s
Fowler, S.L., Compagno, L.J.V. & Cavanagh, R.D.

Justification
Plesiobatis daviesi is demersal on the continental slope in depths of 275?680 m (and occasionally in shelf waters) with a sporadic and patchy distribution in the Indo-Pacific (Southern Africa, India, Indonesia, Australia, South China Sea, Japan and Hawaii). Biology is poorly known and research needs to elucidate the relationship between different populations. The giant stingaree is occasionally caught in local deepwater trawl and longline fisheries, is only landed in low numbers and deepwater fishing is usually relatively restricted within most of its range. In Indonesia, only a small deepwater longline fishery operates between 300 and 600 m and the species is thus not taken in any great quantities compared to other elasmobranch species (W. White, pers. obs). Similarly the deepwater fishery in Taiwan only catches low numbers of this species (D. Ebert pers. comm). In Australian waters, there is minimal fishing pressure on the species? range off Western Australia and Queensland. This species is assessed as Least Concern due to the limited number of slope fisheries presently throughout much of its range. However, the large size of this species and low number of records indicate low productivity, hence poor resilience to fisheries, and possible rarity; further expansion of deepwater fisheries within its range in the future could pose a potential threat, at which time its conservation status would need reassessing.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
It is reported to be locally common (Compagno and Last 1999), which may be the case off tropical Australia, however the generally low numbers of records elsewhere may indicate rarity.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
Available specific data are lacking, the species is known to be taken in deepwater benthic trawls and on deepset longlines. Not targeted and not known to be taken in any considerable numbers in any one region within its range, although it can be taken regularly by longliners off KwaZulu-Natal (L.J.V. Compagno pers. comm.). In Indonesia, only a small deepwater longline fishery operates between 300?600 m and the species is thus not taken in any great quantities compared to other elasmobranch species (W. White, pers. obs). Similarly the deepwater fishery in Taiwan only catches low numbers of this species (D Ebert pers. comm.).

In Australian waters, there is minimal fishing pressure on the species? range off Western Australia and Queensland. The Commonwealth managed Western Trawl Fisheries (continental slope off Western Australia) is comprised of two small-scale demersal trawl fisheries managed by limited entry with a total of 18 permits (over a wide geographical area) (AFMA 2003a). The Commonwealth managed Coral Sea Fishery (off the Queensland continental shelf) is a small-scale fishery with a demersal line sector (nine permits) and a trawl sector (two permits). The fishery is managed by limited entry and catch and effort by these sectors is very low (most operators fish a maximum of 20 days per year) (AFMA 2003b).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Further information is required from catches of this species in order to better define its distribution and obtain life history data. Bycatch in globally expanding deepwater fisheries needs to be documented and monitored.

The development and implementation of management plans (national and/or regional e.g., under the FAO International Plan of Action for the Conservation and Management of Sharks: IPOA?Sharks) are required to facilitate the conservation and sustainable management of all chondrichthyan species in the region. See Anon. (2004) for an update of progress made by nations in the range of P. daviesi.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Deepwater stingray

The deepwater stingray or giant stingaree (Plesiobatis daviesi) is a species of stingray and the sole member of the family Plesiobatidae. It is widely distributed in the Indo-Pacific, typically over fine sediments on the upper continental slope at depths of 275–680 m (900–2,230 ft). This species reaches 2.7 m (8.9 ft) in length and 1.5 m (4.9 ft) in width. It has an oval pectoral fin disc with a long, flexible, broad-angled snout. Most of the entire latter half of its tail supports a distinctively long, slender, leaf-shaped caudal fin. Its coloration is dark above and white below, and its skin is almost completely covered by tiny dermal denticles.

Preying on crustaceans, cephalopods, and bony fishes, the deepwater stingray may hunt both on the sea floor and well above it in open water. It is probably aplacental viviparous, with the mother supplying her gestating young with histotroph ("uterine milk"). Captured rays merit caution due to their long, venomous stings. This species is taken by deepwater commercial fisheries, but in numbers too small to significantly threaten its population. Therefore, the International Union for Conservation of Nature (IUCN) has assessed it as Least Concern.

Contents

Taxonomy and phylogeny

The first scientific description of the deepwater stingray was authored by John H. Wallace, as part of a 1967 Investigational Report from the Oceanographic Research Institute (ORI), Durban. He named the new species daviesi in honor of David H. Davies, the late Director of the ORI, and placed it in the genus Urotrygon based on its long, low caudal fin and lack of a dorsal fin. The type specimens were collected during September 1996 near the Limpopo River mouth in Mozambique: the holotype is a mature male 92 cm (36 in) across, and the paratype is an immature male 33 cm (13 in) across.[3] Other common names for this species include Davies' stingray and giant stingray.[4]

In a 1990 morphological phylogenetic study, Kiyonori Nishida concluded that the deepwater stingray and the sixgill stingray (Hexatrygon bickelli) were the most basal stingrays (suborder Myliobatoidei). Therefore, he moved this species to its own genus, Plesiobatis, and family, Plesiobatidae; the name is derived from the Greek plesio ("primitive") and batis ("ray").[5] Subsequent morphological studies have corroborated the basal position of Plesiobatis, but disagreed on its relationships to nearby taxa. John McEachran, Katherine Dunn, and Tsutomu Miyake in 1996 could not fully resolve the position of Plesiobatis, and thus assigned it provisionally to the family Hexatrygonidae.[6] McEachran and Neil Aschliman in 2004 found Plesiobatis to be the sister taxon of Urolophus, and recommended that it be placed in the family Urolophidae.[7] Until the phylogeny is better-resolved, authors have tended to preserve the family Plesiobatidae.[2][8]

Distribution and habitat

Records of the deepwater stingray come from a number of locations scattered widely in the Indo-Pacific: KwaZulu-Natal in South Africa and Mozambique, the Gulf of Mannar, the northern Andaman Islands, the South China Sea, the Ryukyu Islands and the Kyushu-Palau Ridge, northwestern Australia from the Rowley Shoals to Shark Bay, northeastern Australia from Townsville to Wooli, New Caledonia, and Hawaii.[1][9][10][11] This bottom-dwelling species generally inhabits the upper continental slope at depths of 275–680 m (900–2,230 ft), over muddy or silty substrates.[11] There is an anomalous record from only 44 m (144 ft) deep off Mozambique. It seems to be locally common in tropical Australian waters, but may be rarer elsewhere.[1]

Description

The deepwater stingray has a flabby body,[11] with enlarged pectoral fins forming a disc usually longer than it is wide. The leading margins of the disc converge at a broad angle. The snout is thin and measures over six times as long as the diameter of the orbit; the snout tip protrudes slightly from the disc. The small eyes are positioned just ahead of the spiracles, which have angular posterior rims. The large, circular nostrils are placed closed to the mouth, to which they are connected by a pair of broad grooves. Between the nostrils is a broad curtain of skin with a strongly fringed posterior margin. The wide, straight mouth contains 32–60 tooth rows in either jaw, increasing in number with age. Each tooth is small with a low, blunt cusp; in adult males the teeth at the center are sharp and backward-pointing. The five pairs of gill slits are small and placed beneath the disc.[2][10]

The pelvic fins are small and have blunt outer corners. The moderately thick tail measures 93–102% as long as the disc and lacks lateral skin folds and dorsal fins. One or two serrated stinging spines are present atop the tail, just ahead of the halfway point. The slender caudal fin originates a short distance behind the sting; it is symmetrical above and below, and terminates in a rounded leaf-like shape. The skin is densely covered by fine dermal denticles, that become sparse to absent on the pelvic fins, towards the ventral disc margin, and around the mouth. The deepwater stingray is purplish brown to blackish above; some rays also have irregular darker blotches and spots. The underside is white, with a narrow dark border along the lateral disc margins. The tail is entirely dark, and the caudal fin is black. This large species grows up to 2.7 m (8.9 ft) long, 1.5 m (4.9 ft) across, and 118 kg (260 lb) in weight off southern Africa, though it is not known to exceed 2 m (6.6 ft) long off Australia.[2][3][10]

Biology and ecology

The kitefin shark is known to attack the deepwater stingray.

The diet of the deepwater stingray consists of cephalopods, crustaceans (including penaeid prawns, crabs, and lobsters), and bony fishes (including eels).[1][4] Its long, flexible snout is well-suited for rooting through sediment, while the presence of mesopelagic species in its diet suggest that it may also hunt well above the sea floor.[11] One recorded individual was found severely gouged by kitefin sharks (Dalatias licha), which are capable of excising plugs of flesh, cookiecutter-like, from larger animals.[2] The deepwater stingray is presumed to be similar to other stingrays in being aplacental viviparous, and having the developing embryos nourished by maternally produced histotroph ("uterine milk"). Given its large size and deepwater habits, it is probably not highly prolific, with a small litter size and a long gestation period. The young are apparently born at close to 50 cm (20 in) long, as evidenced by the capture of a free-living specimen of that size that still bore a yolk sac scar. Males and females mature sexually at 1.30–1.72 m (4.3–5.6 ft) and 1.89–2.00 m (6.2–6.6 ft) long respectively. The maximum size, and likely also the maturation size, varies between geographic regions.[1][2][10]

Human interactions

When captured, the deepwater stingray flails its powerful tail violently, and its long, venomous sting can inflict a serious injury to a fishery worker. It is caught incidentally by deepwater bottom trawls and longlines; the meat may be sold but is poorly regarded.[10][11] None of the deepwater commercial fisheries operating within its range (including those off South Africa, Taiwan, Indonesia and Australia) are extensive, and thus only small numbers of deepwater stingrays are landed. As a result, the International Union for Conservation of Nature (IUCN) has determined this species to be minimally threatened by human activity, and listed it under Least Concern. However, should deepwater fisheries expand in the future, it may be susceptible to depletion due to its probable rarity and low reproductive rate.[1]

References

  1. ^ a b c d e f White, W.T.; Kyne, P.M.; Holtzhausen, H. (2006). "Plesiobatis daviesi". IUCN Red List of Threatened Species. Version 2010.4. International Union for Conservation of Nature. http://www.iucnredlist.org/apps/redlist/details/60111. Retrieved July 16, 2011. 
  2. ^ a b c d e f Last, P.R.; Stevens, J.D. (2009). Sharks and Rays of Australia (second ed.). Harvard University Press. p. 394–395. ISBN 0-674-03411-2. 
  3. ^ a b Wallace, J.H. (1967). The batoid fishes of the east coast of southern Africa. Part 2: manta, eagle, duckbill, cownose, butterfly and sting rays. Investigational Report. Oceanographic Research Institute Durban No. 16: 1–56.
  4. ^ a b Froese, Rainer, and Daniel Pauly, eds. (2011). "Plesiobatis daviesi" in FishBase. April 2011 version.
  5. ^ Nishida, K. (December 1990). "Phylogeny of the suborder Myliobatidoidei". Memoirs of the Faculty of Fisheries Hokkaido University 37 (1/2): 1–108. http://eprints.lib.hokudai.ac.jp/dspace/bitstream/2115/21887/1/37(1_2)_P1-108.pdf. 
  6. ^ McEachran, J.D.; Dunn, K.A.; Miyake, T. (1996). "Interrelationships within the batoid fishes (Chondrichthyes: Batoidea)". In Stiassney, M.L.J.; Parenti, L.R.; Johnson, G.D.. Interrelationships of Fishes. Academic Press. pp. 63–84. ISBN 0-12-670951-3. 
  7. ^ McEachran, J.D.; Aschliman, N. (2004). "Phylogeny of Batoidea". In Carrier, L.C.; Musick, J.A.; Heithaus, M.R.. Biology of Sharks and Their Relatives. CRC Press. pp. 79–113. ISBN 0-8493-1514-X. 
  8. ^ Nelson, J.S. (2006). Fishes of the World (fourth ed.). John Wiley. pp. 77–78. ISBN 0-471-25031-7. 
  9. ^ Akhilesh, K.V.; Manjebrayakath, H.; Ganga, U.; Pillai, N.G.K.; Sebastine, M. (July-December 2009). "Morphometric characteristics of deepwater stingray Plesiobatis daviesi (Wallace, 1967) collected from the Andaman Sea". Journal of the Marine Biological Association of India 51 (2): 246–249. http://eprints.cmfri.org.in/2179/1/246-249-K._V._Akhilesh.pdf. 
  10. ^ a b c d e Compagno, L.J.V.; Last, P.R. (1999). "Plesiobatidae. Giant stingaree". In Carpenter, K.E.; Niem, V.H.. FAO Identification Guide for Fishery Purposes. The Living Marine Resources of the Western Central Pacific. Food and Agricultural Organization of the United Nations. pp. 1467–1468. ISBN 92-5-104302-7. 
  11. ^ a b c d e Last, P.R.; White, W.T.; Caire, J.N.; Dharmadi; Fahmi; Jensen, K.; Lim, A.P.F.; Manjaji-Matsumoto, B.M.; Naylor, G.J.P.; Pogonoski, J.J.; Stevens, J.D.; Yearsley, G.K. (2010). Sharks and Rays of Borneo. CSIRO Publishing. pp. 180–181. ISBN 978-1-921605-59-8. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!